The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	1229646	1243095	5390258	holin,tail	Enterobacteria_phage(38.46%)	18	NA	NA
WP_001223948.1|1229646_1230258_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230254_1230920_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1230916_1231540_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1231792_1232536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232621_1232789_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143065.1|1233196_1235050_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1235199_1235415_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235419_1235764_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236120_1236501_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236497_1236845_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1237474_1237744_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1237904_1238327_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1238456_1239515_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1239593_1240244_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1240426_1241017_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|1241003_1241123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|1241518_1241767_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1242612_1243095_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	1520719	1526106	5390258	integrase	Enterobacteria_phage(50.0%)	6	1509668:1509684	1528302:1528318
1509668:1509684	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001005794.1|1520719_1521250_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1521249_1521717_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1521703_1522384_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1522393_1523530_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1523704_1524862_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1525173_1526106_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1528302:1528318	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	1771726	1846663	5390258	holin,integrase,protease,terminase,tail,portal,transposase,tRNA	Enterobacteria_phage(66.67%)	96	1774201:1774221	1822081:1822101
WP_000569336.1|1771726_1772653_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1772657_1773389_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1773369_1773477_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1773536_1774238_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1774201:1774221	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1774258_1775545_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1775578_1775833_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1775851_1775986_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1775989_1776232_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1776319_1776682_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1776678_1777035_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|1777111_1777399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|1777368_1777545_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1777546_1778494_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1778490_1778712_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1778810_1779092_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1779102_1779294_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1779266_1779449_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1779448_1780126_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1780122_1780908_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1780913_1781210_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_001478900.1|1781178_1781331_-	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	3.6e-21
WP_000372942.1|1781285_1781429_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1781397_1781562_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1781634_1782003_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1782263_1782845_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1782861_1783134_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1783646_1784198_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1784204_1784486_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1784608_1785256_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1785364_1785583_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1785697_1785994_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000185456.1|1786026_1786965_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788906.1|1786961_1787663_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1787659_1787950_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1788020_1788299_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1788431_1788647_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1788657_1788894_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1788850_1789297_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1789293_1789821_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1789817_1789994_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1789996_1790398_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1790357_1790567_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1790559_1791165_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1791161_1791356_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1791348_1791783_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_015971135.1|1791771_1792017_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_000691354.1|1792289_1793237_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1793246_1793516_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|1794026_1795973_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|1796110_1796290_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1796330_1796576_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1796653_1796869_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1796873_1797407_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1797677_1798247_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1798246_1798393_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1798620_1798806_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1799017_1799290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1799322_1799799_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1799795_1801919_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1801915_1802128_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1802127_1803630_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001356427.1|1803643_1804534_+|protease	Clp protease ClpP	protease	Q9EYD3	Enterobacteria_phage	100.0	5.8e-167
WP_085948178.1|1804536_1805750_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000502242.1|1805871_1806912_+	peptidase	NA	Q8VNN5	Enterobacteria_phage	99.7	5.9e-195
WP_001097065.1|1806999_1807326_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1807318_1807600_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1807602_1808226_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1808238_1808637_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1808644_1809397_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1809410_1809833_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1809859_1810168_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|1810211_1812857_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1812853_1813183_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1813182_1813881_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1813891_1814635_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1814580_1815210_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001356361.1|1815450_1816626_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_115801855.1|1816577_1818923_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|1818990_1819590_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268835.1|1819654_1820968_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1820969_1821239_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1821606_1821855_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1822369_1824055_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1822081:1822101	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1824051_1824771_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1824817_1825288_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1825329_1825791_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1825915_1827919_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1827915_1829052_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1829044_1829776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1829794_1831324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1831334_1832423_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1833663_1833981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1834042_1837672_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1837681_1839223_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1839386_1840667_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1844629_1846663_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	1973609	2047314	5390258	holin,integrase,head,terminase,tail,portal,transposase	Escherichia_phage(34.69%)	74	1973116:1973131	2031502:2031517
1973116:1973131	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_085952406.1|1973609_1974823_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
WP_000966626.1|1975194_1977342_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071525094.1|1977448_1977631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|1978789_1980328_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1980377_1980725_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1980721_1981102_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1981463_1982009_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1982005_1982749_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1982760_1983840_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1983901_1984837_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1985293_1986211_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1986312_1987263_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1989649_1990366_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1990708_1992163_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1992264_1993581_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1993894_1994947_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_085948178.1|2000422_2001635_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001302302.1|2004993_2005791_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2006026_2007049_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2007048_2007252_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2007310_2009782_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2009877_2010066_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2010062_2010251_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2010731_2010884_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2011158_2011803_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2011900_2012128_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2012124_2012550_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_057699194.1|2012618_2013650_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.8	3.1e-87
