The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	1146289	1193576	4923339	integrase,transposase	Escherichia_phage(40.0%)	40	1187744:1187758	1201105:1201119
WP_001067855.1|1146289_1146994_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000173534.1|1147970_1148486_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
WP_011011078.1|1148482_1149415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|1149470_1150250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429174.1|1150597_1150897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|1151887_1153096_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|1153461_1154667_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|1155110_1155431_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|1155423_1155810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447544.1|1155817_1156504_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|1156481_1157108_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|1157186_1158392_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_085983317.1|1159983_1161146_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1161424_1163407_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1163403_1164042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682341.1|1165755_1166352_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_010989066.1|1166929_1168213_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1168472_1170347_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1170512_1171388_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1172504_1174184_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1174406_1175948_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1176077_1176920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603456.1|1176919_1177483_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1177506_1178142_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1178215_1179418_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1179712_1180726_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098984.1|1180736_1181717_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1181713_1182088_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1182084_1182606_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1182718_1183003_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1183097_1183454_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1183607_1184426_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520831.1|1184470_1185754_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001520307.1|1186174_1188244_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
1187744:1187758	attL	GGTGATGGCGGTGAC	NA	NA	NA	NA
WP_000701821.1|1188279_1188495_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1188945_1189773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1190107_1191301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1191690_1192284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542209.1|1192330_1192498_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|1192511_1193576_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
1201105:1201119	attR	GGTGATGGCGGTGAC	NA	NA	NA	NA
>prophage 2
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	1249601	1324987	4923339	integrase,capsid,lysis,terminase,head,transposase,tail,holin,portal,protease,tRNA	Salmonella_phage(43.1%)	88	1241682:1241698	1330834:1330850
1241682:1241698	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1249601_1250639_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1250754_1251444_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1251762_1252146_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1252207_1252795_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1252897_1253797_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1253814_1255149_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1255279_1256017_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1256001_1257624_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1257887_1258052_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1258048_1258624_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1258655_1259306_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1259305_1260262_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1260258_1260738_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1261235_1262465_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1262442_1262727_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1262767_1263007_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1263049_1264207_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1264169_1267097_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1267223_1267574_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1267595_1267754_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1268152_1268557_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1268686_1268923_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1268888_1269263_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1269347_1270331_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1270333_1271083_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1271093_1271441_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1271437_1271962_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1271961_1272435_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1273299_1273539_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001574100.1|1273528_1273834_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929803.1|1273873_1274476_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1274684_1275296_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1275292_1275433_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1275429_1276107_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1276379_1276943_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1277449_1277638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1277852_1278539_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1278814_1279144_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1279127_1279580_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1279597_1280050_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1280285_1280687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1280973_1281519_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1281490_1283422_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1283405_1283609_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1283605_1285186_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1285175_1286672_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1286684_1287032_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1287086_1288115_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1288172_1288532_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1288542_1288926_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1288953_1289532_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1289580_1290711_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1290819_1291221_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1291228_1291975_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1292025_1292421_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1292417_1292756_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1292727_1295823_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1295825_1296155_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1296164_1296863_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1296869_1297607_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1297504_1298152_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1298213_1301576_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1301614_1301857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1301910_1304283_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1304279_1305104_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1305093_1305672_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1305768_1305996_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1306102_1306315_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1306377_1306443_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001526383.1|1307067_1307187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1307899_1308037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1308509_1310003_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1310407_1312207_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1312223_1313198_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1313471_1314152_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1314148_1315054_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|1315065_1315794_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1315805_1316537_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1316536_1316917_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1317028_1317289_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1317326_1318253_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1318368_1319565_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|1319586_1320504_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1320542_1321391_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1321506_1322400_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1322410_1323772_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1323775_1324411_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1324435_1324987_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1330834:1330850	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	1678949	1708542	4923339	protease,holin,tail	