The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	1232846	1260616	5427778	integrase,tail,holin,transposase	Stx2-converting_phage(31.58%)	33	1232792:1232851	1254774:1256084
1232792:1232851	attL	CTGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGAC	NA	NA	NA	NA
WP_085948178.1|1232846_1234059_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000800629.1|1235599_1236451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071599.1|1236550_1236757_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|1237079_1238285_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1238286_1239600_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1239596_1241228_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1241228_1241627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1241724_1242138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150573.1|1242533_1243808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1243883_1244186_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1244221_1244977_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1245324_1245891_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1245865_1246477_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1246473_1247139_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1247135_1247759_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1248011_1248755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1248840_1249008_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143068.1|1249415_1251269_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1251418_1251634_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1251638_1251983_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1252339_1252720_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1252716_1253064_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1253113_1253758_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1253564_1254455_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1254451_1254778_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1254995_1255265_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1255425_1255848_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1255977_1257036_-	T3SS effector EspW	NA	NA	NA	NA	NA
1254774:1256084	attR	GTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGATGGCGCACTCATCACCGGACTGACCTTTCTTGCCCCCAAAGATGCCACACGGGTTCAGGGTTTTTTTCAGCATTTGCAGGTCAGGTTTGGTGACGGGCCGTGGCAGGATGTTAAGGGGCTGGATGAAGTGGGCAGTGATACAGGCAGAACAGGAGAATGACATGAATATACTAAAAAAACTTATGCAGCGTCTGTGCGGTTGCGGAAAGCATGATGACCGTGAACACGGGGAGTTACTTACAGCACAGCTGCGACTGGGGCCGGCAGACATCCTGGAGTCAGATGAGAATGGCATTATCCCGGAGCAGGCCAGGGTAATCACGCAGGTGGTGATACTGGATGCGGATAAAAAGCAGATACAGTGCGTGGTAAGACCGCTGCAAATCCTGCGTGCTGACGGGACGTGGGAAAATATTGGCGGGATGAAGTAACCCGACAGCTTCACAAAACCGGAGTCCGGCTCCGGTTTTTGTTGTCATGTACGGTGGATGTTTGTTATGACTCCCTGTGTTTGGAATGAATATTTAATAACAGGTGTCTGGAAATATAGGGGCAAATCTACTGGATAGGCTATTGGGGCGTGAGAATCGAATGGAGAGAAGGGCTGTGGCTCTGGAAAGGCAATTAAATGGAGGTGTCGATTTTTTAAGGAGTGTTAATAACTATTTTCAGAGTGTCATGGCAGAACACAGAGAAAATAAAACAAGTAATAAAATATTAATGGAAAAAATAAATTCCTGTGTATTTGGAACGGATTCTAATCACTTTTCTTGCCCGGAGTCATTTTTGACATGCCCGATAACGCTGGACACACCTGCGAATGGAGTGTTCATGAGAAACTCACAAGGTGCTGAGATATGCTCTCTATATGATAAGGACACGTTAGTGCAACTTGTTGAAACTGGTGGAGCTCATCCTCTGAGTCGAGAACCTATAACAGAATCAATGATTATGAGAAAAGACGAATGTCACTTTGATTCAAAAAAAGAATCCTTTGTTGCAAGTGATGCTTAATTTTTTTTGTTGGTGTGTTTTTATATTAATAGTTTATTATAATAGTGCCATGTAAGGATATATTGTCTGAACAATTATTCAGACAATATTTTTTTCTTGCTTTATATGAAATATATAATATTTGGATCCTTAATTTCTAACCAAGGGGTCCCATGTTTTTATGTTATGATGCAGCCCATAATTTCGGGGGCTACATGCAAGAATATCTTTTTCTTCGGCGCCTGATTTGCGTAAAA	NA	NA	NA	NA
WP_001144077.1|1257114_1257765_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1257947_1258538_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|1258524_1258644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|1259039_1259288_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1260133_1260616_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	1538233	1639030	5427778	transposase,integrase,tRNA,bacteriocin,portal,capsid,tail,holin,lysis,terminase	Escherichia_phage(77.78%)	118	1542589:1542613	1607276:1607300
WP_001005794.1|1538233_1538764_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1538763_1539231_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1539217_1539898_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1539907_1541044_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1541218_1542376_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1542589:1542613	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|1542807_1543977_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|1543960_1544143_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994803.1|1544221_1544599_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_001291844.1|1544634_1544847_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|1544806_1545433_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000809302.1|1545429_1545861_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_151545389.1|1545916_1546594_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	99.6	2.3e-123
WP_001260980.1|1546918_1547176_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	8.6e-39
WP_001451755.1|1547304_1547502_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001302866.1|1547590_1547896_+	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451754.1|1547938_1548508_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_000206752.1|1548770_1549394_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_000212746.1|1549397_1549685_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|1549686_1549905_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_001301947.1|1549906_1550122_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001301469.1|1550081_1550588_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001303141.1|1550589_1551537_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_000476217.1|1551533_1551773_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_000157000.1|1551765_1551969_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_001453790.1|1551965_1552844_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_001159716.1|1552951_1553395_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
WP_000080417.1|1553471_1554293_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_000077905.1|1554356_1554704_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000344634.1|1554779_1555367_-	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000187066.1|1555366_1556056_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
WP_000459724.1|1556052_1557003_-	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
WP_000995346.1|1557021_1557303_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
WP_024175068.1|1557323_1557545_-	hypothetical protein	NA	A0A2R2Z322	Escherichia_phage	100.0	6.4e-35
WP_000917253.1|1557616_1557829_-	hypothetical protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
WP_000201269.1|1557899_1558547_-	Rha family transcriptional regulator	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
WP_001064714.1|1559407_1560361_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1560357_1561827_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1561921_1562635_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1562730_1562934_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|1563104_1563299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1563465_1563843_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913119.1|1563836_1565357_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001193567.1|1565346_1566318_+	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000402093.1|1566317_1566767_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001187434.1|1566774_1567338_+	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000144764.1|1567334_1567529_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204844.1|1567521_1567956_+	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_024165517.1|1567944_1568190_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.1e-35
WP_001356551.1|1568204_1568357_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1568739_1569699_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1569710_1569980_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874428.1|1570465_1572403_+	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|1572537_1572717_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|1572757_1573003_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_001072901.1|1573080_1573296_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087729.1|1573300_1573834_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001056885.1|1574108_1574678_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1574677_1574827_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1574834_1575299_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1575330_1575624_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1575773_1575977_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086073.1|1576032_1576839_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1576819_1578526_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|1578525_1580670_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1580827_1581835_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1581858_1583073_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1583128_1583518_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1583567_1584029_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1584012_1584576_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207926.1|1584575_1585226_+	hypothetical protein	NA	A0A0N6WEJ5	Escherichia_phage	100.0	4.6e-121
WP_000117994.1|1585222_1587160_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|1587161_1587431_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1587570_1587759_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146324.1|1588053_1589679_+	hypothetical protein	NA	A0A0N7C0A7	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|1589675_1590944_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|1590958_1591237_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|1591242_1591860_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000998048.1|1592148_1593687_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1593736_1594084_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1594080_1594461_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_024175551.1|1595065_1595311_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	98.8	1.6e-39
