The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	1222305	1245800	5573120	tail,holin,transposase,integrase	Stx2-converting_phage(35.29%)	30	1213951:1213965	1246671:1246685
1213951:1213965	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1222305_1223511_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1223512_1224826_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1224822_1226454_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1226454_1226853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1226950_1227364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150580.1|1227759_1228980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1229055_1229358_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1229393_1230149_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1230508_1231075_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1231049_1231661_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1231657_1232323_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1232319_1232943_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1233195_1233939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1234024_1234192_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143065.1|1234599_1236453_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1236602_1236818_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1236822_1237167_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1237523_1237904_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1237900_1238248_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1238297_1238942_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1238748_1239639_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1239635_1239962_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1240179_1240449_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1240609_1241032_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1241161_1242220_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1242298_1242949_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1243131_1243722_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|1243708_1243828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|1244223_1244472_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1245317_1245800_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1246671:1246685	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	1471504	1592644	5573120	terminase,tail,protease,portal,transposase,capsid,holin,tRNA,integrase,bacteriocin	Escherichia_phage(49.45%)	126	1523654:1523713	1553466:1554777
WP_000695640.1|1471504_1472920_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000604897.1|1472920_1473463_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	5.1e-41
WP_000826440.1|1473470_1474679_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	6.0e-207
WP_000826499.1|1474718_1475111_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000472021.1|1475112_1475472_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001301445.1|1476090_1478280_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_001301799.1|1478329_1479532_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000186369.1|1479867_1481106_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_000490072.1|1481245_1481572_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000903148.1|1481686_1482943_-	ion channel protein	NA	NA	NA	NA	NA
WP_000170346.1|1483146_1484112_+	glucokinase	NA	NA	NA	NA	NA
WP_000038456.1|1484330_1484657_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000985336.1|1484678_1485926_+	fructose-like permease IIC component	NA	NA	NA	NA	NA
WP_000173224.1|1485940_1487026_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000366040.1|1487025_1488063_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000955897.1|1488087_1490583_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000646830.1|1490585_1491443_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001295458.1|1491455_1492190_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000544359.1|1492204_1493902_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000785916.1|1494278_1495517_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|1495581_1495653_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484404.1|1496008_1496929_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_000499593.1|1497281_1497524_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867641.1|1497600_1497876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825602.1|1498171_1498807_+	YfdX family protein	NA	NA	NA	NA	NA
WP_000106757.1|1499319_1500570_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_001283490.1|1500623_1502318_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|1502387_1503332_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001302961.1|1503405_1504551_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001301578.1|1504606_1508200_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	7.8e-37
WP_000991370.1|1508204_1508819_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_001301602.1|1509234_1510398_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_001018694.1|1510397_1511936_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000426437.1|1512043_1513372_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001301925.1|1513850_1514846_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000194527.1|1514853_1516287_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	1.2e-28
WP_001274894.1|1516502_1517417_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_024230735.1|1517488_1518736_+	MFS transporter	NA	NA	NA	NA	NA
WP_001102876.1|1519333_1519960_-	resolvase	NA	A0A0A8WJD4	Clostridium_phage	28.7	5.9e-09
WP_000409798.1|1520262_1520439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119352.1|1520625_1522038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000245915.1|1522707_1523355_-	hypothetical protein	NA	NA	NA	NA	NA
1523654:1523713	attL	CTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCAT	NA	NA	NA	NA
WP_085948178.1|1523696_1524910_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000403517.1|1525268_1525736_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1525722_1526403_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1526412_1527549_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1527723_1528881_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_001218303.1|1529312_1530482_+|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	99.7	2.2e-230
WP_000405131.1|1530465_1530648_-	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_000497812.1|1530708_1530960_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|1530947_1531181_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_054428277.1|1531324_1531678_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	99.1	3.0e-58
WP_001291843.1|1531713_1531926_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_072178294.1|1531885_1532413_-	hypothetical protein	NA	A0A0N7KZB6	Stx2-converting_phage	99.4	2.8e-100
WP_024230746.1|1532696_1533353_-	antirepressor	NA	A0A088CD42	Shigella_phage	70.8	4.1e-77
WP_000247838.1|1533679_1534402_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	70.1	6.3e-87
WP_000610373.1|1534567_1534918_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207904.1|1534914_1535271_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	99.2	1.2e-62
WP_122993658.1|1535347_1535611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1536454_1537668_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151583359.1|1537673_1538045_-	hypothetical protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	2.2e-56
WP_000763383.1|1538041_1538263_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1538361_1538643_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1538653_1538845_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|1538817_1539000_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_151310832.1|1538996_1539677_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	2.1e-132
WP_032168747.1|1539673_1540459_-	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	100.0	9.7e-150
WP_000995439.1|1540464_1540761_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000361829.1|1540835_1540979_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	97.9	3.5e-18
WP_001198866.1|1540971_1541112_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_024230760.1|1541303_1541774_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.4e-87
WP_024212238.1|1541832_1542216_-	hypothetical protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000957426.1|1542835_1543882_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1543875_1544337_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_029793531.1|1544403_1544745_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	2.8e-61
WP_000250473.1|1544805_1545513_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1545591_1545819_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438542.1|1545957_1546254_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185465.1|1546286_1547225_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	99.7	4.8e-172
WP_001510925.1|1547221_1547923_+	replication P family protein	NA	Q6H9X6	Enterobacteria_phage	99.6	1.7e-129
WP_024230862.1|1547919_1548210_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	97.9	2.8e-46
WP_001000127.1|1548280_1548559_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|1548691_1548907_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_000814575.1|1549111_1549558_+	recombination protein NinB	NA	Q8HA08	Enterobacteria_phage	100.0	1.4e-81
WP_000153288.1|1549554_1550082_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_001254221.1|1550078_1550261_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_024230861.1|1550764_1552537_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
WP_085948178.1|1553508_1554722_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151310836.1|1554972_1555575_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	97.5	4.4e-94
1553466:1554777	attR	CTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTTAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCAGCCATCGCGTTGTCATACGAGTCGCCTGTACTCCCTGTTGATGCCAGTAATCCGGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGACACATACTGAGAGCCTTTATCGCTGTGATGGATGGTGCCAGACGGACGACGGGCCCACAACGCCTGCTCCAGCGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATAAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACTGTACATCTGGCCACCCTGATTCCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTACACCTGATGATTTTCATCGTATACGCGCTGTATCTCTCTCTTCAGCCAGTCGTCGTGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAATGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATACCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGCTGGTGAGCCCACCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGGGCAATGGAACAAATTGCCGCCCACTGTGAGTCATATTCATCCTGACTTTCCAGAACCATACGAATCGCCCGCTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAA	NA	NA	NA	NA
WP_024230729.1|1555571_1555766_+	protein ninH	NA	G9L694	Escherichia_phage	95.3	2.1e-29
WP_001204852.1|1555758_1556193_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_072163120.1|1556181_1556427_-	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	96.3	1.1e-32
WP_151547364.1|1556959_1558900_+	DUF1737 domain-containing protein	NA	A0A1U9AJ89	Stx1_converting_phage	98.3	0.0e+00
WP_000143458.1|1559035_1559215_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_088888712.1|1559255_1559501_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	93.8	2.5e-19
WP_000284510.1|1559578_1559794_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_062874321.1|1559798_1560332_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	97.2	2.8e-100
WP_045904330.1|1560606_1561176_+	antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
WP_021351520.1|1561175_1561322_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	93.5	2.7e-13
WP_012816804.1|1561549_1561735_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001109019.1|1561973_1562525_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086073.1|1562817_1563624_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1563604_1565311_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787034.1|1565310_1567455_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1567612_1568620_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1568643_1569858_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_029793700.1|1569913_1570303_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	99.2	2.2e-62
WP_001367376.1|1570352_1570814_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1570797_1571361_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207922.1|1571360_1572011_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_032276022.1|1572007_1573945_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001023420.1|1573946_1574216_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_001303606.1|1574356_1574545_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_024230846.1|1574839_1576465_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.8	0.0e+00
WP_016241167.1|1576461_1577730_+	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	98.1	2.1e-218
WP_000455634.1|1577744_1578023_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1578028_1578646_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_024230847.1|1578736_1579471_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	99.6	1.7e-135