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1678949_1679444_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1679857_1680349_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1680338_1680602_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1680598_1683085_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1683091_1683787_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1683773_1684643_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1684758_1685208_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1685217_1685820_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1685840_1686458_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1686454_1687114_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1687165_1687903_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1687899_1688112_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1688108_1688588_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1688584_1690516_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1690512_1691070_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1691066_1692110_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1692153_1692801_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1693530_1694094_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1694285_1694489_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1694791_1695583_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1695879_1696083_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1696251_1698618_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1698946_1699936_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1699950_1700319_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1700347_1701679_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1701975_1702305_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1702897_1704139_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1704141_1704669_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1705046_1705490_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1705543_1707373_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1707720_1708011_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1708038_1708542_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	1780594	1789765	4923339	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1780594_1781542_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1781525_1782257_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1782237_1782345_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1782404_1783136_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1783358_1785044_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1785040_1785760_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1785806_1786274_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1786330_1786861_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1787032_1787491_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1787731_1789765_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	1858073	1868579	4923339		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1858073_1859477_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1859654_1860548_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1860924_1862010_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1862009_1862909_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1862956_1863835_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1863835_1864387_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1864392_1865385_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1865381_1866155_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1866159_1867239_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1867265_1868579_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	1954573	2005260	4923339	integrase,capsid,terminase,head,tail,holin,portal,plate,protease	Salmonella_phage(80.3%)	71	1949151:1949165	1965281:1965295
1949151:1949165	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1954573_1955047_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1955694_1955985_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1956356_1957154_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1957445_1958435_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1958436_1958679_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1958703_1959273_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1959276_1959858_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1959868_1960126_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1960127_1960661_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1960731_1961271_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1961407_1962235_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1962292_1962664_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1963203_1963428_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1963390_1963729_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1963934_1964630_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1964727_1964952_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1964980_1965535_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1965281:1965295	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|1965531_1966674_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1966670_1966895_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|1966891_1967866_+	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|1967862_1968336_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|1968332_1969208_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|1969216_1969606_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|1969622_1970483_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|1970490_1971480_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|1971493_1972246_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1972396_1972654_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1972799_1973186_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|1973172_1973454_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|1973453_1974068_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_151529515.1|1974064_1974457_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	99.2	8.1e-65
WP_001379492.1|1974919_1975252_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|1975302_1975653_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|1975778_1976273_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|1976269_1978003_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|1978014_1978197_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|1978196_1979438_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|1979415_1980066_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|1980080_1981286_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|1981335_1981536_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|1981538_1981862_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|1981858_1982263_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|1982234_1982747_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|1982743_1983301_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|1983322_1983487_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|1983476_1984973_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|1984972_1985329_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|1985325_1985652_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|1985736_1987662_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|1987678_1988128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|1988187_1989528_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|1989524_1990583_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|1990582_1991116_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|1991120_1991534_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|1991526_1992606_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|1992608_1993196_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|1993182_1994745_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|1994714_1995320_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|1995433_1995667_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|1995741_1995855_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|1995902_1996316_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|1996312_1996525_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|1997718_1997880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1998006_1998426_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1998428_1999697_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2000151_2000364_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2000374_2000563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2000823_2002020_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2002669_2002969_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2003060_2003756_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2003829_2005260_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	2109304	2116113	4923339	integrase,tail	Salmonella_phage(33.33%)	11	2111514:2111536	2121229:2121251
WP_000856224.1|2109304_2109535_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2109672_2110047_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2110047_2110923_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2110939_2111293_+	YebY family protein	NA	NA	NA	NA	NA
2111514:2111536	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2111666_2112521_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2112580_2113075_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2113264_2113495_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2113548_2114082_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2114338_2114506_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2114570_2114759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2115231_2116113_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2121229:2121251	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	2902837	2993754	4923339	integrase,lysis,terminase,tail,holin,protease,tRNA	Salmonella_phage(58.7%)	91	2926931:2926950	2990827:2990846