WP_000078907.1|1595367_1595508_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1595564_1595966_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1596059_1596716_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|1596718_1597165_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|1597174_1597426_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1597436_1598702_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_151567859.1|1598771_1607153_+	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_000368131.1|1607374_1608307_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1607276:1607300	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_000776768.1|1608600_1609356_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001301650.1|1609560_1609677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952959.1|1609750_1610782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301981.1|1611146_1612487_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|1612858_1613143_+	DUF406 family protein	NA	NA	NA	NA	NA
WP_000531969.1|1613322_1614633_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426146.1|1614632_1616777_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195817.1|1616979_1617465_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033336.1|1618110_1618674_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112844.1|1618755_1621395_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000182852.1|1621417_1622176_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000675435.1|1622186_1622687_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001415277.1|1622725_1623154_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000794741.1|1623150_1623672_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001301548.1|1623673_1624516_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730817.1|1624686_1625238_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001302029.1|1625403_1626336_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1626370_1627456_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043834.1|1627459_1628284_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1628283_1629093_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089225.1|1629092_1629641_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1629674_1629953_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683769.1|1630073_1632080_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1632238_1633459_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127753.1|1633733_1634912_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615801.1|1634908_1635904_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699109.1|1636002_1637139_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_001289184.1|1637204_1638218_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1638217_1639030_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	1854017	1938511	5427778	protease,integrase,portal,tail,holin,tRNA,terminase	Enterobacteria_phage(53.33%)	100	1856492:1856512	1913929:1913949
WP_000569336.1|1854017_1854944_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1854948_1855680_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1855660_1855768_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1855827_1856529_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1856492:1856512	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1856549_1857836_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1857869_1858124_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556581.1|1858142_1858277_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|1858280_1858523_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1858610_1858973_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1858969_1859326_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|1859402_1859690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|1859659_1859836_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1859837_1860785_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1860781_1861003_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1861101_1861383_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1861393_1861585_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1861557_1861740_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1861739_1862417_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1862413_1863199_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1863204_1863501_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|1863576_1863783_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1864263_1864641_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1864618_1865680_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|1865760_1866450_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|1866554_1866785_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|1866854_1867394_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001415640.1|1867480_1868410_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
WP_000788810.1|1868406_1869108_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|1869104_1869407_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|1869474_1869807_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|1869898_1870006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1870063_1871590_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|1872054_1872606_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1872615_1873413_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1873529_1873631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|1873627_1874083_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|1874082_1874253_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1874245_1874536_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1874532_1874895_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1874891_1875032_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1875117_1875552_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_024165948.1|1875540_1875789_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.2e-34
WP_001356551.1|1875803_1875956_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1876759_1878706_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1878840_1879020_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|1879060_1879306_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000284506.1|1879383_1879599_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1879603_1880137_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1880407_1880977_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1880976_1881123_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1881350_1881536_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1882053_1882530_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077621.1|1882526_1883534_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|1883695_1884934_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|1884926_1885151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038670.1|1885210_1885792_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_088136225.1|1885772_1886492_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|1886484_1886709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|1886701_1887295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|1887491_1887734_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761774.1|1887730_1889545_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_001399692.1|1889832_1890078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|1890074_1890497_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|1890963_1891158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|1891154_1893044_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|1893298_1893580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|1895072_1895285_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1895284_1896787_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1896731_1898756_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1898843_1899170_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1899162_1899444_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1899446_1900070_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1900082_1900481_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1900488_1901241_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1901254_1901677_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1901703_1902012_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|1902055_1904701_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1904697_1905027_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1905026_1905725_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1905735_1906479_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1906424_1907054_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151542842.1|1907294_1910771_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001228302.1|1910838_1911438_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000268979.1|1911502_1912816_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001023381.1|1912817_1913087_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|1913454_1913703_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1914217_1915903_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1913929:1913949	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1915899_1916619_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1916665_1917136_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1917177_1917639_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1917763_1919767_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1919763_1920900_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1920892_1921624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1921642_1923172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1923182_1924271_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1925511_1925829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1925890_1929520_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1929529_1931071_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1931234_1932515_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1936477_1938511_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	1964136	2002203	5427778	plate,integrase,head,portal,capsid,tail,holin,lysis,terminase	Escherichia_phage(63.64%)	50	1965917:1965944	1997877:1997904
WP_000807362.1|1964136_1965036_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1965441_1965759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303578.1|1965746_1965926_+	hypothetical protein	NA	NA	NA	NA	NA