WP_000373320.1|2013681_2014104_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2014138_2014837_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2014858_2015083_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2015079_2015436_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2015468_2015621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2015617_2015929_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2016055_2016619_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2016728_2016833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2017019_2017232_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2017273_2017459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2017399_2017678_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2017679_2018729_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2018741_2019101_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2019097_2019787_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|2019817_2019940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|2020420_2020849_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2021326_2023177_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|2023258_2024472_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2024791_2024998_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2025002_2025347_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2025397_2025931_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2026086_2026269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2026281_2026413_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2026640_2026826_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2027352_2027667_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2027748_2027973_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2028367_2028877_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2028848_2030777_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2030760_2030967_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2030963_2032556_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2031502:2031517	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2032545_2034051_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2034087_2034435_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2034492_2034759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2034740_2035481_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2035494_2035926_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2035952_2036366_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_097212984.1|2036346_2038926_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000847298.1|2038922_2039252_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|2039251_2039950_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|2039960_2040704_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|2040649_2041279_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_151555421.1|2041519_2042695_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.0	4.4e-231
WP_115801853.1|2042646_2044998_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|2045065_2045665_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268861.1|2045729_2047043_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2047044_2047314_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 5
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	2424303	2490816	5390258	holin,capsid,head,protease,terminase,tail,portal	Enterobacteria_phage(39.29%)	84	NA	NA
WP_001260835.1|2424303_2425125_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2425224_2425308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2425400_2425736_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2426132_2427386_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2427492_2428386_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2428520_2429741_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2429865_2430561_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2430513_2431806_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2431963_2432578_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2432620_2433475_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2433476_2434094_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2434104_2436528_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2436588_2439015_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2439213_2439519_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2439626_2440337_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2440339_2440900_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2440934_2441276_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2441410_2441737_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2441909_2442035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2442725_2442962_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|2443049_2445521_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2445613_2445805_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2445801_2445990_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2446390_2446555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2446558_2446777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2446848_2447148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2447500_2447779_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2447780_2447972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2447992_2448364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2448461_2448764_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2448760_2449186_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2449208_2450171_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2450177_2450918_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2451728_2452124_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2452180_2452765_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2452880_2452985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2453173_2453386_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2453553_2453832_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2453833_2454883_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2454895_2455255_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2455251_2455941_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|2455971_2456094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|2456580_2457009_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2457487_2459338_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411805.1|2459786_2459993_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2459997_2460342_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2460392_2460926_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2461196_2461766_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2461765_2461912_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2462134_2462320_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2462845_2463160_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2463241_2463466_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|2463481_2463739_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867493.1|2463852_2464398_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2464372_2466298_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2466294_2466501_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2466497_2468099_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2468079_2469399_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2469408_2469741_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2469796_2470822_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2470863_2471262_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2471273_2471627_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2471641_2472175_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2472171_2472567_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2472574_2473327_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2473340_2473763_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2473789_2474203_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2474183_2476796_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2476792_2477122_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2477121_2477820_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2477830_2478574_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|2478519_2479149_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_064234939.1|2479389_2482869_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230508.1|2482936_2483536_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2483600_2484824_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2484825_2485095_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2485208_2485784_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2485856_2486486_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2486567_2487209_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001480712.1|2487239_2487374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241229.1|2487370_2487685_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2487744_2489028_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2489116_2490577_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2490612_2490816_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 6
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	2672783	2730501	5390258	holin,integrase,head,terminase,tail,capsid,tRNA	Escherichia_phage(41.79%)	75	2669241:2669256	2729662:2729677