WP_000078907.1|1579703_1579844_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1579900_1580302_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509491.1|1580395_1581052_+	hypothetical protein	NA	A0A088CD74	Shigella_phage	100.0	5.1e-104
WP_000455653.1|1581054_1581501_+	hypothetical protein	NA	G9L6M0	Escherichia_phage	100.0	6.2e-77
WP_024230848.1|1581511_1581763_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_024230849.1|1581773_1583039_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	99.5	2.6e-205
WP_151583360.1|1583108_1591490_+	hypothetical protein	NA	G3CFQ0	Escherichia_phage	98.1	0.0e+00
WP_000368131.1|1591711_1592644_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 3
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	1837036	1909048	5573120	terminase,tail,protease,portal,holin,tRNA,integrase	Enterobacteria_phage(53.62%)	84	1839511:1839531	1884466:1884486
WP_000569336.1|1837036_1837963_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1837967_1838699_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1838679_1838787_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1838846_1839548_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1839511:1839531	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1839568_1840855_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1840888_1841143_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1841161_1841296_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1841299_1841542_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1841629_1841992_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1841988_1842345_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|1842421_1842709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|1842678_1842855_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1842856_1843804_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1843800_1844022_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1844120_1844402_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1844412_1844604_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1844576_1844759_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1844758_1845436_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1845432_1846218_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1846223_1846520_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1846595_1846886_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1847389_1848997_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1849103_1849796_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1850159_1850699_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001417283.1|1850785_1851715_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_000788906.1|1851711_1852413_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1852409_1852694_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1852921_1853119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1853162_1853444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1853534_1853636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1853632_1854088_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1854087_1854258_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1854250_1854541_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1854537_1854900_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1854896_1855037_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1855122_1855557_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_015971135.1|1855545_1855791_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_001356551.1|1855805_1855958_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1856761_1858708_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1858845_1859025_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1859065_1859311_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1859388_1859604_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001056806.1|1860410_1860980_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1860979_1861126_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1861353_1861539_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1862056_1862533_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1862529_1864653_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1864649_1864862_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1864861_1866364_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114424.1|1866308_1868333_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1868420_1868747_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1868739_1869021_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1869023_1869647_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1869659_1870058_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1870065_1870818_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1870831_1871254_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1871280_1871589_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_151583363.1|1871632_1874278_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000847304.1|1874274_1874604_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_080025938.1|1874603_1875302_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_151310936.1|1875312_1876056_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	4.0e-145
WP_140439088.1|1876001_1876634_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	7.9e-102
WP_151583364.1|1876881_1880358_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	98.2	0.0e+00
WP_001230508.1|1880425_1881025_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151547367.1|1881089_1882259_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	97.2	1.2e-84
WP_001023396.1|1882260_1882530_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1882690_1883107_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1883188_1883830_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_029208404.1|1883860_1883995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261939.1|1883991_1884240_-	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1884754_1886440_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1884466:1884486	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1886436_1887156_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1887202_1887673_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1887714_1888176_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1888300_1890304_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1890300_1891437_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1891429_1892161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1892179_1893709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1893719_1894808_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1896048_1896366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1896427_1900057_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1900066_1901608_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1901771_1903052_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001457618.1|1907014_1909048_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	1934727	1972794	5573120	terminase,head,tail,portal,lysis,capsid,plate,holin,integrase	Escherichia_phage(63.64%)	50	1936508:1936535	1968468:1968495
WP_000807362.1|1934727_1935627_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1936032_1936350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303578.1|1936337_1936517_+	hypothetical protein	NA	NA	NA	NA	NA
1936508:1936535	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1936614_1937628_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1937743_1938043_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1938164_1938440_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217673.1|1938617_1939118_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.7e-91
WP_000557698.1|1939181_1939406_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1939405_1939705_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1939707_1939932_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1939928_1940204_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1940193_1942476_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1942565_1943789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1943835_1944288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1944287_1946255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|1946572_1947607_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1947606_1949379_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1949552_1950407_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1950465_1951539_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1951542_1952286_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1952385_1952895_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1952894_1953098_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1953101_1953383_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1953382_1953880_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1953894_1954320_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1954307_1954733_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1954704_1954878_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1954840_1955308_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1955300_1955753_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_001093728.1|1955819_1956455_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_069192632.1|1956451_1956799_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	98.3	2.5e-57
WP_001121479.1|1956803_1957712_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1957704_1958316_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217043.1|1958312_1959512_+|tail	tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.5	2.0e-215
WP_001008233.1|1959532_1959976_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1959947_1960550_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001145594.1|1960549_1961080_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.7e-100
WP_000905094.1|1961110_1961704_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286704.1|1961763_1962954_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.6e-223
WP_001251408.1|1962966_1963485_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1963541_1963817_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1963849_1963969_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1963961_1966409_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1966423_1966903_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1966902_1968066_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1968147_1968366_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1968639_1970001_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
1968468:1968495	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1970148_1970481_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1970671_1971394_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1971390_1972794_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	2056019	2129267	5573120	terminase,head,tail,protease,lysis,transposase,capsid,holin,integrase	Stx2-converting_phage(57.83%)	100	2046970:2046984	2062397:2062411
2046970:2046984	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|2056019_2057198_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|2057178_2057370_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2057451_2057796_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2057983_2058334_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207904.1|2058330_2058687_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	99.2	1.2e-62
WP_122993658.1|2058763_2059027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289954.1|2059200_2060148_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|2060144_2060366_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|2060464_2060746_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|2060756_2060948_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|2060920_2061103_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_054428303.1|2061099_2061780_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	100.0	1.2e-132
WP_000100845.1|2061776_2062562_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
2062397:2062411	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995487.1|2062567_2062864_-	host-nuclease inhibitor protein Gam	NA	A0A0P0ZE86	Stx2-converting_phage	100.0	3.3e-50
WP_000372937.1|2062938_2063082_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2063050_2063215_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2063287_2063656_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2063838_2064090_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2064148_2064421_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2064398_2064581_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2065149_2065671_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2066172_2066868_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2066943_2067159_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2067300_2067597_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000539354.1|2067777_2068599_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2068595_2069972_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|2070042_2070321_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2070453_2070669_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2070679_2070916_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2070872_2071319_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2071315_2071843_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2071839_2072022_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208497.1|2072296_2073025_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	95.6	3.6e-114
