The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	1222297	1245834	5553457	integrase,tail,holin,transposase	Stx2-converting_phage(35.29%)	30	1213943:1213957	1246705:1246719
1213943:1213957	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1222297_1223503_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1223504_1224818_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1224814_1226446_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1226446_1226845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1226942_1227356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024180907.1|1227751_1229002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1229077_1229380_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1229415_1230171_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1230542_1231109_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1231083_1231695_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1231691_1232357_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1232353_1232977_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1233229_1233973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1234058_1234226_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143065.1|1234633_1236487_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1236636_1236852_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1236856_1237201_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1237557_1237938_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1237934_1238282_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1238331_1238976_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1238782_1239673_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1239669_1239996_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1240213_1240483_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1240643_1241066_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1241195_1242254_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1242332_1242983_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1243165_1243756_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|1243742_1243862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|1244257_1244506_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1245351_1245834_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1246705:1246719	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	1523458	1588720	5553457	integrase,portal,capsid,holin,bacteriocin,protease,terminase,tail	Escherichia_phage(50.0%)	83	1527814:1527837	1587689:1587712
WP_001005794.1|1523458_1523989_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1523988_1524456_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1524442_1525123_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1525132_1526269_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1526443_1527601_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1527814:1527837	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_001218303.1|1528032_1529202_+|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	99.7	2.2e-230
WP_000405131.1|1529185_1529368_-	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_000497812.1|1529428_1529680_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|1529667_1529901_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_054428277.1|1530044_1530398_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	99.1	3.0e-58
WP_001291843.1|1530433_1530646_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_072178294.1|1530605_1531133_-	hypothetical protein	NA	A0A0N7KZB6	Stx2-converting_phage	99.4	2.8e-100
WP_024230746.1|1531416_1532073_-	antirepressor	NA	A0A088CD42	Shigella_phage	70.8	4.1e-77
WP_000247838.1|1532399_1533122_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	70.1	6.3e-87
WP_000610373.1|1533287_1533638_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207904.1|1533634_1533991_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	99.2	1.2e-62
WP_122993658.1|1534067_1534331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289954.1|1534504_1535452_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1535448_1535670_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1535768_1536050_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1536060_1536252_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|1536224_1536407_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_054428303.1|1536403_1537084_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	100.0	1.2e-132
WP_032168747.1|1537080_1537866_-	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	100.0	9.7e-150
WP_000995439.1|1537871_1538168_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000361829.1|1538242_1538386_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	97.9	3.5e-18
WP_001198866.1|1538378_1538519_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_024230760.1|1538710_1539181_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.4e-87
WP_024212238.1|1539239_1539623_-	hypothetical protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000957426.1|1540242_1541289_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1541282_1541744_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_029793531.1|1541810_1542152_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	2.8e-61
WP_000250473.1|1542212_1542920_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1542998_1543226_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438542.1|1543364_1543661_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185465.1|1543693_1544632_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	99.7	4.8e-172
WP_001510925.1|1544628_1545330_+	replication P family protein	NA	Q6H9X6	Enterobacteria_phage	99.6	1.7e-129
WP_024230862.1|1545326_1545617_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	97.9	2.8e-46
WP_001000127.1|1545687_1545966_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|1546098_1546314_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_000814575.1|1546518_1546965_+	recombination protein NinB	NA	Q8HA08	Enterobacteria_phage	100.0	1.4e-81
WP_000153288.1|1546961_1547489_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_001254221.1|1547485_1547668_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_024230861.1|1548171_1549944_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
WP_001108084.1|1550507_1551074_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_151310836.1|1551048_1551651_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	97.5	4.4e-94
WP_024230729.1|1551647_1551842_+	protein ninH	NA	G9L694	Escherichia_phage	95.3	2.1e-29
WP_001204852.1|1551834_1552269_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_072163120.1|1552257_1552503_-	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	96.3	1.1e-32
WP_151547364.1|1553035_1554976_+	DUF1737 domain-containing protein	NA	A0A1U9AJ89	Stx1_converting_phage	98.3	0.0e+00
WP_000143458.1|1555111_1555291_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_088888712.1|1555331_1555577_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	93.8	2.5e-19
WP_000284510.1|1555654_1555870_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_062874321.1|1555874_1556408_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	97.2	2.8e-100
WP_045904330.1|1556682_1557252_+	antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
WP_021351520.1|1557251_1557398_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	93.5	2.7e-13
WP_012816804.1|1557625_1557811_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001109019.1|1558049_1558601_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086073.1|1558893_1559700_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1559680_1561387_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787034.1|1561386_1563531_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1563688_1564696_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1564719_1565934_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_029793700.1|1565989_1566379_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	99.2	2.2e-62
WP_001367376.1|1566428_1566890_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1566873_1567437_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207922.1|1567436_1568087_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_032276022.1|1568083_1570021_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001023420.1|1570022_1570292_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_001303606.1|1570432_1570621_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_024230846.1|1570915_1572541_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.8	0.0e+00
WP_016241167.1|1572537_1573806_+	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	98.1	2.1e-218
WP_000455634.1|1573820_1574099_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1574104_1574722_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_024230847.1|1574812_1575547_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	99.6	1.7e-135
WP_000078907.1|1575779_1575920_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1575976_1576378_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509491.1|1576471_1577128_+	hypothetical protein	NA	A0A088CD74	Shigella_phage	100.0	5.1e-104