2669241:2669256	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_001295593.1|2672783_2673218_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2673798_2674440_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2674521_2675151_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2675223_2675799_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2675911_2676181_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2676182_2677496_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2677560_2678160_-	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2678230_2681728_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2681861_2682389_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_010917807.1|2682419_2682626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064732755.1|2682579_2683212_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2683157_2683901_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2683911_2684610_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2684609_2684951_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|2684943_2688024_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|2688075_2688285_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2688380_2688755_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2688760_2689477_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2689545_2689890_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2689886_2690333_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2690329_2690680_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2690689_2691016_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2693542_2693764_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2693808_2695746_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2695809_2697471_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2697467_2698031_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2698319_2698685_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2698726_2698927_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2699058_2699385_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_001412416.1|2699320_2699503_-	hypothetical protein	NA	H6WZK4	Escherichia_phage	98.3	2.2e-25
WP_077631024.1|2699493_2699694_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	71.8	7.2e-09
WP_012817877.1|2699785_2699971_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2700193_2700325_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2700419_2701115_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2701388_2701922_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2701972_2702317_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2702321_2702537_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_021497500.1|2702686_2704540_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|2705114_2705546_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2706107_2706662_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2706658_2706949_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2706948_2707548_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2708047_2709439_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|2709438_2710428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2710395_2711547_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2711978_2712224_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2712302_2712464_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2712474_2712738_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|2712739_2712904_-	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|2712989_2713202_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2713307_2713730_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2713745_2714507_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2714529_2715276_-	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2715282_2716071_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2716148_2716571_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2716567_2716822_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2716901_2717321_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_077697748.1|2717357_2717576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233809.1|2717608_2717743_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|2717753_2717909_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2717905_2718394_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2718835_2719057_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2719056_2719227_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2719301_2719577_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2719678_2722279_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2722271_2723081_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2723136_2723286_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2723323_2723512_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2723611_2723827_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2723828_2725064_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2725115_2726051_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2726179_2727553_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_124056621.1|2727511_2727742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2728030_2729014_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2729268_2730501_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2729662:2729677	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 7
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	2815447	2890903	5390258	holin,integrase,capsid,head,protease,terminase,tail,portal,transposase	Stx2-converting_phage(36.21%)	88	2830949:2830976	2891040:2891067
WP_000422055.1|2815447_2816497_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2816716_2817475_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2817471_2818062_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2818101_2818974_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2819186_2820770_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2820797_2821418_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2821414_2822296_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2822433_2822478_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2822569_2824132_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2824131_2825727_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001302292.1|2825730_2827089_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|2827100_2828294_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2828293_2829100_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2829480_2829660_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2829745_2830246_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2830291_2830798_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2830949:2830976	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|2831299_2831518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|2832111_2832540_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|2834268_2834859_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2835042_2835690_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2835826_2835973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2836400_2836679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2837018_2837399_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2837395_2837743_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2837792_2839331_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2840296_2840866_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2840931_2841843_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2841949_2842072_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_024262009.1|2843213_2843402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025672.1|2843669_2844995_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2846021_2846291_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2846292_2847606_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2847757_2848357_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_115801855.1|2848424_2850770_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001304109.1|2850721_2851897_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2852238_2852871_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2852816_2853560_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|2853570_2854269_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2854268_2854610_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212822.1|2854602_2857845_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_001453746.1|2857892_2858102_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2858197_2858572_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2858586_2859303_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2859368_2859713_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2859709_2860156_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2860152_2860503_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2860512_2860839_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|2860841_2863421_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001063094.1|2863366_2863588_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|2863632_2865570_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2865633_2867295_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|2867291_2867855_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2868144_2868510_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2868551_2868779_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2869203_2869389_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2869616_2869763_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2869762_2870332_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2870602_2871136_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2871186_2871531_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2871535_2871751_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2871900_2873754_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_064761991.1|2873873_2874059_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000935548.1|2874550_2875609_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2875759_2875957_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2876198_2876729_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2876737_2877097_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2877109_2878156_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2878157_2878436_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2878505_2878763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2878983_2879196_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2879474_2880233_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2880931_2881096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2881092_2881674_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|2881860_2882283_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|2882314_2883355_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2883326_2883878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2883861_2884089_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2884165_2884573_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2884836_2885136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2885208_2885427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2885449_2885857_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2885834_2886068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|2886061_2886205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2886541_2886730_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2886726_2886918_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2887010_2889482_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2889546_2889795_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2889772_2890903_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2891040:2891067	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 8