WP_001302729.1|2072930_2073125_-	hypothetical protein	NA	A0A0N7KZV5	Escherichia_phage	95.3	1.2e-29
WP_000849633.1|2073280_2073961_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|2074035_2074758_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2074757_2075363_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2075359_2076031_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2076021_2076510_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2077159_2078119_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2078130_2078400_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2078696_2079020_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143109.1|2079263_2081201_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|2081338_2081518_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2081558_2081831_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2081907_2082123_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2082122_2082620_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2082616_2083054_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2083256_2083754_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2083750_2084008_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2084470_2084698_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2084739_2085105_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958380.1|2085397_2085961_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001457603.1|2085957_2087619_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_151547372.1|2087682_2089620_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.1	0.0e+00
WP_001063099.1|2089664_2089886_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|2092412_2092739_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2092748_2093099_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2093095_2093542_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2093538_2093883_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2093941_2094658_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2094663_2095038_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2095133_2095343_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_103656124.1|2095395_2098638_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2098630_2098972_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|2098971_2099670_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2099686_2100007_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2100114_2100288_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|2100358_2101282_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_001457600.1|2101336_2102074_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	99.6	9.1e-150
WP_122994717.1|2102019_2102652_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_151547373.1|2102890_2106373_+	DUF1983 domain-containing protein	NA	A0A0P0ZDT4	Stx2-converting_phage	99.5	0.0e+00
WP_001230459.1|2106439_2107039_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080209.1|2107103_2108417_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023452.1|2108418_2108688_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2108828_2109704_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_151547374.1|2109928_2110579_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	2.1e-121
WP_012779375.1|2110563_2110848_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	100.0	1.2e-49
WP_151583366.1|2111293_2111488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322268.1|2111427_2111559_+	hypothetical protein	NA	O64339	Escherichia_phage	59.5	1.5e-07
WP_001303036.1|2111902_2113069_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2113187_2113661_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2113859_2114918_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2115089_2115419_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2115519_2115702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2116190_2116304_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2116316_2116511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2116969_2117338_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2117411_2117633_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2117695_2118172_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2118186_2118666_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2118747_2119569_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2119789_2120200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2120215_2120899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2121034_2122105_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2122101_2123007_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_064717557.1|2123003_2123855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966626.1|2124133_2126281_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071525094.1|2126387_2126570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|2127728_2129267_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 6
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	2153652	2194935	5573120	terminase,head,tail,portal,transposase,holin,integrase	Escherichia_phage(36.59%)	53	2133923:2133937	2157777:2157791
2133923:2133937	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2153652_2154675_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2154674_2154878_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2154936_2157408_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2157503_2157692_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2157688_2157877_-	cell division inhibitor	NA	NA	NA	NA	NA
2157777:2157791	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2158357_2158510_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2158784_2159429_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2159526_2159754_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2159750_2160176_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2160244_2161282_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|2161313_2161736_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2161770_2162469_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2162490_2162715_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2162711_2163068_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2163100_2163253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2163249_2163561_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2163687_2164251_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278461.1|2164360_2164465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2164651_2164864_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2164905_2165091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2165031_2165310_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2165311_2166361_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2166373_2166733_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2166729_2167419_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|2167449_2167572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023257.1|2168958_2170809_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|2170890_2172104_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2172424_2172631_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2172635_2172980_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2173030_2173564_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2173719_2173902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2173914_2174046_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2174273_2174459_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2174985_2175300_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2175381_2175606_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2176000_2176510_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2178380_2178587_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2178583_2180176_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2180165_2181671_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2181707_2182055_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2182112_2182379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2182360_2183101_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2183114_2183546_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2183572_2183986_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_151547375.1|2183966_2186546_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.7	0.0e+00
WP_000847298.1|2186542_2186872_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|2186871_2187570_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_151583367.1|2187580_2188324_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	1.1e-147
WP_122998366.1|2188269_2188899_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.0	2.6e-105
WP_151583368.1|2189139_2192619_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230508.1|2192686_2193286_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268855.1|2193350_2194664_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|2194665_2194935_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 7
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	2280780	2375843	5573120	terminase,tail,protease,portal,holin,tRNA,integrase	Escherichia_phage(36.21%)	101	2284766:2284780	2294476:2294490
WP_001025318.1|2280780_2282514_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302537.1|2282729_2283296_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185748.1|2283309_2284056_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214277.1|2284443_2285544_+	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
2284766:2284780	attL	CTCATCGCCAGGAAA	NA	NA	NA	NA
WP_000176813.1|2285568_2287998_+	Trimethylamine-N-oxide reductase 2	NA	NA	NA	NA	NA
WP_000564730.1|2288162_2289134_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2289130_2289874_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2289914_2290310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137555.1|2290362_2291127_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.3e-71
WP_000063650.1|2291143_2292430_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_001193437.1|2292463_2292718_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001692487.1|2292909_2293281_-	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.1	3.0e-61
WP_000734577.1|2293321_2294149_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	98.2	1.1e-130
WP_001028879.1|2294145_2294334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001692486.1|2294394_2294787_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	56.4	2.6e-34
2294476:2294490	attR	TTTCCTGGCGATGAG	NA	NA	NA	NA
WP_001692485.1|2294783_2295002_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	76.4	2.8e-22
WP_000002325.1|2294973_2295189_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	60.6	5.5e-15
WP_000148632.1|2295188_2295548_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	76.4	2.3e-42
WP_000632555.1|2295732_2295924_-	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	96.8	1.7e-28
WP_000781571.1|2295920_2296112_-	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	93.7	3.3e-27
WP_000930864.1|2296113_2296557_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	45.6	1.6e-08
WP_000402986.1|2296669_2297125_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001405833.1|2297190_2297433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183589.1|2297594_2297888_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	93.8	4.1e-45
WP_001287835.1|2298136_2298505_+	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	98.4	4.6e-62
WP_000424038.1|2298616_2300275_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	95.8	0.0e+00
WP_000844629.1|2300276_2301245_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	99.4	5.5e-187
WP_001258397.1|2301244_2302102_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	92.3	1.6e-150
WP_000762843.1|2302101_2302917_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	84.1	5.9e-118
WP_000576620.1|2303053_2303998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151583369.1|2304854_2306801_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000143458.1|2306938_2307118_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2307158_2307404_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284510.1|2307481_2307697_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087733.1|2307701_2308235_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001443546.1|2308312_2308504_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
WP_001208682.1|2308881_2309088_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2309152_2309377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151547388.1|2309337_2309538_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	8.5e-10