1965917:1965944	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1966023_1967037_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1967152_1967452_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1967573_1967849_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|1968026_1968527_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1968590_1968815_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1968814_1969114_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1969116_1969341_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1969337_1969613_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1969602_1971885_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1971974_1973198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1973244_1973697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1973696_1975664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542846.1|1975981_1977016_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	1.2e-200
WP_000156848.1|1977015_1978788_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1978961_1979816_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1979874_1980948_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1980951_1981695_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1981794_1982304_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1982303_1982507_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1982510_1982792_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1982791_1983289_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1983303_1983729_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1983716_1984142_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1984113_1984287_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1984249_1984717_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001810.1|1984709_1985162_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_001093728.1|1985228_1985864_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1985860_1986208_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1986212_1987121_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1987113_1987725_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217043.1|1987721_1988921_+|tail	tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.5	2.0e-215
WP_001008233.1|1988941_1989385_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1989356_1989959_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001145594.1|1989958_1990489_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.7e-100
WP_000905094.1|1990519_1991113_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|1991172_1992363_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|1992375_1992894_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1992950_1993226_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1993258_1993378_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1993370_1995818_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1995832_1996312_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1996311_1997475_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1997556_1997775_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1998048_1999410_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
1997877:1997904	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1999557_1999890_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|2000080_2000803_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|2000799_2002203_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	2101289	2202374	5427778	transposase,integrase,head,portal,tail,holin,terminase	Escherichia_phage(35.19%)	107	2122377:2122436	2146973:2148282
WP_000998048.1|2101289_2102828_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2102877_2103225_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2103221_2103602_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2103963_2104509_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2104505_2105249_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2105260_2106340_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2106401_2107337_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2107793_2108711_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2108812_2109763_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2109880_2111524_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2112149_2112866_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2113208_2114663_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2114764_2116081_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2116394_2117447_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
2122377:2122436	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|2122430_2123643_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151542851.1|2123683_2127004_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2127493_2128291_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2128526_2129549_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2129548_2129752_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2129810_2132282_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2132377_2132566_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2132562_2132751_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2133231_2133384_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2133658_2134303_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2134400_2134628_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2134624_2135050_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_151542853.1|2135118_2136156_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|2136187_2136610_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2136644_2137343_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2137364_2137589_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2137585_2137942_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2137974_2138127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2138123_2138435_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2138561_2139125_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2139234_2139339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2139525_2139738_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2139779_2139965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2139905_2140184_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2140185_2141235_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2141247_2141607_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2141603_2142293_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|2142323_2142446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|2142926_2143355_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2143832_2145683_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|2145764_2146978_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2147297_2147504_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2147508_2147853_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2147903_2148437_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
2146973:2148282	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCATACTGGCTAAGAAGGATAGTTGGGTTTCACATGATACTTATATCTGGCAGTACATTTTCTGACAGACAGTGATGGGTGTTGTCAAGATATTGTGTCATTTATAACCTGAATCAGGGGGGGGAGCCGGAATGTTATCTGGCATTTTTAGCAGAGCCTGAATGCCATAATCACGGCTCCCGGCGTTGGCCGTCAGTGGGCGACACTGGCGGCTTTTTGTTTTCCTTTACTTTCATTTTCTGTCGGCGGTGACGGAGACATACATCAGATGGAAAAAATCACAACAGGTGTGTCATACACCACGTCAGCGGTGGGGACGGGATACTGGTTACTGCAGCTGCTGGACAAAGTCTCTCCGTCCCAGTGGGTGGCAATCGGTGTGCTGGGGAGTCTGCTGTTTGGCCTGCTGACGTATCTGACTAACCTGTATTTCAAAATCAGAGAGGACCGTCGTAAGGCGGCGCGGGGGGAGTAAAGCGATGAAGAAAAAATACGAACTGGGTGTTAAAGGGATAAATAATTACCCGGATAAGATTACTGTTACTGTGGCACCGGAAATTGGTGGGTATCCGTCACTGTTGTTGCCAGATGTGGCGATTAGTCTTGACCGTACTGAAGGTGCCACGCTGGAGTTTTACGAAGCTGAGGCGAAAAAGCAGGCGAAGCAGTTTTTCATGGATGTTGCTGCCGGGTTATGTGAAGGGGATGGTCCGTTGCCGGAAAAGCGCCCCGTAATTTTAGAGGCGCAGGATGTGTTGATAACCTACAGAGGAAAACTACCGGGAATAATTACGGGTTCTCTGAAGACTCCACCGCTGGCCTGAAGACTTAACATATCCAGGGATTTGAAATCGATAAACCCTGATAAATATCCATGAACGCAAAAATCAGATACGGCCTGTCGGCTGCCGTTCTGGCGCTGATTGGTGCAGGGGCGTCTGCGCCTGAAATCCTCGACCAGTTTCTTGACGAAAAAGAAGGTAACCACACCACGGCATACCGTGATGGTGCGGGTATCTGGACCATCTGCCGCGGTGCCATCCTGGTGGATGGTAAACCTGTCGTTCCGGGCATGAAGTTGTCGAAGGAAAAATGCGACCAGGTTAACGCCATTGAACGTGATAAGGCGCTGGAGTGGGTGGAGCGCAATATTAAAGTACCGCTGACCGAACCCCAGAAAGCGGGGATCGCGTCATTCTGTCCGTACAACATTGGTCCCGGTAAGTGTTTCCCGTCGACGTTTTACAGACGAA	NA	NA	NA	NA
WP_001303555.1|2148592_2148775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2148787_2148919_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2149146_2149332_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2149858_2150173_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2150254_2150479_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2150873_2151383_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2153268_2153475_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2153471_2155064_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2155053_2156559_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2156595_2156943_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2157000_2157267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2157248_2157989_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2158002_2158434_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2158460_2158874_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082463.1|2158854_2161434_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|2161430_2161760_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2161759_2162458_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_151545396.1|2162468_2163212_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	5.0e-148
WP_071601640.1|2163157_2163787_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_151545398.1|2164027_2167507_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	98.5	0.0e+00
WP_001230508.1|2167574_2168174_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151542857.1|2168238_2169552_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	2.8e-77
WP_001023407.1|2169553_2169823_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_010917831.1|2169948_2170962_-	Tir-cytoskeleton coupling protein TccP	NA	NA	NA	NA	NA
WP_000022458.1|2171286_2171940_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_010904783.1|2172147_2172507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079078.1|2173076_2173607_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
WP_115801852.1|2173949_2174621_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240083.1|2174856_2175492_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740078.1|2175492_2176497_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2176604_2177018_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|2177150_2177822_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826732.1|2177821_2179180_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	8.7e-05