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	2937599	3112209	5390258	holin,integrase,capsid,head,protease,terminase,tail,portal,tRNA,lysis,transposase	Enterobacteria_phage(32.79%)	207	3097776:3097796	3118866:3118886
WP_001299679.1|2937599_2938856_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2939069_2939693_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2939692_2940544_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2940694_2941642_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2941766_2943446_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|2943500_2943779_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2944056_2944641_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2944757_2945849_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|2948670_2949741_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|2949751_2950384_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|2950394_2951813_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001366914.1|2952125_2952254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|2952359_2953817_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|2953844_2954045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|2954152_2955175_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|2955174_2956155_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|2956151_2956910_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000903990.1|2956919_2957564_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010917800.1|2957508_2957790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576838.1|2957728_2958583_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|2958608_2960579_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|2960628_2960883_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|2961083_2961680_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|2961731_2962944_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|2963132_2963744_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|2963843_2964758_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|2964853_2966590_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|2966981_2968052_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2968061_2969360_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|2969722_2971255_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|2971306_2972026_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|2972247_2973789_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|2973934_2974465_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|2974510_2975779_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|2975778_2976198_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|2976570_2977482_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2977688_2978150_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2978226_2978886_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2978957_2979251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2979491_2979893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|2979995_2980364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|2980883_2981579_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2981602_2982415_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2982418_2982685_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_085948178.1|2983850_2985064_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000361110.1|2985237_2985822_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|2986320_2987274_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|2987460_2988945_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|2989247_2990786_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2990835_2991183_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2991179_2991560_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|2991635_2991884_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|2991940_2992609_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|2993106_2993289_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|2993367_2993868_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|2993904_2994411_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|2994429_2995320_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|2995439_2996021_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|2996020_2998936_-	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|2999000_2999600_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|2999666_3003065_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3003125_3003758_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3003694_3004438_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3004443_3005142_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3005141_3005471_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3005467_3008017_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3008009_3008444_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3008425_3008848_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3008863_3009604_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_001336590.1|3009767_3010064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138832.1|3010326_3012051_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
WP_000683109.1|3012083_3012413_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	96.1	2.1e-50
WP_000975100.1|3012409_3012988_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3012999_3013353_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3013364_3013763_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3013804_3014830_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3014885_3015218_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3015227_3016547_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3016527_3018129_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3018125_3018332_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3018328_3020254_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3020228_3020774_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3021162_3021357_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3021521_3021728_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3022013_3022424_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3022715_3023009_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3023099_3023282_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3023498_3023975_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3023961_3024267_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3024588_3025278_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3025274_3025415_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3025411_3025774_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3025770_3026061_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3026053_3026224_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3026223_3026679_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|3026869_3027061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|3027180_3028707_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3028764_3028887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3028951_3029284_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3029351_3029654_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3029650_3030352_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3030348_3031173_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|3031276_3031513_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3031502_3032645_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3032758_3034009_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3034180_3034834_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3034843_3035305_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3035358_3036465_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3036500_3037142_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3037145_3038516_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3038684_3039356_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3039355_3040816_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001302829.1|3041119_3041368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133425.1|3041672_3041954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127893.1|3041967_3043629_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000113645.1|3043612_3043969_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3044092_3044275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3044258_3044699_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3044698_3044995_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3044991_3045330_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000171117.1|3045326_3046502_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	2.4e-184