WP_000348565.1|2309839_2310316_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|2310312_2312436_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|2312432_2312645_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|2312644_2314147_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2314091_2316116_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2316203_2316530_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|2316522_2316804_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|2316806_2317430_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682716.1|2317442_2317841_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2317848_2318601_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2318614_2319037_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|2319063_2319372_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_151547389.1|2319415_2322061_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.1	0.0e+00
WP_000847304.1|2322057_2322387_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_080025938.1|2322386_2323085_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_151310936.1|2323095_2323839_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	4.0e-145
WP_140439088.1|2323784_2324417_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	7.9e-102
WP_151547390.1|2324664_2328057_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	84.1	0.0e+00
WP_001230428.1|2328124_2328724_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_151547391.1|2328788_2330102_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	1.3e-77
WP_151547392.1|2330103_2330373_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	5.4e-44
WP_024230666.1|2331233_2334620_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	99.5	0.0e+00
WP_000891621.1|2336039_2336606_-	hydrolase	NA	NA	NA	NA	NA
WP_001258685.1|2336915_2338688_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|2338805_2339258_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2339286_2340027_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2340061_2340583_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024949.1|2340584_2341187_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010723105.1|2341257_2341323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2341461_2342073_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2342081_2343092_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571476.1|2343337_2344123_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2344119_2344875_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001303192.1|2344953_2345886_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2345901_2347224_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448391.1|2347343_2348315_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091169.1|2348445_2349888_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|2350015_2350885_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301737.1|2351222_2352698_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001069467.1|2352932_2354744_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|2354780_2355422_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173471.1|2355477_2356656_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|2356789_2357080_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|2357146_2357503_+	protein YebF	NA	NA	NA	NA	NA
WP_000024742.1|2357829_2358489_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936917.1|2358697_2360758_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944243.1|2360754_2361417_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_000011656.1|2361440_2362097_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2362198_2362429_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|2362567_2362942_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|2362945_2363818_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|2363830_2364172_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812736.1|2364567_2365224_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_001296140.1|2365224_2365416_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2365520_2365757_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001302304.1|2365874_2367314_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001302055.1|2367394_2370028_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|2369996_2371280_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2371409_2371907_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431368.1|2372003_2372702_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|2372721_2374770_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|2374961_2375843_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 8
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	2615497	2767932	5573120	terminase,head,tail,protease,portal,lysis,transposase,capsid,holin,tRNA,integrase	Enterobacteria_phage(33.98%)	170	2623748:2623763	2704829:2704844
WP_001260835.1|2615497_2616319_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2616418_2616502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2616594_2616930_-	acid shock protein	NA	NA	NA	NA	NA
WP_024230673.1|2617326_2618580_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2618686_2619580_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2619714_2620935_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2621059_2621755_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2621707_2623000_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2623157_2623772_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
2623748:2623763	attL	TATCTTGCTGTGAAAA	NA	NA	NA	NA
WP_000526515.1|2623814_2624669_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2624670_2625288_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2625298_2627722_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_024230672.1|2627782_2630197_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.7e-209
WP_000778147.1|2630395_2630701_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2630808_2631519_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2631521_2632082_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2632116_2632458_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2632592_2632919_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2633091_2633217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2633907_2634144_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|2634231_2636703_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2636795_2636987_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2636983_2637172_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2637572_2637737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2637740_2637959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2638030_2638330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2638682_2638961_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2638962_2639154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2639174_2639546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2639643_2639946_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2639942_2640368_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2640390_2641353_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2641359_2642100_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2642910_2643306_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2643362_2643947_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2644062_2644167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2644355_2644568_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2644735_2645014_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2645015_2646065_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2646077_2646437_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2646433_2647123_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|2647153_2647276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|2647760_2648189_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000411805.1|2650965_2651172_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2651176_2651521_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2651571_2652105_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2652375_2652945_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2652944_2653091_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2653318_2653504_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|2653928_2654156_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2654197_2654563_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_085952407.1|2654559_2654739_+	hypothetical protein	NA	H6WZK7	Escherichia_phage	83.9	1.2e-18
WP_000958371.1|2654854_2655418_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	99.5	1.8e-89
WP_001301491.1|2655414_2657076_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2657139_2659077_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2659121_2659343_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267295.1|2659288_2661868_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_054428291.1|2661870_2662197_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	1.6e-53
WP_001007905.1|2662206_2662557_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2662553_2663000_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2662996_2663341_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2663406_2664123_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2664137_2664512_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2664607_2664817_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2664864_2668107_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2668099_2668441_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2668440_2669139_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2669155_2669410_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2669519_2669630_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2669932_2670811_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967274.1|2670864_2671602_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	99.6	9.1e-150
WP_071526731.1|2671547_2671784_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2671796_2671886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2671905_2674254_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2674844_2678246_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2680349_2680475_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2680554_2680830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2680890_2682252_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_085948178.1|2682417_2683630_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303923.1|2683685_2683898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000799385.1|2683928_2684792_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2684775_2685912_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2686161_2687388_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2687436_2688558_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735407.1|2688633_2690094_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2690093_2690765_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2690933_2692304_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2692307_2692949_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2692984_2694091_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2694144_2694606_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2694615_2695269_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2695440_2696691_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2696804_2697947_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2697936_2698173_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2698276_2699101_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2699097_2699799_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2699795_2700098_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2700165_2700498_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2700562_2700685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2700742_2702269_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_071525067.1|2702388_2702580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053040.1|2702770_2703226_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2703225_2703396_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2703388_2703679_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2703675_2704038_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2704034_2704175_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2704171_2704861_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
2704829:2704844	attR	TTTTCACAGCAAGATA	NA	NA	NA	NA