WP_000455653.1|1577130_1577577_+	hypothetical protein	NA	G9L6M0	Escherichia_phage	100.0	6.2e-77
WP_024230848.1|1577587_1577839_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_024230849.1|1577849_1579115_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	99.5	2.6e-205
WP_029793689.1|1579184_1587566_+	hypothetical protein	NA	G3CFQ0	Escherichia_phage	98.1	0.0e+00
WP_000368131.1|1587787_1588720_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1587689:1587712	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
>prophage 3
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	1833126	1938575	5553457	integrase,portal,holin,tRNA,protease,terminase,tail	Enterobacteria_phage(47.5%)	121	1915766:1915780	1940638:1940652
WP_000569336.1|1833126_1834053_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1834057_1834789_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1834769_1834877_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1834936_1835638_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1835658_1836945_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1836978_1837233_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1837251_1837386_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1837389_1837632_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1837719_1838082_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207904.1|1838078_1838435_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	99.2	1.2e-62
WP_122993658.1|1838511_1838775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289954.1|1838948_1839896_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1839892_1840114_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1840212_1840494_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1840504_1840696_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|1840668_1840851_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_054428303.1|1840847_1841528_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	100.0	1.2e-132
WP_032168747.1|1841524_1842310_-	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	100.0	9.7e-150
WP_000995439.1|1842315_1842612_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_023148105.1|1842686_1842977_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1843480_1845088_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1845194_1845887_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1846250_1846790_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001417283.1|1846876_1847806_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_000788906.1|1847802_1848504_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1848500_1848785_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1849012_1849210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1849253_1849535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1849625_1849727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1849723_1850179_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1850178_1850349_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1850341_1850632_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1850628_1850991_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1850987_1851128_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1851213_1851648_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_015971135.1|1851636_1851882_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_001356551.1|1851896_1852049_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_151547365.1|1852858_1854805_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1854942_1855122_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1855162_1855408_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1855485_1855701_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001056806.1|1856507_1857077_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1857076_1857223_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1857450_1857636_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1858153_1858630_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1858626_1860750_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1860746_1860959_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1860958_1862461_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114424.1|1862405_1864430_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1864517_1864844_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1864836_1865118_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1865120_1865744_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1865756_1866155_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1866162_1866915_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1866928_1867351_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1867377_1867686_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_064032219.1|1867729_1870375_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|1870371_1870701_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|1870700_1871399_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_151547366.1|1871409_1872153_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.8	1.7e-148
WP_122998366.1|1872098_1872728_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.0	2.6e-105
WP_151310888.1|1872968_1876448_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
WP_001230508.1|1876515_1877115_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151547367.1|1877179_1878349_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	97.2	1.2e-84
WP_001023455.1|1878350_1878620_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_072142879.1|1878779_1879196_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1879277_1879919_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_029208404.1|1879949_1880084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261939.1|1880080_1880329_-	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1880843_1882529_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1882525_1883245_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1883291_1883762_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1883803_1884265_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1884389_1886393_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1886389_1887526_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1887518_1888250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1888268_1889798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1889808_1890897_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1892137_1892455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1892516_1896146_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1896155_1897697_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1897860_1899141_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001457618.1|1903103_1905137_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_001005448.1|1905268_1906378_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032355122.1|1906639_1906921_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1907212_1907755_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1907842_1908517_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001301545.1|1911033_1912068_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1912149_1912488_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_054428285.1|1912705_1913611_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1913731_1914004_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1914113_1914428_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1914437_1914785_-	hypothetical protein	NA	NA	NA	NA	NA
1915766:1915780	attL	TTTTTATGATCATAG	NA	NA	NA	NA
WP_000141034.1|1915835_1916075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1916408_1917197_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1917193_1917994_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1918058_1918877_+	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1918928_1919675_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1919648_1920614_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1920610_1921615_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1921611_1922889_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1923145_1924198_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1924496_1925351_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1925379_1926642_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1926651_1927104_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1927134_1927419_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1927422_1928778_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1928825_1929866_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1929965_1930745_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1930826_1931726_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1932131_1932449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303578.1|1932436_1932616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|1932713_1933727_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1933842_1934142_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1934263_1934539_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217673.1|1934716_1935217_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.7e-91