WP_000504050.1|3046539_3047112_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3047151_3048309_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3048601_3048826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3048950_3049223_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3049233_3049644_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3049640_3049892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3050262_3052395_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3052391_3052691_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3052696_3052939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3052928_3053120_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3053119_3053305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3053297_3053495_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3053520_3054264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3054321_3054510_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001301987.1|3056352_3057474_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|3057522_3058749_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3058998_3060135_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3060118_3060982_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|3061012_3061225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|3061345_3062707_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3062767_3063043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3063122_3063248_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301984.1|3065351_3068753_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3069343_3071692_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3071711_3071801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3071813_3072050_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3071995_3072733_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3072786_3073665_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3073967_3074078_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3074187_3074442_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|3074458_3075157_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|3075156_3075498_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|3075490_3078733_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3078785_3078995_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3079090_3079465_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|3079470_3080187_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|3080245_3080590_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3080586_3081033_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3081029_3081380_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3081389_3081716_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3081795_3084297_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063095.1|3084242_3084464_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.9e-35
WP_000173030.1|3084508_3086446_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|3086509_3088171_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|3088167_3088731_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3089020_3089386_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3089427_3089613_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3089742_3089883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3090239_3090464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3090528_3090735_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3090962_3091109_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3091108_3091678_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3091948_3092482_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3092532_3092877_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3092881_3093097_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3093172_3093442_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3093479_3093662_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3093809_3095747_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3096061_3096229_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3096825_3097647_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3097643_3098018_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3097776:3097796	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3098030_3099080_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3099081_3099360_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3099527_3099740_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3099928_3100033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3100148_3100736_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3100738_3100930_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3100931_3101369_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3101355_3101673_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3101626_3101944_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3101933_3102236_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|3102232_3102550_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|3102546_3103263_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|3103296_3103719_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|3103750_3104788_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3104856_3105282_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3105265_3105589_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3105713_3106190_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3106505_3106658_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3106772_3107288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3107420_3107810_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3107871_3108141_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3108109_3109228_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3109394_3110189_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3110185_3111232_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3111387_3112209_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3118866:3118886	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 9
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	3339684	3489941	5390258	holin,integrase,capsid,head,protease,terminase,tail,bacteriocin,portal,transposase	Escherichia_phage(41.35%)	186	3436487:3436502	3491706:3491721
WP_001028088.1|3339684_3340179_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3340199_3341528_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3341610_3341718_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_024177246.1|3342083_3342290_-	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	100.0	1.3e-26
WP_000203825.1|3342676_3343306_+	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_000763353.1|3343353_3343575_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3343571_3343856_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_072143464.1|3344375_3344741_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.2	5.4e-71
WP_000426668.1|3344740_3345136_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000902692.1|3345369_3345543_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	88.0	7.6e-15
WP_000331700.1|3345608_3353990_-	hypothetical protein	NA	A0A0H4IT29	Shigella_phage	98.8	0.0e+00
WP_000012437.1|3354059_3355325_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_000540391.1|3355335_3355587_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455645.1|3355597_3356044_-	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000509019.1|3356046_3356700_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000035555.1|3356793_3357195_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000078907.1|3357251_3357392_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000836187.1|3357624_3358362_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_001459282.1|3358441_3359059_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000455633.1|3359064_3359343_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000197188.1|3359357_3360626_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_001459281.1|3360622_3362248_-	hypothetical protein	NA	A0A2R2Z356	Escherichia_phage	99.8	0.0e+00
WP_001303606.1|3362542_3362731_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3362869_3363139_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_044390836.1|3363140_3365078_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207919.1|3365074_3365725_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_000829203.1|3365724_3366288_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	7.0e-102
WP_001370499.1|3366271_3366733_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	94.8	3.3e-73
WP_001140442.1|3366783_3367173_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3367228_3368443_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3368466_3369474_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3369631_3371776_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143992.1|3371775_3373482_-|terminase	bacteriophage terminase large subunit	terminase	G9L6K0	Escherichia_phage	100.0	0.0e+00
WP_001086073.1|3373462_3374269_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001283921.1|3374668_3374926_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001505200.1|3374922_3375420_-	kilA-N domain protein	NA	A0A0H4IPL1	Shigella_phage	100.0	2.4e-93
WP_071535903.1|3375641_3375848_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	66.1	2.1e-11
WP_000622438.1|3376075_3376210_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	100.0	4.2e-13
WP_001056876.1|3376224_3376791_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	100.0	1.4e-105
WP_000087461.1|3377065_3377599_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|3377603_3377819_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290231.1|3377895_3378168_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|3378208_3378388_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_060722694.1|3378524_3380462_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.5	0.0e+00
WP_000738068.1|3380948_3381218_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3381229_3382189_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001304085.1|3382571_3382724_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_015967940.1|3382738_3382984_+	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	100.0	2.7e-34
WP_001204880.1|3382972_3383407_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3383399_3383594_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3383590_3384196_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004009.1|3384195_3384918_-	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	100.0	1.3e-129
WP_000290549.1|3384992_3385670_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	100.0	4.3e-130