WP_000544528.1|2705182_2705488_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2705474_2705951_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2706167_2706350_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2706440_2706734_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2707025_2707436_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2707721_2707928_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2708092_2708287_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2708675_2709221_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2709195_2711121_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2711117_2711324_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2711320_2712922_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2712902_2714222_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2714231_2714564_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2714619_2715645_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2715686_2716085_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2716096_2716450_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000683105.1|2717035_2717431_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2717438_2718179_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2718194_2718617_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2718598_2719033_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2719025_2721575_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2721571_2721901_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2721900_2722599_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2722604_2723348_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2723284_2723917_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2723977_2727376_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2727442_2728042_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2728106_2731022_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2731021_2731603_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_085948178.1|2732326_2733539_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001079482.1|2733944_2734451_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2734487_2734988_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2735066_2735249_-	general stress protein	NA	NA	NA	NA	NA
WP_000937476.1|2736470_2736719_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171540.1|2736794_2737175_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2737171_2737519_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2737568_2739107_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2739409_2740894_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2741080_2742034_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_085948178.1|2742619_2743832_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151583370.1|2743884_2744430_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001185665.1|2745668_2745935_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101055.1|2745938_2746751_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000072536.1|2746774_2747470_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_001056834.1|2747989_2748358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2748460_2748862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295992.1|2749102_2749396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284277.1|2749467_2750127_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000807626.1|2750203_2750665_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001304191.1|2750871_2751783_-	hemolysin HlyE	NA	NA	NA	NA	NA
WP_085948178.1|2751943_2753156_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000897378.1|2753468_2753888_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457644.1|2753887_2755156_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000943459.1|2755201_2755732_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000406391.1|2755877_2757419_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000234823.1|2757640_2758360_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000190855.1|2758411_2759944_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_001266908.1|2760306_2761605_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000197859.1|2761614_2762685_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_000340206.1|2763073_2764810_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000051572.1|2764905_2765820_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_001295616.1|2765919_2766531_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_085952403.1|2766718_2767932_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
>prophage 9
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	2841914	2940173	5573120	terminase,head,tail,portal,transposase,capsid,holin,integrase	Escherichia_phage(31.19%)	129	2834640:2834653	2851462:2851475
2834640:2834653	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|2841914_2843045_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2843022_2843271_-	excisionase	NA	NA	NA	NA	NA
WP_151547385.1|2843335_2845807_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	3.2e-58
WP_001090200.1|2845899_2846091_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2846087_2846276_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2846673_2846841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2846834_2847068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2847045_2847453_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2847475_2847694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2847766_2848066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2848330_2848738_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2848814_2849042_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2849025_2849577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2849548_2850589_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|2850620_2851043_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|2851229_2851811_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
2851462:2851475	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|2851807_2851972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2852670_2853429_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2853707_2853920_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2854140_2854398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2854467_2854746_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2854747_2855794_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2855806_2856166_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2856174_2856705_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2856946_2857144_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2857294_2858353_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_064761991.1|2858844_2859030_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_072617007.1|2859149_2861003_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000284517.1|2861152_2861368_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|2861372_2861717_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2861767_2862301_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2862571_2863141_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2863140_2863287_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2863514_2863700_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2864124_2864352_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2864393_2864759_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_151547386.1|2865048_2865612_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	1.4e-89
WP_001301491.1|2865608_2867270_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2867333_2869271_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2869315_2869537_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267295.1|2869482_2872062_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_054428291.1|2872064_2872391_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	1.6e-53
WP_001007905.1|2872400_2872751_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2872747_2873194_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2873190_2873535_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2873593_2874310_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2874315_2874690_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2874785_2874995_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_103656124.1|2875047_2878290_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2878282_2878624_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2878623_2879061_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_151583371.1|2879248_2882725_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
WP_001230428.1|2882792_2883392_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_151583372.1|2883456_2884680_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.1	3.0e-81
WP_001023362.1|2884681_2884951_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2885064_2885640_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_010917823.1|2886017_2886365_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001121225.1|2886349_2887000_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2887582_2889121_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2889170_2889518_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2889514_2889895_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2890857_2891172_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2891810_2893055_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2893147_2893336_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2893332_2893521_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2894085_2894295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2894295_2894934_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2894945_2895098_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2895390_2895729_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2896120_2896363_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_151547382.1|2896346_2896772_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2896840_2897884_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|2897915_2898338_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|2898371_2899088_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2899120_2899402_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2899398_2899626_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2899618_2899930_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2900057_2900276_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2900277_2900835_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2901068_2901281_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2901400_2901745_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2901866_2902139_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2902140_2903190_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2903202_2903508_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2903570_2904125_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2904349_2904547_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2904682_2905396_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2905846_2906278_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2906755_2908606_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|2909053_2909260_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2909264_2909609_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2909659_2910193_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2910463_2911033_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2911032_2911179_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2911401_2911587_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2912112_2912427_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2912508_2912733_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|2912748_2913006_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867498.1|2913119_2913665_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2913639_2915565_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2915561_2915768_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2915764_2917366_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2917346_2918666_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001457523.1|2918675_2919008_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_000063265.1|2919063_2920089_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2920130_2920529_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2920540_2920894_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2920908_2921442_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2921438_2921834_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2921841_2922594_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2922607_2923030_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2923056_2923470_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032213368.1|2923450_2926063_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|2926059_2926389_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|2926388_2927087_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_151547366.1|2927097_2927841_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.8	1.7e-148
WP_122998366.1|2927786_2928416_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.0	2.6e-105
WP_151583373.1|2928656_2932136_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_001230508.1|2932203_2932803_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268855.1|2932867_2934181_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|2934182_2934452_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2934565_2935141_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2935213_2935843_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2935924_2936566_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001480712.1|2936596_2936731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096855372.1|2936727_2937042_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2937101_2938385_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2938473_2939934_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2939969_2940173_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 10