WP_000557698.1|1935280_1935505_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1935504_1935804_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1935806_1936031_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1936027_1936303_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1936292_1938575_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
1940638:1940652	attR	CTATGATCATAAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	1942671	1968893	5553457	head,portal,capsid,lysis,holin,plate,terminase,tail	Escherichia_phage(73.53%)	35	NA	NA
WP_000038161.1|1942671_1943706_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1943705_1945478_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1945651_1946506_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1946564_1947638_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1947641_1948385_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1948484_1948994_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1948993_1949197_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1949200_1949482_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1949481_1949979_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1949993_1950419_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1950406_1950832_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1950803_1950977_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1950939_1951407_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1951399_1951852_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_001093728.1|1951918_1952554_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1952550_1952898_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1952902_1953811_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1953803_1954415_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217052.1|1954411_1955731_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001057694.1|1955730_1956333_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|1956304_1956748_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001145592.1|1956768_1957179_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905094.1|1957209_1957803_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286704.1|1957862_1959053_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.6e-223
WP_001251408.1|1959065_1959584_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1959640_1959916_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1959948_1960068_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1960060_1962508_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1962522_1963002_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1963001_1964165_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1964246_1964465_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1964738_1966100_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001301848.1|1966247_1966580_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1966770_1967493_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1967489_1968893_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	2052117	2126516	5553457	integrase,head,terminase,transposase,lysis,capsid,holin,protease,tail	Stx2-converting_phage(56.47%)	102	2043068:2043082	2058495:2058509
2043068:2043082	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|2052117_2053296_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|2053276_2053468_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2053549_2053894_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2054081_2054432_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207904.1|2054428_2054785_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	99.2	1.2e-62
WP_122993658.1|2054861_2055125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151547369.1|2055298_2056246_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	99.7	4.0e-182
WP_000763383.1|2056242_2056464_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|2056562_2056844_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|2056854_2057046_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|2057018_2057201_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_054428303.1|2057197_2057878_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	100.0	1.2e-132
WP_000100845.1|2057874_2058660_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
2058495:2058509	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995487.1|2058665_2058962_-	host-nuclease inhibitor protein Gam	NA	A0A0P0ZE86	Stx2-converting_phage	100.0	3.3e-50
WP_000372937.1|2059036_2059180_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2059148_2059313_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2059385_2059754_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2059936_2060188_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2060246_2060519_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2060496_2060679_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2061247_2061769_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2062270_2062966_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2063041_2063257_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2063398_2063695_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000539354.1|2063875_2064697_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_151547370.1|2064693_2065935_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.5	4.5e-218
WP_085948178.1|2065940_2067153_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151547371.1|2067119_2067383_+	hypothetical protein	NA	G9L681	Escherichia_phage	100.0	2.4e-28
WP_001000130.1|2067453_2067732_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2067864_2068080_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2068090_2068327_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2068283_2068730_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2068726_2069254_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2069250_2069433_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208497.1|2069707_2070436_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	95.6	3.6e-114
WP_001302729.1|2070341_2070536_-	hypothetical protein	NA	A0A0N7KZV5	Escherichia_phage	95.3	1.2e-29
WP_000849633.1|2070691_2071372_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|2071446_2072169_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2072168_2072774_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2072770_2073442_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2073432_2073921_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2074570_2075530_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2075541_2075811_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2076107_2076431_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143109.1|2076674_2078612_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|2078749_2078929_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2078969_2079242_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2079318_2079534_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2079533_2080031_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2080027_2080465_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2080667_2081165_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2081161_2081419_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2081881_2082109_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2082150_2082516_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958380.1|2082808_2083372_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001457603.1|2083368_2085030_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_151547372.1|2085093_2087031_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.1	0.0e+00
WP_001063099.1|2087075_2087297_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|2089661_2089988_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2089997_2090348_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2090344_2090791_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2090787_2091132_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2091190_2091907_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2091912_2092287_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2092382_2092592_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_103656124.1|2092644_2095887_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2095879_2096221_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|2096220_2096919_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2096935_2097256_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2097363_2097537_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|2097607_2098531_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_001457600.1|2098585_2099323_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	99.6	9.1e-150
WP_122994717.1|2099268_2099901_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_151547373.1|2100139_2103622_+	DUF1983 domain-containing protein	NA	A0A0P0ZDT4	Stx2-converting_phage	99.5	0.0e+00
WP_001230459.1|2103688_2104288_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080209.1|2104352_2105666_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023452.1|2105667_2105937_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2106077_2106953_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_151547374.1|2107177_2107828_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	2.1e-121