WP_000938191.1|2902837_2903518_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2904138_2904798_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2904884_2905214_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2905210_2905492_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2905540_2906320_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2906345_2906894_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2907108_2908320_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2908377_2908695_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2908739_2909156_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2909326_2909989_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2910083_2910542_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2910577_2912632_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2912755_2913202_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2913220_2915374_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2915360_2915966_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2916182_2916692_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2917048_2918101_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2918172_2918625_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2918810_2920571_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2920639_2921158_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2921257_2921425_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|2921680_2922244_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2922240_2923881_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2923885_2925139_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2925153_2927061_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2926931:2926950	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2927073_2929182_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2929280_2930390_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2930386_2930929_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2931094_2932105_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2932312_2934925_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2935351_2935543_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2935813_2936500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2936484_2936784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2936852_2937479_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2938126_2939095_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2939570_2940152_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2940151_2942590_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2942643_2942886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2942924_2946275_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_001576012.1|2946346_2947051_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2946948_2947686_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2947695_2948391_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2948480_2949014_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2949130_2949628_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2949727_2950060_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2951180_2951726_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2952194_2952641_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_077907023.1|2952658_2953111_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	3.9e-79
WP_001574216.1|2953094_2953424_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2953699_2954386_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2954746_2955196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2955331_2955457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2955651_2956341_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2956337_2956478_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2956474_2957086_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2957294_2957897_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2957981_2958203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2958312_2958546_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2959137_2959734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2959745_2960723_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2960777_2961035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2961034_2961679_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2961682_2961991_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2961994_2962453_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000113623.1|2962449_2962797_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2962807_2963557_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062943.1|2963559_2964543_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2964627_2964948_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2964982_2965210_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2965315_2965750_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2966046_2966178_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2966226_2966577_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_136614733.1|2966703_2969904_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.6	0.0e+00
WP_077248255.1|2969866_2971024_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2971066_2971306_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2971346_2971595_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|2971639_2972932_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|2973126_2974329_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2974406_2975843_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2976087_2977302_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2977618_2978080_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2978280_2979681_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|2980287_2981379_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|2981563_2982754_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2982815_2983463_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2983490_2984039_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|2984298_2986140_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|2986484_2990951_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
2990827:2990846	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|2990950_2991655_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2991635_2992958_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|2992950_2993754_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	3043817	3052549	4923339	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3043817_3045072_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3045535_3045994_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3046185_3048462_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3048492_3048813_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3049136_3049358_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3049487_3051434_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3051430_3052549_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP035915	Salmonella enterica strain S61394 chromosome, complete genome	4923339	4502525	4549569	4923339	tRNA,tail,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4502525_4503524_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4503611_4504922_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4505168_4505684_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4505782_4505992_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4506013_4506127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4506123_4507449_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4507627_4508236_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4508344_4508713_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4508883_4511304_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4511402_4512275_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4512288_4512786_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4512966_4513884_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4514047_4515406_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4515494_4516604_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4516965_4518156_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4518287_4519832_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4519846_4520737_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4520902_4521313_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4521455_4523552_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4523551_4524289_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|4524285_4524954_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4524987_4525230_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4525673_4527323_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4527667_4529017_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4529149_4529497_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4530072_4530360_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4530362_4530968_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4530980_4531295_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4531454_4531910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4531906_4532104_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4532093_4533521_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4533520_4534045_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4534096_4534414_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4534373_4534502_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4534598_4536953_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4536952_4537906_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4537905_4538115_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4538102_4539146_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4539155_4539878_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4540205_4540568_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4540564_4541494_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4541493_4543041_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4543204_4543564_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4543554_4544670_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4544662_4545295_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4545297_4547043_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4547047_4547653_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4547649_4548105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4548353_4548644_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4548840_4549569_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP035916	Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence	287007	59413	108510	287007	transposase,protease,integrase	Acinetobacter_phage(22.22%)	50	56650:56668	85156:85174
56650:56668	attL	TCATGATGCAGCATACTTC	NA	NA	NA	NA
WP_000795947.1|59413_60589_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|60759_60972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|61332_62415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|62581_64081_-	kinase	NA	NA	NA	NA	NA
WP_000081622.1|64106_65744_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|65743_66784_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|66869_67508_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|67507_68149_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|68171_68810_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|69272_69740_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|69757_70966_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|70976_71933_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|71932_73012_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|73013_73787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|73779_74922_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|74931_75990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|76313_76895_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|76894_78052_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|78074_78530_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|78552_79593_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|79641_80220_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|80287_80863_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|81291_82533_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_039003037.1|82752_83475_-	PAP2 family protein	NA	NA	NA	NA	NA
WP_049589868.1|83546_85172_-	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_012478345.1|85367_86342_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
85156:85174	attR	GAAGTATGCTGCATCATGA	NA	NA	NA	NA
WP_000077926.1|86775_87057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|87106_87298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|87389_87761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|88103_88496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|89099_89393_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|89397_90723_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|90783_90990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|91091_91502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|91514_92330_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|92583_93009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|93752_94052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123872853.1|94041_94362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151529560.1|94364_96404_-	UvrD-helicase domain-containing protein	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.0	3.9e-25
WP_001572342.1|96400_97387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|98417_98621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|98962_99367_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|99864_100101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|100142_100598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|100657_101323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|101380_101761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090707.1|102512_103355_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351437.1|103341_105465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032192125.1|105464_106913_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|106953_108510_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP035916	Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence	287007	147886	200255	287007	transposase,integrase	Escherichia_phage(47.83%)	50	169411:169470	188067:188887
WP_001067855.1|147886_148591_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071448054.1|148596_149343_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|149342_149861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|149865_150282_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001617865.1|150893_151769_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_001067855.1|152071_152776_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|152889_153666_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|153894_154920_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|155341_156094_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|157904_158390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|158586_159677_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|159766_160582_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|160668_160971_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|160864_161116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|161146_162640_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|162751_163057_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063122217.1|163084_164299_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	25.4	1.5e-16
WP_001447541.1|164515_165400_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|166324_167029_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|167113_167515_-	hypothetical protein	NA	NA	NA	NA	NA
169411:169470	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|169473_170178_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001336345.1|170824_171115_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|171226_171724_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001067855.1|172128_172833_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|173022_173838_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|173988_174693_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000612791.1|174923_175787_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|175824_176070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|176538_177330_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000800531.1|178509_178842_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|179011_179803_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|179895_181155_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|181416_182208_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|182265_182874_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|182969_183812_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|183978_184992_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|185194_185545_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|185670_186231_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001067855.1|187358_188063_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|188287_188491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|188618_189458_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
188067:188887	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCGTCATACTTTCGCCTTCATGATCTGCAACGAGTTGATCAATAATAAGCGAAATTCGATAACGAAATTCGATATAAATCTAGAAAAAAATACCTCTATGTGTACTACGCAGTTTTAGCTGTGGCTTTCACAGGAGCACGCTTACTTACGGCTTAGCGTGCTTTATTTTCCGTTTTCTGAGGCGATCCCTAGGAGCTCGGATCTCAGGACGAAGGTCTCCGCGAATGTCCGGTCGATCCGCGCGACGTCCCAGGCGGGCGTTCCCTTGGCGGACATCCACGCCGCAGCGTCGTGCATCAGCCGCACAACCTCGTCGATATCACCCGAGCAGGCGACCCGAACGTTCGGAGGCTCCTCGCTGTCCATTCGCTCCCCTGGCGCGGTATGAACCGCCGCCTCATAGTGCAGTTTGATCCTGACGAGCCCAGCATGTCTGCGCCCACCTTCGCGGAACCTGACCAGGGTCCGCTAGCGGGCGGCCGGAAGGTGAATGCTAGGCATGATCTAACCCTCGGTCTCTGGCGTCGCGACTGCGAAATTTCGCGAGGGTTTCCGAGAAGGTGATTGCGCTTCGCAGATCTCCAGGCGCGTGGGTGCGGACGTAGTCAGCGCCATTGCCGATCGCGTGAAGTTCCGCCGCAAGGCTCGCTGGACCCAGATCCTTTACAGGAAGGCCAACGGTGGCGCCCAAGAAGGATTTCCGCGACACCGAGACCAATAGCGGAAGCCCCAACGCCGACTTCAGCTTTTGAAGGTTCGACA	NA	NA	NA	NA
WP_072644484.1|189638_189803_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|191193_191898_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|192091_192478_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_057109146.1|192797_193190_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_001067858.1|193524_194229_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063865358.1|194548_195724_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
WP_032495443.1|195747_198900_+	multidrug efflux RND transporter permease subunit OqxB2	NA	NA	NA	NA	NA
WP_000888203.1|198969_199449_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|199550_200255_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