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	3211796	3333873	5573120	terminase,tail,head,protease,portal,transposase,capsid,holin,integrase	Enterobacteria_phage(30.43%)	146	3319440:3319460	3340530:3340550
WP_000422055.1|3211796_3212846_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|3213065_3213824_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|3213820_3214411_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3214450_3215323_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|3215535_3217119_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3217146_3217767_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|3217763_3218645_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3218782_3218827_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|3218918_3220481_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|3220480_3222076_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001302292.1|3222079_3223438_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|3223449_3224643_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|3224642_3225449_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3225829_3226009_+	general stress protein	NA	NA	NA	NA	NA
WP_001056499.1|3226094_3226595_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|3226640_3227147_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024230666.1|3228978_3232365_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	99.5	0.0e+00
WP_151547392.1|3233225_3233495_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	5.4e-44
WP_151547391.1|3233496_3234810_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	1.3e-77
WP_001230428.1|3234874_3235474_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_151547390.1|3235541_3238934_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	84.1	0.0e+00
WP_140439088.1|3239181_3239814_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	7.9e-102
WP_151310936.1|3239759_3240503_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	4.0e-145
WP_080025938.1|3240513_3241212_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847304.1|3241211_3241541_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_151547389.1|3241537_3244183_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.1	0.0e+00
WP_000532073.1|3244226_3244535_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|3244561_3244984_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|3244997_3245750_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3245757_3246156_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974958.1|3246168_3246792_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281348.1|3246794_3247076_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|3247068_3247395_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|3247482_3249507_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|3249451_3250954_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|3250953_3251166_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|3251162_3253286_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000348565.1|3253282_3253759_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_151547388.1|3254060_3254261_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	8.5e-10
WP_000735655.1|3254221_3254446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3254510_3254717_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001443546.1|3255094_3255286_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
WP_000087733.1|3255363_3255897_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_000284510.1|3255901_3256117_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290232.1|3256193_3256466_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	97.8	7.2e-20
WP_000143458.1|3256506_3256686_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_151583375.1|3256821_3258768_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.8	0.0e+00
WP_000576620.1|3259624_3260569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762843.1|3260705_3261521_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	84.1	5.9e-118
WP_001258397.1|3261520_3262378_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	92.3	1.6e-150
WP_000844629.1|3262377_3263346_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	99.4	5.5e-187
WP_000424038.1|3263347_3265006_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	95.8	0.0e+00
WP_001287835.1|3265117_3265486_-	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	98.4	4.6e-62
WP_001183589.1|3265734_3266028_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	93.8	4.1e-45
WP_001405833.1|3266189_3266432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000402986.1|3266497_3266953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000930864.1|3267065_3267509_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	45.6	1.6e-08
WP_000781571.1|3267510_3267702_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	93.7	3.3e-27
WP_000632555.1|3267698_3267890_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	96.8	1.7e-28
WP_000148632.1|3268074_3268434_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	76.4	2.3e-42
WP_000002325.1|3268433_3268649_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	60.6	5.5e-15
WP_001692485.1|3268620_3268839_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	76.4	2.8e-22
WP_001692486.1|3268835_3269228_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	56.4	2.6e-34
WP_001028879.1|3269288_3269477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734577.1|3269473_3270301_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	98.2	1.1e-130
WP_001692487.1|3270341_3270713_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.1	3.0e-61
WP_001193437.1|3270904_3271159_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063650.1|3271192_3272479_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_000147167.1|3272534_3272753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|3273346_3273775_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|3275503_3276094_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3276277_3276925_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3277061_3277208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3277635_3277914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|3278253_3278634_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|3278630_3278978_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3279027_3280566_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|3281531_3282101_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3282166_3283078_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3283184_3283307_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_024262009.1|3284448_3284637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025672.1|3284904_3286230_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3287256_3287526_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|3287527_3288841_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3288992_3289592_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|3289659_3292005_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|3291956_3293132_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3293474_3294107_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_151583376.1|3294052_3294796_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.0e-148
WP_151583377.1|3294806_3295505_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	98.3	3.4e-130
WP_000807954.1|3295504_3295846_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_103656124.1|3295838_3299081_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	100.0	0.0e+00
WP_001453698.1|3299133_3299343_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3299438_3299813_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3299818_3300535_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3300593_3300938_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3300934_3301381_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3301377_3301728_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3301737_3302064_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|3304590_3304812_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_151547372.1|3304856_3306794_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.1	0.0e+00
WP_151583378.1|3306857_3308234_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.5	9.3e-257
WP_085952403.1|3308217_3309431_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000958387.1|3309829_3310393_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_071526897.1|3310584_3310716_-	DNase	NA	H6WZK7	Escherichia_phage	100.0	2.4e-05
WP_000279796.1|3310684_3311050_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3311091_3311277_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3311406_3311547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3311903_3312128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3312192_3312399_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3312626_3312773_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3312772_3313342_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3313612_3314146_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3314196_3314541_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3314545_3314761_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3314836_3315106_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3315143_3315326_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3315473_3317411_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3317725_3317893_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3318489_3319311_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3319307_3319682_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3319440:3319460	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3319694_3320744_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3320745_3321024_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3321191_3321404_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3321592_3321697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3321812_3322400_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3322402_3322594_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3322595_3323033_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3323019_3323337_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3323290_3323608_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3323597_3323900_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|3323896_3324214_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|3324210_3324927_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|3324960_3325383_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001457513.1|3325414_3326452_-	primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	79.5	1.5e-89
WP_000693915.1|3326520_3326946_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3326929_3327253_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3327377_3327854_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3328169_3328322_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_054428263.1|3328436_3328952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3329084_3329474_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3329535_3329805_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3329773_3330892_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3331058_3331853_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3331849_3332896_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3333051_3333873_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3340530:3340550	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	3454855	3504522	5573120	protease,transposase,integrase	Stx2-converting_phage(29.41%)	51	3492438:3492453	3510338:3510353