WP_012779375.1|2107812_2108097_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	100.0	1.2e-49
WP_024175529.1|2108542_2108737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322268.1|2108676_2108808_+	hypothetical protein	NA	O64339	Escherichia_phage	59.5	1.5e-07
WP_001303036.1|2109151_2110318_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2110436_2110910_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2111108_2112167_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2112338_2112668_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2112768_2112951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2113439_2113553_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2113565_2113760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2114218_2114587_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2114660_2114882_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2114944_2115421_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2115435_2115915_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2115996_2116818_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2117038_2117449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2117464_2118148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2118283_2119354_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2119350_2120256_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_064717557.1|2120252_2121104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966626.1|2121382_2123530_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071525094.1|2123636_2123819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|2124977_2126516_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 6
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	2150901	2192185	5553457	integrase,head,portal,transposase,holin,terminase,tail	Escherichia_phage(33.33%)	54	2131172:2131186	2155026:2155040
2131172:2131186	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2150901_2151924_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2151923_2152127_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2152185_2154657_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2154752_2154941_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2154937_2155126_-	cell division inhibitor	NA	NA	NA	NA	NA
2155026:2155040	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2155606_2155759_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2156033_2156678_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2156775_2157003_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2156999_2157425_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2157493_2158531_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|2158562_2158985_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2159019_2159718_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2159739_2159964_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2159960_2160317_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2160349_2160502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2160498_2160810_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2160936_2161500_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278461.1|2161609_2161714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2161900_2162113_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2162154_2162340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2162280_2162559_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2162560_2163610_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2163622_2163982_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2163978_2164668_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|2164698_2164821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023257.1|2166207_2168058_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|2168139_2169353_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2169673_2169880_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2169884_2170229_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2170279_2170813_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2170968_2171151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2171163_2171295_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2171522_2171708_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2172234_2172549_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2172630_2172855_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2173249_2173759_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_072147822.1|2173760_2174078_+|terminase	terminase	terminase	K7PGW7	Enterobacteria_phage	65.4	1.4e-22
WP_000259002.1|2175630_2175837_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2175833_2177426_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2177415_2178921_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2178957_2179305_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2179362_2179629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2179610_2180351_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2180364_2180796_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2180822_2181236_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_151547375.1|2181216_2183796_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.7	0.0e+00
WP_000847298.1|2183792_2184122_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|2184121_2184820_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_151547366.1|2184830_2185574_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.8	1.7e-148
WP_122998366.1|2185519_2186149_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.0	2.6e-105
WP_151310888.1|2186389_2189869_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
WP_001230508.1|2189936_2190536_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_070080209.1|2190600_2191914_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023455.1|2191915_2192185_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
>prophage 7
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	2249703	2271002	5553457	integrase,tail,transposase	Enterobacteria_phage(76.0%)	29	2264138:2264151	2274144:2274157
WP_050543672.1|2249703_2250783_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	3.1e-37
WP_085948178.1|2250785_2251999_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000132765.1|2252103_2252427_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2252584_2253769_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2253768_2254281_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2254335_2254701_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|2254736_2254865_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|2257667_2258156_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2258312_2258885_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|2258928_2259345_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|2260550_2260865_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2260869_2261829_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2261905_2264728_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2264138:2264151	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2264734_2265100_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|2265172_2265403_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|2265725_2266025_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2266021_2266288_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2266284_2266488_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2266511_2266928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2267020_2267134_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2267130_2267373_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2267384_2267663_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2267673_2268024_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2268045_2268249_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2268320_2268458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2268547_2268952_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2268967_2269618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2269647_2269995_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2270000_2271002_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2274144:2274157	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	2591572	2736790	5553457	head,portal,transposase,capsid,holin,protease,terminase,tail	Escherichia_phage(29.57%)	170	NA	NA
WP_001260835.1|2591572_2592394_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2592493_2592577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2592669_2593005_-	acid shock protein	NA	NA	NA	NA	NA
WP_024230673.1|2593401_2594655_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2594761_2595655_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2595789_2597010_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2597134_2597830_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2597782_2599075_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2599232_2599847_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2599889_2600744_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2600745_2601363_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2601373_2603797_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_024230672.1|2603857_2606272_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.7e-209