WP_000218228.1|2179287_2180139_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000365585.1|2182887_2183583_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
WP_001157239.1|2183649_2185068_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786000.1|2185048_2185519_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212226.1|2185507_2186428_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922685.1|2186600_2187518_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2187596_2187779_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001302088.1|2187949_2189644_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491488.1|2189640_2190456_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2190753_2190981_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_001347685.1|2190968_2191157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071524607.1|2191089_2191332_+	protein DsrB	NA	NA	NA	NA	NA
WP_000104001.1|2191375_2191999_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000942326.1|2192288_2193074_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2193081_2193351_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|2193360_2194098_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001302429.1|2194097_2194463_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2194465_2194879_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2194875_2195880_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|2195884_2196349_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620075.1|2196453_2197581_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|2197577_2198021_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|2198039_2199413_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282715.1|2199474_2200161_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_075335630.1|2200153_2201107_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_085948178.1|2201160_2202374_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 6
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	2293537	2383950	5427778	protease,integrase,portal,tail,holin,tRNA,terminase	Escherichia_phage(36.92%)	110	2306236:2306253	2352532:2352549
WP_000916763.1|2293537_2293768_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|2293906_2294281_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|2294284_2295157_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|2295169_2295511_+	YebY family protein	NA	NA	NA	NA	NA
WP_045893699.1|2295903_2296980_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.1	1.7e-96
WP_001311878.1|2296945_2297227_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|2297333_2297522_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2297514_2297709_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166313.1|2297765_2298575_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000102194.1|2298567_2301237_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_001427414.1|2301317_2301488_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560228.1|2301487_2301709_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_062882198.1|2301755_2302607_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	67.5	3.2e-66
WP_001169149.1|2303021_2303174_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_000233812.1|2303184_2303319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253182.1|2303554_2304019_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_062881721.1|2304123_2304399_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	64.6	9.2e-23
WP_000702023.1|2304382_2304805_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899743.1|2304817_2305675_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_062881720.1|2305681_2306428_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.5	3.1e-113
2306236:2306253	attL	GCATCAGATTGTTGATCG	NA	NA	NA	NA
WP_151542863.1|2306449_2307211_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	92.5	1.3e-122
WP_151542866.1|2307227_2307650_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000072553.1|2307755_2307968_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
WP_100004899.1|2308053_2308218_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	88.9	1.0e-16
WP_151542868.1|2308219_2308483_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	2.8e-29
WP_000207986.1|2308493_2309363_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278450.1|2309478_2309583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542871.1|2309772_2309985_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_000119356.1|2310196_2310376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818166.1|2310394_2310880_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_062882632.1|2311341_2311941_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.0e-106
WP_000228018.1|2311940_2312231_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640170.1|2312227_2312782_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_071525387.1|2312778_2313003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001370386.1|2313529_2313715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151542873.1|2314323_2316270_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.0	0.0e+00
WP_000143464.1|2316406_2316586_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_024246943.1|2316626_2316872_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	2.0e-16
WP_001072899.1|2316949_2317165_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001015166.1|2317168_2317810_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000282141.1|2317819_2318134_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_109063312.1|2318262_2318796_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	6.2e-100
WP_001208683.1|2319314_2319500_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	86.9	8.1e-23
WP_000373407.1|2319975_2320452_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077621.1|2320448_2321456_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_151542875.1|2321617_2322856_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.0	5.4e-62
WP_001095275.1|2322868_2323072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542877.1|2323130_2323712_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.3	5.8e-51
WP_151542961.1|2323692_2324403_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000551742.1|2324406_2324772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151542879.1|2324764_2324998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728900.1|2325194_2325485_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_151542881.1|2325481_2327236_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
WP_151542883.1|2327583_2327835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126694.1|2327831_2328242_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|2328702_2328897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|2328893_2330783_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|2331037_2331319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|2332811_2333024_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|2333023_2334526_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2334470_2336495_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2336582_2336909_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2336901_2337183_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2337185_2337809_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2337821_2338220_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2338227_2338980_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2338993_2339416_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|2339442_2339751_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|2339794_2342440_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|2342436_2342766_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|2342765_2343464_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|2343474_2344218_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2344163_2344793_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151542887.1|2345033_2348510_+	DUF1983 domain-containing protein	NA	Q687E8	Enterobacteria_phage	96.0	0.0e+00
WP_001230428.1|2348577_2349177_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_151545402.1|2349241_2350555_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	3.3e-78
WP_001023407.1|2350556_2350826_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000812736.1|2351555_2352212_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_151542963.1|2352219_2352405_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001295499.1|2352509_2352746_-	DUF1480 family protein	NA	NA	NA	NA	NA
2352532:2352549	attR	GCATCAGATTGTTGATCG	NA	NA	NA	NA
WP_001302304.1|2352863_2354303_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001302055.1|2354383_2357017_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|2356985_2358269_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2358398_2358896_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431368.1|2358992_2359691_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|2359710_2361759_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|2361950_2362832_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127211.1|2362877_2364251_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262182.1|2364427_2365219_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211007.1|2365362_2365602_-	membrane protein	NA	NA	NA	NA	NA
WP_000714550.1|2365761_2365905_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006862.1|2365979_2366267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|2366935_2367079_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2367091_2367301_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010147.1|2367466_2368276_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|2368272_2368839_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156258.1|2369268_2369727_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|2369781_2370633_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|2370645_2371446_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|2371508_2372480_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394973.1|2372942_2374493_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001302042.1|2374496_2376095_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624305.1|2376225_2377590_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|2377773_2378352_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854987.1|2378355_2379717_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