WP_085948178.1|3454855_3456068_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000301248.1|3456789_3457365_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3457433_3458012_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3458060_3459101_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3459123_3459579_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3459601_3460759_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|3460758_3461340_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3461662_3462721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|3462730_3463873_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3463865_3464639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3464640_3465720_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3465719_3466676_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3466686_3467895_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3467912_3468380_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3468640_3468970_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3468956_3469298_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3470240_3471854_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3471884_3472235_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3472231_3472657_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397129.1|3474994_3475666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302565.1|3475854_3476106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001687190.1|3476083_3476263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817755.1|3476324_3476606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3476537_3476678_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_001310151.1|3476669_3477026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803992.1|3476979_3477243_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3478454_3479072_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3479083_3479758_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3479758_3480223_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000612150.1|3481935_3482256_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3482264_3482567_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3482657_3483356_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3483736_3484012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3484236_3485856_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3485948_3486308_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_071525024.1|3486442_3486691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303893.1|3486716_3486917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|3486992_3487283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3487306_3487558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|3487605_3488211_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_085948178.1|3489263_3490476_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001171554.1|3490915_3491296_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612606.1|3491292_3491640_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_000998048.1|3491685_3493224_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3492438:3492453	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000233452.1|3493980_3496341_-	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|3496495_3497059_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000335698.1|3497879_3499265_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3499483_3499681_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3499907_3500204_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|3501315_3503133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|3503319_3504522_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
3510338:3510353	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
>prophage 12
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	3596967	3653652	5573120	tail,head,protease,portal,transposase,holin,integrase	Escherichia_phage(29.79%)	73	3598902:3598917	3655417:3655432
WP_000003653.1|3596967_3597555_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3597551_3598259_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3598277_3600071_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3598902:3598917	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3600067_3601186_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|3601803_3601986_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|3603318_3603588_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_151583379.1|3603589_3604804_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	97.5	7.6e-77
WP_001230444.1|3604868_3605468_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515110.1|3605535_3609009_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3609142_3609670_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001303882.1|3609700_3609907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151310946.1|3609860_3610493_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.7e-104
WP_000194760.1|3610438_3611182_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3611192_3611891_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3611890_3612220_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_134790849.1|3612216_3612981_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_001455418.1|3612932_3614795_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_000533402.1|3614775_3615189_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3615215_3615647_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3615660_3616401_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3616382_3616649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3616706_3617054_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3617090_3618596_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3618585_3620178_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3620174_3620381_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|3622251_3622494_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3622543_3624082_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3624131_3624479_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000235421.1|3624931_3625207_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3625957_3626164_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3626126_3626471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3626419_3626692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3626624_3626819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3626851_3627385_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3627605_3627719_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3627940_3628126_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3628653_3628968_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_141012355.1|3629172_3630386_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
WP_000874392.1|3630561_3632412_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|3632529_3632733_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3633179_3633893_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3633987_3634227_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3634513_3635332_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3635483_3635855_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3635844_3636216_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3636228_3637278_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3637279_3637558_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3637725_3637938_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3637982_3638120_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_097561939.1|3638282_3638474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160654.1|3638485_3639259_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3639610_3640024_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3640039_3640810_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3640831_3641578_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3641584_3642676_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3642754_3643210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3643416_3643842_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3643825_3644098_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3644206_3644608_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3644635_3644827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3644826_3645114_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071526892.1|3645115_3645334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3645391_3645547_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_085948178.1|3645650_3646864_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000394511.1|3647001_3647391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3647577_3647763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3647764_3648070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3648336_3648525_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3648521_3648713_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_103656106.1|3648806_3651278_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3651345_3651588_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3651565_3652585_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3652992_3653652_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3655417:3655432	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	3884584	3923993	5573120	terminase,tail,protease,portal,lysis,transposase,holin,integrase	Enterobacteria_phage(51.16%)	53	3884169:3884183	3924067:3924081
3884169:3884183	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3884584_3885283_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_096976694.1|3885335_3885539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951026.1|3885513_3886395_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3886563_3886725_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3887221_3888241_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3888274_3889255_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3889431_3889701_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3889702_3891019_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3891078_3891678_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3891748_3895162_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3895222_3895831_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3895767_3896511_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3896516_3897215_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3897224_3897554_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_085948178.1|3898242_3899455_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001161009.1|3901903_3902233_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3902241_3902628_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3902688_3903432_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3903442_3903844_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3903840_3904419_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3904430_3904706_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3904698_3905022_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3905108_3907136_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3907080_3907416_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3907537_3908662_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3908589_3908802_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3908798_3910901_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3910900_3911392_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|3911381_3911660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3912066_3912219_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3912206_3912674_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3912670_3913168_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3913167_3913383_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3913525_3913924_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3914004_3914163_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3914248_3914992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3915175_3915865_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3915879_3916002_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3916339_3917299_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3917510_3918176_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3918172_3918793_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3918785_3918956_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3918952_3919135_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3919832_3920513_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3920509_3920692_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3920664_3920856_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3920866_3921148_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3921246_3921468_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3921678_3922281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3922405_3922591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3922523_3922691_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3922730_3922949_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|3923111_3923993_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
3924067:3924081	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	4489957	4567356	5573120	tail,transposase,plate	Escherichia_phage(30.77%)	75	NA	NA