WP_000778147.1|2606470_2606776_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2606883_2607594_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2607596_2608157_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2608191_2608533_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2608667_2608994_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2609166_2609292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2609982_2610219_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|2610306_2612778_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2612870_2613062_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2613058_2613247_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2613647_2613812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2613815_2614034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2614105_2614405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2614757_2615036_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2615037_2615229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2615249_2615621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2615718_2616021_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2616017_2616443_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2616465_2617428_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2617434_2618175_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2618985_2619381_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2619437_2620022_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2620137_2620242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2620430_2620643_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2620810_2621089_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_151547378.1|2621090_2622140_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	7.7e-110
WP_001217455.1|2622152_2622512_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2622508_2623198_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|2623228_2623351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|2623835_2624264_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2624742_2626593_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411805.1|2627041_2627248_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2627252_2627597_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2627647_2628181_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2628451_2629021_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2629020_2629167_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2629394_2629580_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|2630004_2630232_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2630273_2630639_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_151547379.1|2630607_2630817_+	hypothetical protein	NA	H6WZK7	Escherichia_phage	85.5	1.3e-24
WP_000958380.1|2630932_2631496_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001457603.1|2631492_2633154_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_151547372.1|2633217_2635155_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.1	0.0e+00
WP_001063099.1|2635199_2635421_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|2637785_2638112_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2638121_2638472_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2638468_2638915_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2638911_2639256_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2639314_2640031_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2640036_2640411_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2640506_2640716_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_103656124.1|2640768_2644011_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2644003_2644345_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2644344_2644782_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_151547380.1|2644969_2648230_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001304111.1|2648232_2648448_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2648515_2649115_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151547381.1|2649179_2650403_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	92.6	8.7e-81
WP_001023362.1|2650404_2650674_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2650787_2651363_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_010917823.1|2651740_2652088_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001121225.1|2652072_2652723_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2653305_2654844_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2654893_2655241_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2655237_2655618_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2656580_2656895_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2657533_2658778_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2658870_2659059_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2659055_2659244_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2659808_2660018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2660018_2660657_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2660668_2660821_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2661113_2661452_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2661843_2662086_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_151547382.1|2662069_2662495_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2662563_2663607_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|2663638_2664061_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|2664094_2664811_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2664843_2665125_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2665121_2665349_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2665341_2665653_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2665780_2665999_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2666000_2666558_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2666791_2667004_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2667123_2667468_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_151547383.1|2667589_2667862_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2667863_2668913_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2668925_2669231_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2669293_2669848_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2670072_2670270_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2670405_2671119_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2671569_2672001_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2672478_2674329_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|2674776_2674983_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2674987_2675332_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2675382_2675916_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2676186_2676756_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2676755_2676902_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2677124_2677310_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2677835_2678150_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2678231_2678456_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|2678471_2678729_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867498.1|2678842_2679388_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_151547384.1|2679362_2681288_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000198153.1|2681284_2681491_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2681487_2683089_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2683069_2684389_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2684398_2684731_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2684786_2685812_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2685853_2686252_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2686263_2686617_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000683105.1|2687202_2687598_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2687605_2688346_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2688361_2688784_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2688765_2689200_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2689192_2691742_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2691738_2692068_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2692067_2692766_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_127824130.1|2692771_2693515_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_000090920.1|2693451_2694084_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2694144_2697543_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2697609_2698209_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2698273_2701189_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2701188_2701770_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_085948178.1|2702493_2703706_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001079482.1|2704111_2704618_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2704654_2705155_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2705233_2705416_-	general stress protein	NA	NA	NA	NA	NA