WP_000457334.1|2379790_2379970_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|2380089_2380449_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2380810_2381155_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2381286_2383197_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220997.1|2383254_2383950_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	2603704	2673270	5427778	protease,transposase,head,capsid,tail,holin,terminase	Stx2-converting_phage(39.62%)	80	NA	NA
WP_001260835.1|2603704_2604526_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2604625_2604709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2604801_2605137_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2605533_2606787_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2606893_2607787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2607921_2609142_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2609266_2609962_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2609914_2611207_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2611364_2611979_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2612021_2612876_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2612877_2613495_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2613505_2615929_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2615989_2618416_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2618614_2618920_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2619027_2619738_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2619740_2620301_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2620335_2620677_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2620811_2621138_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2621310_2621436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2622126_2622363_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_085948178.1|2623885_2625099_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001090200.1|2626327_2626519_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2626515_2626704_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2627104_2627269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2627272_2627491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2627562_2627862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2628213_2628492_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2628493_2628685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2628705_2629077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2629174_2629477_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2629473_2629899_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2629921_2630884_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2630890_2631631_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2632441_2632837_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2632893_2633478_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2633593_2633698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2633886_2634099_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2634266_2634545_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2634546_2635596_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2635608_2635968_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2635964_2636654_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|2636684_2636807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|2637290_2637719_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_085948178.1|2639932_2641146_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411805.1|2641808_2642015_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2642019_2642364_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2642414_2642948_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2643218_2643788_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2643787_2643934_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2644161_2644347_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2644771_2644999_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2645040_2645406_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958392.1|2645695_2646259_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_001303179.1|2646255_2647917_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_151542909.1|2647980_2649918_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001063023.1|2649962_2650184_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125988.1|2652224_2652551_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007901.1|2652560_2652911_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2652907_2653354_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2653350_2653695_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2653753_2654470_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2654475_2654850_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2654945_2655155_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212925.1|2655206_2658449_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|2658441_2658783_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179510.1|2658782_2659481_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000194720.1|2659491_2660235_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2660180_2660813_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_151545407.1|2662719_2665233_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_001230508.1|2665300_2665900_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151567873.1|2665964_2667278_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2667279_2667549_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2667662_2668238_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2668310_2668940_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2669021_2669663_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001480712.1|2669693_2669828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241229.1|2669824_2670139_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2670198_2671482_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2671570_2673031_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2673066_2673270_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	2944514	3019191	5427778	protease,terminase,integrase,head,portal,capsid,tail,holin,lysis,transposase	Enterobacteria_phage(34.48%)	89	2960016:2960043	3019352:3019379
WP_000422055.1|2944514_2945564_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2945783_2946542_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2946538_2947129_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2947168_2948041_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2948253_2949837_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2949864_2950485_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2950481_2951363_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2951500_2951545_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2951636_2953199_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2953198_2954794_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001302292.1|2954797_2956156_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|2956167_2957361_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2957360_2958167_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2958547_2958727_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2958812_2959313_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2959358_2959865_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2960016:2960043	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|2960366_2960585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|2961178_2961607_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|2963335_2963926_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2964109_2964757_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2964893_2965040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2965467_2965746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2966085_2966466_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2966462_2966810_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2966859_2968398_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2969363_2969933_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2969998_2970910_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2971016_2971139_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_024262009.1|2972280_2972469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025672.1|2972736_2974062_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2975088_2975358_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216534.1|2975359_2976664_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001228334.1|2976815_2977415_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000514948.1|2977482_2980338_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_122989782.1|2980578_2981208_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000194801.1|2981153_2981897_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|2981907_2982606_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2982605_2982935_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072643101.1|2982931_2985544_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000533440.1|2985524_2985938_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2985964_2986387_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2986400_2987153_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2987160_2987556_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2987552_2988086_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2988100_2988454_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2988465_2988864_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2988905_2989931_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2989986_2990319_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2990328_2991648_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2991628_2993230_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2993226_2993433_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2993429_2995355_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2995329_2995875_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_032161313.1|2995988_2996246_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_001303940.1|2996261_2996486_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2996567_2996882_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001082601.1|2997345_2997813_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_000539792.1|2997820_2997967_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