WP_001254256.1|3385944_3386127_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3386123_3386651_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3386647_3387094_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3387050_3387287_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3387297_3387513_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001036036.1|3387598_3387868_-	hypothetical protein	NA	A0A0P0ZCF7	Stx2-converting_phage	100.0	4.9e-45
WP_023439153.1|3387868_3390775_-	replication protein P	NA	A0A0P0ZC72	Stx2-converting_phage	99.4	0.0e+00
WP_032350764.1|3390882_3391701_-	replication protein	NA	A0A0P0ZC04	Stx2-converting_phage	90.1	9.2e-127
WP_000438533.1|3391863_3392160_-	hypothetical protein	NA	G9L678	Escherichia_phage	96.9	2.6e-47
WP_000064148.1|3392298_3392532_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000428098.1|3392645_3393350_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_001062368.1|3393440_3393998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|3393994_3394747_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000198445.1|3395249_3395633_+	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000167584.1|3395691_3396162_+	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	1.1e-87
WP_001198858.1|3396353_3396494_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361831.1|3396486_3396600_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|3396596_3396785_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536228.1|3396793_3397474_+	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000073097.1|3397470_3398058_+	hypothetical protein	NA	G9L666	Escherichia_phage	100.0	9.9e-107
WP_001111288.1|3398081_3398378_+	DUF2856 family protein	NA	G9L665	Escherichia_phage	100.0	9.5e-50
WP_001214440.1|3398388_3398556_+	DUF2737 family protein	NA	G9L664	Escherichia_phage	100.0	1.5e-23
WP_016241159.1|3398552_3399182_+	hypothetical protein	NA	G9L663	Escherichia_phage	100.0	7.3e-108
WP_151555430.1|3399178_3399955_+	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	79.5	1.9e-105
WP_000797281.1|3400106_3400295_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951706.1|3400296_3400506_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000208030.1|3400502_3401345_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	67.2	5.8e-100
WP_000969528.1|3401341_3401602_+	hypothetical protein	NA	A0A1B1W289	Salmonella_phage	96.5	7.8e-40
WP_000002093.1|3401601_3401886_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	3.5e-49
WP_001303965.1|3401957_3402257_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3402342_3402627_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3402679_3403990_+|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3403986_3404565_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3404585_3404813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|3404850_3406092_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3407899_3408820_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3408819_3409125_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3409278_3409878_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3409874_3412421_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3412420_3413593_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3413722_3414415_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3414387_3415416_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_000818441.1|3418314_3419388_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3419436_3419571_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3419598_3419829_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3419803_3419992_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3420002_3420215_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3420500_3420713_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3421154_3421460_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3421566_3422211_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3422207_3422954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000742329.1|3422953_3425050_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3425095_3426235_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3426222_3426669_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3426688_3428869_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3428988_3430293_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|3430372_3430465_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|3430477_3431614_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3431625_3433170_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3433303_3434161_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3434157_3434556_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3434552_3435140_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3435136_3435844_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3435862_3437656_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3436487:3436502	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3437652_3438771_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|3439388_3439571_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|3441044_3441314_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3441315_3442629_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|3442693_3443293_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3443360_3446834_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3446967_3447495_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_001303882.1|3447525_3447732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074460437.1|3447685_3448318_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	1.9e-103
WP_000194720.1|3448263_3449007_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_060722696.1|3449017_3449716_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	7.1e-128
WP_000847304.1|3449715_3450045_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082450.1|3450041_3452621_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533402.1|3452601_3453015_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3453041_3453473_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3453486_3454227_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3454208_3454475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3454532_3454880_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3454916_3456422_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3456411_3458004_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3458000_3458207_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3458190_3460119_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001301919.1|3460090_3460333_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3460382_3461921_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3461970_3462318_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3462314_3462695_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3462770_3463046_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3463796_3464003_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3463965_3464310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3464258_3464531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3464463_3464658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3464690_3465224_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3465444_3465558_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3465779_3465965_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3466492_3466807_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3468163_3470014_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|3470131_3470335_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3470781_3471495_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3471589_3471829_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3472115_3472934_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3473085_3473457_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3473446_3473818_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3473830_3474880_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3474881_3475160_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3475327_3475540_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3475584_3475722_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_097561939.1|3475884_3476076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160654.1|3476087_3476861_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3477212_3477626_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3477641_3478412_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3478433_3479180_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3479186_3480278_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3480356_3480812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3481018_3481444_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3481427_3481700_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3481808_3482210_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3482237_3482429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3482428_3482716_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|3482717_3482936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3482993_3483149_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3483290_3483680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3483866_3484052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3484053_3484359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3484625_3484814_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3484810_3485002_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3485095_3487567_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3487634_3487877_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3487854_3488874_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3489281_3489941_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3491706:3491721	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 10
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	3720892	3758989	5390258	holin,integrase,protease,terminase,tail,portal,lysis	Enterobacteria_phage(51.16%)	52	3720477:3720491	3759063:3759077