WP_085948178.1|4489957_4491171_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000687183.1|4491661_4492561_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4493236_4494193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4494325_4496659_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4496672_4496996_-	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_001071227.1|4496995_4497217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4497213_4497771_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4497767_4498028_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4498961_4499714_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4499710_4500262_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4500267_4500540_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_100068595.1|4500687_4500891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|4500949_4501516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4502137_4502770_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4502762_4503221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4503220_4503838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4503810_4504227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|4504639_4505852_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000246059.1|4507687_4508431_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4509254_4510028_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4510085_4510640_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4510669_4511080_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4511100_4511544_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4511515_4512109_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4512108_4512903_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4512902_4513214_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251067.1|4514165_4514459_-	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000437875.1|4514577_4514778_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4514878_4515592_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_085948178.1|4516697_4517910_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303805.1|4518237_4518483_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4519552_4520806_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4520817_4521921_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4522208_4523264_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4523302_4523704_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4523761_4525006_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4525097_4525556_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4525816_4527274_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4527330_4527867_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4527799_4528066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4528372_4528825_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4528834_4529233_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|4529235_4529529_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4529580_4530636_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|4530706_4531477_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4531436_4533176_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4533993_4534767_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4534952_4535213_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4535231_4535492_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4535647_4536388_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4536358_4537126_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4537230_4537809_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4538048_4540493_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4540535_4541009_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4541162_4541933_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4542050_4543223_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4543303_4543489_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4543403_4543667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4543868_4545629_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4545631_4546768_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|4546875_4547166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356741.1|4547513_4548101_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_085949308.1|4548169_4549702_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.2e-24
WP_000509109.1|4550716_4554949_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103335.1|4555024_4557166_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4557375_4557894_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4558590_4559091_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4559125_4559350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4559400_4560792_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4560882_4561296_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4561299_4563150_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4563113_4564196_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4564220_4565501_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4565497_4566022_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4566024_4567356_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 15
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	5005641	5064669	5573120	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|5005641_5006994_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|5007087_5007639_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|5007794_5009168_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|5009343_5010342_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|5010374_5011370_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|5011356_5012379_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|5012392_5013895_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|5014034_5014991_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|5015300_5015831_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|5015910_5016261_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|5016254_5016506_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|5016717_5017059_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|5017061_5020841_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|5020837_5022571_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|5022776_5023415_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|5023737_5025081_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|5025176_5025383_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|5025707_5026262_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|5026324_5027263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5027474_5028215_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|5028404_5030348_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|5030465_5030846_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5030934_5031795_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5031902_5032868_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5032975_5033638_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5033682_5035095_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5035403_5036024_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5036241_5036880_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5037014_5038223_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5038230_5038662_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5039284_5040079_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5040149_5040599_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5040640_5040868_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5040872_5041187_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5041193_5041589_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5041915_5042191_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5042319_5043006_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|5043005_5043860_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5043869_5044520_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5044533_5044998_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5045007_5045313_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5045328_5046726_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5048252_5049008_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5049004_5049754_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5049935_5050265_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5050413_5050689_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|5050805_5052431_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5052514_5053678_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5053680_5054319_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5054328_5054727_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5054744_5055404_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5055454_5056153_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5056171_5056573_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5056699_5057431_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5057611_5060053_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5060091_5060517_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5060721_5062020_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5062123_5062321_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5062402_5063407_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5063409_5064669_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 16
NZ_CP032808	Escherichia coli strain ERL04-3476 chromosome, complete genome	5573120	5201549	5216214	5573120	tail,tRNA,integrase	Enterobacteria_phage(37.5%)	18	5197390:5197405	5214919:5214934
5197390:5197405	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5201549_5202965_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000891404.1|5204196_5204439_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5204572_5205610_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5205698_5206796_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5206857_5207106_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5207266_5207908_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5207989_5208619_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5208691_5209264_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5209375_5209645_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5209646_5210960_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5211024_5211624_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5212945_5213482_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5213472_5213823_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5213819_5214104_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|5214113_5214293_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|5214439_5214637_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5214981_5215263_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5214919:5214934	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|5215680_5216214_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP032809	Escherichia coli strain ERL04-3476 plasmid pERL04-3476-1, complete sequence	92771	8951	60300	92771	transposase,protease,integrase	Macacine_betaherpesvirus(38.46%)	49	38653:38667	60025:60039
WP_000998048.1|8951_10490_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|10539_10887_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|10883_11264_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_071525077.1|15461_15641_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|16242_17064_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|17063_18170_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|18259_19981_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|20054_21053_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001302198.1|21655_21871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358886.1|21933_24630_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|24716_25592_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|25649_27560_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|27559_29065_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|29066_30290_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|30320_30755_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|30751_31306_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|31320_31668_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|31664_32264_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|32260_33238_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|33276_34449_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|34435_34948_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|35005_35839_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|35930_36332_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|38222_38738_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
38653:38667	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|38739_41736_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|41785_43906_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|43909_45349_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|45415_45610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|45639_45924_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|45924_46122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|46092_46323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|46443_47184_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|47468_48446_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|48758_48947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|48853_49054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49050_49671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|49667_50351_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|50809_51028_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51029_51335_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|51335_52142_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|52818_52899_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|52864_54078_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000852148.1|54153_54909_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|55496_56663_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|56662_57634_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001349526.1|58018_58291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|58328_59231_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|59234_59540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|59616_60300_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
60025:60039	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