2997966_2998536_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2998806_2999340_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731259.1|2999390_2999735_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2999739_2999955_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3000104_3001958_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_064761991.1|3002077_3002263_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000917750.1|3003962_3004160_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3004401_3004932_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3004940_3005300_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3005312_3006359_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3006360_3006639_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3006708_3006966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3007186_3007399_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3007677_3008436_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3009134_3009299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3009295_3009877_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|3010063_3010486_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|3010517_3011558_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3011529_3012081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3012064_3012292_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3012368_3012776_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3013039_3013339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3013411_3013630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3013652_3014060_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3014037_3014271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3014264_3014432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3014829_3015018_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|3015014_3015206_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3015298_3017770_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3017834_3018083_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3018060_3019191_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3019352:3019379	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	3072368	3173591	5427778	protease,terminase,lysis,integrase,head,portal,capsid,tail,holin,tRNA,transposase	Enterobacteria_phage(51.85%)	111	3101775:3101790	3167494:3167509
WP_000152933.1|3072368_3072953_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3073069_3074161_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3075004_3077890_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3077989_3079909_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3080136_3081207_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3081217_3081850_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3081860_3083279_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001366914.1|3083591_3083720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|3083825_3085283_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|3085310_3085511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3085618_3086641_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3086640_3087621_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3087617_3088376_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000904019.1|3088385_3089030_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010917800.1|3088974_3089256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576838.1|3089194_3090049_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3090074_3092045_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3092094_3092349_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|3092549_3093146_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|3093197_3094410_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|3094598_3095210_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3095309_3096224_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3096319_3098056_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3098447_3099518_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_053889839.1|3099527_3100826_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3101188_3102721_+	SpoVR family protein	NA	NA	NA	NA	NA
3101775:3101790	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3102772_3103492_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3103713_3105255_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3105400_3105931_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3105976_3107245_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3107244_3107664_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3108036_3108948_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3109154_3109616_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3109692_3110352_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3110423_3110717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3110957_3111359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|3111461_3111830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3112349_3113045_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3113068_3113881_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3113884_3114151_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3115390_3115975_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3116473_3117427_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3117613_3119098_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998042.1|3119400_3120939_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|3120988_3121336_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3121332_3121713_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3121788_3122037_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3122093_3122762_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3123259_3123442_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3123520_3124021_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3124057_3124564_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3124582_3125473_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3125592_3126174_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3126173_3129089_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3129153_3129753_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3129819_3133218_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3133278_3133911_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3133847_3134591_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3134596_3135295_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3135294_3135624_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3135620_3138170_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3138162_3138597_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3138578_3139001_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3139016_3139757_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3139764_3140160_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3140156_3140735_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3140746_3141100_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3141111_3141510_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3141551_3142577_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3142632_3142965_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3142974_3144294_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3144274_3145876_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3145872_3146079_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3146075_3148001_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3147975_3148521_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3148909_3149104_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3149268_3149475_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3149760_3150171_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_085948178.1|3150359_3151573_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000738495.1|3151775_3152069_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3152159_3152342_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3152558_3153035_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3153021_3153327_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3153648_3154338_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3154334_3154475_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3154471_3154834_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3154830_3155121_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3155113_3155284_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3155283_3155739_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|3155929_3156121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709088.1|3156240_3157767_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3157824_3157947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3158011_3158344_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3158411_3158714_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3158710_3159412_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3159408_3160233_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|3160336_3160573_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3160562_3161705_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3161818_3163069_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3163240_3163894_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3163903_3164365_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3164418_3165525_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3165560_3166202_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3166205_3167576_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3167494:3167509	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3167744_3168416_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3168415_3169876_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3170476_3170758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3171013_3171556_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3171761_3172175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3172187_3172523_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3172535_3173591_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	3447722	3503334	5427778	protease,transposase,portal,head,tail,holin,terminase	Enterobacteria_phage(28.26%)	72	NA	NA