3720477:3720491	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3720892_3721591_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3721821_3722703_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3722872_3723034_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3723530_3724550_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3724583_3725564_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3725740_3726010_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3726011_3727328_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3727387_3727987_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3728057_3731471_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3731531_3732140_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3732076_3732820_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3732825_3733524_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3733533_3733863_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3733862_3736928_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3736899_3737229_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3737237_3737624_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3737684_3738428_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3738438_3738840_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3738836_3739415_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3739426_3739702_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3739694_3740018_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3740104_3742132_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3742076_3742412_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3742533_3743658_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3743585_3743798_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3743794_3745897_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3745896_3746388_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|3746377_3746656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3747062_3747215_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3747202_3747670_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3747666_3748164_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3748163_3748379_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3748521_3748920_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3749000_3749159_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3749244_3749988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3750171_3750861_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3750875_3750998_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3751335_3752295_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3752506_3753172_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3753168_3753789_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3753781_3753952_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3753948_3754131_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3754828_3755509_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3755505_3755688_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3755660_3755852_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3755862_3756144_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3756242_3756464_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3756674_3757277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3757401_3757587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3757519_3757687_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3757726_3757945_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|3758107_3758989_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
3759063:3759077	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 11
NZ_CP032805	Escherichia coli strain ERL05-0623 chromosome, complete genome	5390258	4337976	4389287	5390258	tail,plate,integrase,transposase	Enterobacteria_phage(23.81%)	52	4337547:4337561	4373782:4373796
4337547:4337561	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4337976_4339158_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4340120_4340864_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4341687_4342461_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4342518_4343073_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4343102_4343597_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4343596_4344190_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4344161_4344605_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001096948.1|4344625_4345336_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	86.6	1.3e-65
WP_000788819.1|4345335_4345647_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4346598_4346892_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4347010_4347211_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4347311_4348025_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4348152_4348542_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4348781_4349027_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4350096_4351350_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4351361_4352465_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4352752_4353808_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4353846_4354248_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4354305_4355550_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4355641_4356100_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4356360_4357818_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4357874_4358411_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4358343_4358610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4358916_4359369_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4359378_4359777_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|4359779_4360073_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226188.1|4360124_4361180_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|4361250_4362021_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4361980_4363720_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4364537_4365311_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4365496_4365757_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4365775_4366036_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4366191_4366932_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4366902_4367670_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4367774_4368353_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4368592_4371037_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4371079_4371553_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4371706_4372477_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4372594_4373767_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4373847_4374033_+	protein YncO	NA	NA	NA	NA	NA
4373782:4373796	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4373947_4374211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4374412_4376173_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4376175_4377312_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|4377419_4377710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001690273.1|4378057_4378657_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4378725_4382940_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103125.1|4383015_4385157_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4385366_4385885_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4386581_4387082_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4387116_4387341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4387391_4388783_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4388873_4389287_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
NZ_CP032806	Escherichia coli strain ERL05-0623 plasmid pERL05-0623-1, complete sequence	92785	8214	58184	92785	integrase,transposase,protease	Macacine_betaherpesvirus(45.45%)	46	36701:36715	59957:59971
WP_001034100.1|8214_12117_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_071525077.1|13514_13694_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14295_15117_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15116_16223_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16312_18034_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18107_19106_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001302198.1|19703_19919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358886.1|19981_22678_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|22764_23640_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|23697_25608_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|25607_27113_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|27114_28338_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|28368_28803_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|28799_29354_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|29368_29716_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|29712_30312_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|30308_31286_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|31324_32497_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|32483_32996_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|33053_33887_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|33978_34380_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|36270_36786_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
36701:36715	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|36787_39784_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|39833_41954_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|41957_43397_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|43463_43658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|43687_43972_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|43972_44170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032195322.1|44140_44380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|44500_45241_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|45525_46503_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|46815_47004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|46910_47111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|47107_47728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|47724_48408_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|48866_49085_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|49086_49392_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|49392_50199_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|50875_50956_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|50921_52135_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_071525396.1|52096_52435_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|53022_54189_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|54188_55160_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001349526.1|55544_55817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336590.1|55900_56197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138832.1|56459_58184_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
59957:59971	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