WP_000937476.1|2706637_2706886_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171540.1|2706961_2707342_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2707338_2707686_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2707735_2709274_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2709576_2711061_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2711247_2712201_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|2712699_2713284_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001185665.1|2714522_2714789_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101055.1|2714792_2715605_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000072536.1|2715628_2716324_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_001056834.1|2716843_2717212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2717314_2717716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295992.1|2717956_2718250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284277.1|2718321_2718981_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000807626.1|2719057_2719519_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001304191.1|2719725_2720637_-	hemolysin HlyE	NA	NA	NA	NA	NA
WP_085948178.1|2720797_2722010_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000897378.1|2722322_2722742_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457644.1|2722741_2724010_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000943459.1|2724055_2724586_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000406391.1|2724731_2726273_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000234823.1|2726494_2727214_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000190855.1|2727265_2728798_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_001266908.1|2729160_2730459_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000197859.1|2730468_2731539_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_000340206.1|2731931_2733668_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000051572.1|2733763_2734678_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_001295616.1|2734777_2735389_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_085952403.1|2735576_2736790_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
>prophage 9
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	2810772	2930933	5553457	integrase,head,transposase,capsid,holin,protease,terminase,tail	Escherichia_phage(28.43%)	137	2810609:2810636	2915405:2915432
2810609:2810636	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|2810772_2811903_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2811880_2812129_-	excisionase	NA	NA	NA	NA	NA
WP_151547385.1|2812193_2814665_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	3.2e-58
WP_001090200.1|2814757_2814949_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2814945_2815134_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2815531_2815699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2815692_2815926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2815903_2816311_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2816333_2816552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2816624_2816924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2817188_2817596_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2817672_2817900_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2817883_2818435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2818406_2819447_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|2819478_2819901_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|2820087_2820669_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2820665_2820830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2821528_2822287_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2822565_2822778_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2822998_2823256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2823325_2823604_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2823605_2824652_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2824664_2825024_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2825032_2825563_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2825804_2826002_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2826152_2827211_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_064761991.1|2827702_2827888_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_072617007.1|2828007_2829861_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000284517.1|2830010_2830226_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|2830230_2830575_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2830625_2831159_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2831429_2831999_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2831998_2832145_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2832372_2832558_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2832982_2833210_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2833251_2833617_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_151547386.1|2833906_2834470_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	1.4e-89
WP_001457603.1|2834466_2836128_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_001502569.1|2836191_2838129_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.1	0.0e+00
WP_001063023.1|2838173_2838395_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|2840921_2841248_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2841257_2841608_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2841604_2842051_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2842047_2842392_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2842450_2843167_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2843172_2843547_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2843642_2843852_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_103656124.1|2843904_2847147_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2847139_2847481_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179510.1|2847480_2848179_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000194720.1|2848189_2848933_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2848878_2849511_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2849853_2851029_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|2850980_2853326_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|2853393_2853993_+	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|2854144_2855458_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|2855459_2855729_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2856755_2858081_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_024262009.1|2858348_2858537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054428288.1|2859731_2860664_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.1	1.5e-133
WP_000938103.1|2860729_2861299_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2862264_2863803_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2863852_2864200_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2864196_2864577_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2864916_2865195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2865622_2865769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2865905_2866553_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2866736_2867327_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001302903.1|2869055_2869484_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_000147167.1|2870077_2870296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063650.1|2870351_2871638_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_001193437.1|2871671_2871926_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001692487.1|2872117_2872489_-	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.1	3.0e-61
WP_000734577.1|2872529_2873357_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	98.2	1.1e-130
WP_001028879.1|2873353_2873542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001692486.1|2873602_2873995_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	56.4	2.6e-34
WP_001692485.1|2873991_2874210_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	76.4	2.8e-22
WP_000002325.1|2874181_2874397_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	60.6	5.5e-15
WP_000148632.1|2874396_2874756_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	76.4	2.3e-42
WP_000632555.1|2874940_2875132_-	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	96.8	1.7e-28
WP_000781571.1|2875128_2875320_-	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	93.7	3.3e-27
WP_000930864.1|2875321_2875765_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	45.6	1.6e-08
WP_000402986.1|2875877_2876333_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001405833.1|2876398_2876641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183589.1|2876802_2877096_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	93.8	4.1e-45