WP_000003653.1|3447722_3448310_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3448306_3449014_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3449032_3450826_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|3450822_3451941_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|3452558_3452741_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|3454214_3454484_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3454485_3455799_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|3455863_3456463_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515111.1|3456530_3460004_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_000649829.1|3460137_3460665_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001303882.1|3460695_3460902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140439784.1|3460855_3461488_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	1.0e-101
WP_000194801.1|3461433_3462177_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3462187_3462886_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3462885_3463215_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082463.1|3463211_3465791_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3465771_3466185_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3466211_3466643_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3466656_3467397_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3467378_3467645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3467702_3468050_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3468086_3469592_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3469581_3471174_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3471170_3471377_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3471360_3473289_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001301919.1|3473260_3473503_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3473552_3475091_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3475140_3475488_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3475484_3475865_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3475940_3476216_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3476966_3477173_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3477135_3477480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3477428_3477701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3477633_3477828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3477860_3478394_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3478614_3478728_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3478949_3479135_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3479661_3479976_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|3480180_3481394_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000874392.1|3481569_3483420_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|3483537_3483741_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3484187_3484901_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3484995_3485235_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3485521_3486340_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3486491_3486863_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3486852_3487224_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3487236_3488286_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3488287_3488566_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3488733_3488946_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3488990_3489128_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_097561939.1|3489290_3489482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160654.1|3489493_3490267_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_151542923.1|3490618_3491032_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	1.1e-59
WP_000450992.1|3491047_3491818_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|3491839_3492586_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_001205823.1|3492592_3493684_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3493762_3494218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3494424_3494850_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3494833_3495106_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3495214_3495616_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3495643_3495835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3495834_3496122_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|3496123_3496342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3496399_3496555_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3496696_3497086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3497272_3497458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3497459_3497765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3498031_3498220_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3498216_3498408_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3498501_3500973_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3501040_3501283_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|3502674_3503334_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 11
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	3743793	3783207	5427778	protease,transposase,integrase,portal,tail,holin,lysis,terminase	Enterobacteria_phage(48.84%)	52	3743378:3743392	3783281:3783295
3743378:3743392	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3743793_3744492_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_151567879.1|3744722_3745604_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.4	7.3e-146
WP_072127173.1|3745773_3745935_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3746431_3747451_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3747484_3748465_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3748641_3748911_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_001233141.1|3750288_3750888_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3750958_3754372_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3754432_3755041_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3754977_3755721_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3755726_3756425_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3756434_3756764_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_151542929.1|3756763_3758386_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	2.7e-247
WP_085948178.1|3758440_3759653_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001161009.1|3761113_3761443_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3761451_3761838_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3761898_3762642_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3762652_3763054_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3763050_3763629_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3763640_3763916_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3763908_3764232_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3764318_3766346_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3766290_3766626_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3766747_3767872_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3767799_3768012_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934096.1|3768008_3770111_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3770110_3770602_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|3770591_3770870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3771276_3771429_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3771416_3771884_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3771880_3772378_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3772377_3772593_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3772735_3773134_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3773214_3773373_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_151542931.1|3773458_3774202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3774385_3775075_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3775089_3775212_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3775549_3776509_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3776720_3777386_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3777382_3778003_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3777995_3778166_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3778162_3778345_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3779042_3779723_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3779719_3779902_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3779874_3780066_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3780076_3780358_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3780456_3780678_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3780888_3781491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3781615_3781801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3781733_3781901_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3781940_3782159_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3782136_3783207_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3783281:3783295	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	4362177	4402833	5427778	integrase,tail,transposase	Escherichia_phage(30.0%)	44	4361748:4361762	4399303:4399317
4361748:4361762	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4362177_4363359_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4364321_4365065_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4365888_4366662_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4366719_4367274_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4367303_4367798_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4367797_4368391_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4368362_4368806_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001096948.1|4368826_4369537_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	86.6	1.3e-65
WP_000788819.1|4369536_4369848_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4370799_4371093_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4371211_4371412_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4371512_4372226_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708831.1|4372353_4372737_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_085948178.1|4372762_4373975_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303805.1|4374302_4374548_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4375617_4376871_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4376882_4377986_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4378273_4379329_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4379367_4379769_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4379826_4381071_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4381162_4381621_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4381881_4383339_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4383395_4383932_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4383864_4384131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4384437_4384890_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4384899_4385298_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|4385300_4385594_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4385645_4386701_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|4386771_4387542_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001303130.1|4387501_4389241_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4390058_4390832_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4391017_4391278_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4391296_4391557_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4391712_4392453_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4392423_4393191_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4393295_4393874_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4394113_4396558_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4396600_4397074_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4397227_4397998_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4398115_4399288_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4399368_4399554_+	protein YncO	NA	NA	NA	NA	NA
4399303:4399317	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4399468_4399732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4399933_4401694_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4401696_4402833_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	4860386	4919397	5427778	protease,transposase	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|4860386_4861739_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4861832_4862384_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4862539_4863913_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4864088_4865087_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4865119_4866115_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4866101_4867124_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|4868779_4869736_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4870045_4870576_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4870655_4871006_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4870999_4871251_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|4871462_4871804_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_151542951.1|4871806_4875586_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4875582_4877316_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4877521_4878160_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4878482_4879826_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4879904_4880111_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4880435_4880990_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|4881052_4881991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4882202_4882943_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4883132_4885076_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4885193_4885574_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4885662_4886523_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4886630_4887596_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4887703_4888366_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4888410_4889823_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4890131_4890752_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4890969_4891608_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4891742_4892951_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4892958_4893390_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4894012_4894807_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4894877_4895327_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4895368_4895596_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4895600_4895915_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4895921_4896317_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4896643_4896919_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4897047_4897734_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949515.1|4897733_4898588_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4898597_4899248_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4899261_4899726_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4899735_4900041_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4900056_4901454_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4901808_4902873_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4902980_4903736_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4903732_4904482_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4904663_4904993_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4905141_4905417_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4905533_4907159_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4907242_4908406_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4908408_4909047_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4909056_4909455_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4909472_4910132_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4910182_4910881_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4910899_4911301_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4911427_4912159_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4912339_4914781_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4914819_4915245_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4915449_4916748_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4916851_4917049_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4917130_4918135_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4918137_4919397_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 14
NZ_CP032811	Escherichia coli strain ERL03-1416 chromosome, complete genome	5427778	5056277	5070942	5427778	tRNA,integrase,tail	Enterobacteria_phage(37.5%)	19	5052118:5052133	5069647:5069662
5052118:5052133	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5056277_5057693_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5057775_5058759_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5058924_5059167_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5059300_5060338_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5060426_5061524_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5061585_5061834_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5061994_5062636_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5062717_5063347_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5063419_5063992_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5064103_5064373_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268962.1|5064374_5065688_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230514.1|5065752_5066352_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5067673_5068210_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5068200_5068551_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5068547_5068832_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|5068841_5069021_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|5069167_5069365_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5069709_5069991_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5069647:5069662	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|5070408_5070942_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP032812	Escherichia coli strain ERL03-1416 plasmid pERL03-1416-1, complete sequence	90979	8213	52647	90979	integrase,protease,transposase	Stx2-converting_phage(37.5%)	41	39158:39172	58241:58255
WP_001034100.1|8213_12116_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_071525077.1|13513_13693_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14294_15116_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15115_16222_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16311_18033_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18106_19105_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|19472_19853_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|19849_20197_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|20246_21785_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302198.1|22160_22376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358886.1|22438_25135_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25221_26097_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|26154_28065_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28064_29570_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|29571_30795_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|30825_31260_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|31256_31811_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|31825_32173_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|32169_32769_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|32765_33743_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|33781_34954_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|34940_35453_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|35510_36344_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36435_36837_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|38727_39243_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
39158:39172	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217733.1|39244_42241_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42290_44411_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44414_45854_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|45920_46115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|46144_46429_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|46429_46627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|46597_46828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|46948_47689_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|47973_48951_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|49263_49452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|49358_49559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49555_50176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50172_50856_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51314_51533_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51534_51840_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|51840_52647_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
58241:58255	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