WP_001287835.1|2877344_2877713_+	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	98.4	4.6e-62
WP_000424038.1|2877824_2879483_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	95.8	0.0e+00
WP_000844629.1|2879484_2880453_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	99.4	5.5e-187
WP_001258397.1|2880452_2881310_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	92.3	1.6e-150
WP_000762843.1|2881309_2882125_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	84.1	5.9e-118
WP_000576620.1|2882261_2883206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151547387.1|2884062_2886009_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000143458.1|2886144_2886324_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290232.1|2886364_2886637_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	97.8	7.2e-20
WP_000284510.1|2886713_2886929_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087733.1|2886933_2887467_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001443546.1|2887544_2887736_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
WP_001208682.1|2888113_2888320_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2888384_2888609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151547388.1|2888569_2888770_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	8.5e-10
WP_000348565.1|2889071_2889548_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|2889544_2891668_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|2891664_2891877_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001114424.1|2893222_2895247_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2895334_2895661_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|2895653_2895935_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|2895937_2896561_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682716.1|2896573_2896972_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2896979_2897732_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2897745_2898168_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|2898194_2898503_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_151547389.1|2898546_2901192_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.1	0.0e+00
WP_000847304.1|2901188_2901518_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_080025938.1|2901517_2902216_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_151310936.1|2902226_2902970_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	4.0e-145
WP_140439088.1|2902915_2903548_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	7.9e-102
WP_151547390.1|2903795_2907188_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	84.1	0.0e+00
WP_001230428.1|2907255_2907855_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_151547391.1|2907919_2909233_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	1.3e-77
WP_151547392.1|2909234_2909504_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	5.4e-44
WP_024230666.1|2910364_2913751_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	99.5	0.0e+00
WP_001079499.1|2915582_2916089_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2915405:2915432	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056499.1|2916134_2916635_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2916720_2916900_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2917280_2918087_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2918086_2919280_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|2919291_2920650_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|2920653_2922249_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2922248_2923811_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2923902_2923947_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2924084_2924966_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2924962_2925583_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2925610_2927194_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2927406_2928279_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2928318_2928909_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2928905_2929664_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2929883_2930933_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 10
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	3202541	3253353	5553457	integrase,head,portal,capsid,lysis,holin,tRNA,terminase,tail	Enterobacteria_phage(50.0%)	65	3222729:3222744	3252400:3252415
WP_000214712.1|3202541_3202745_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|3202780_3204241_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|3204329_3205613_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_096855372.1|3205672_3205987_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001480712.1|3205983_3206118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143804.1|3206148_3206790_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001131658.1|3207574_3208150_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|3208263_3208533_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3208534_3209848_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230508.1|3209912_3210512_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151310888.1|3210579_3214059_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
WP_122998366.1|3214299_3214929_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.0	2.6e-105
WP_151547366.1|3214874_3215618_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.8	1.7e-148
WP_072617001.1|3215628_3216327_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_000847298.1|3216326_3216656_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_151547393.1|3216652_3219265_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000533440.1|3219245_3219659_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|3219685_3220108_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|3220121_3220874_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|3220881_3221277_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|3221273_3221807_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|3221821_3222175_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|3222186_3222585_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3222626_3223652_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
3222729:3222744	attL	CCAGTTTTTCGGGTAA	NA	NA	NA	NA
WP_001457523.1|3223707_3224040_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_000123254.1|3224049_3225369_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3225349_3226951_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3226947_3227154_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3227150_3229076_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3229050_3229596_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3229984_3230179_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3230343_3230550_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3230835_3231246_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3231537_3231831_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3231921_3232104_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3232320_3232797_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3232783_3233089_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3233410_3234100_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3234096_3234237_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3234233_3234596_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3234592_3234883_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3234875_3235046_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3235045_3235501_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|3235691_3235883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|3236002_3237529_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3237586_3237709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151547394.1|3237773_3238106_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3238173_3238476_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3238472_3239174_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3239170_3239995_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|3240098_3240335_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3240324_3241467_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3241580_3242831_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3243002_3243656_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3243665_3244127_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3244180_3245287_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3245322_3245964_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3245967_3247338_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3247506_3248178_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3248177_3249638_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3250238_3250520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3250775_3251318_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3251523_3251937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3251949_3252285_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3252297_3253353_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
3252400:3252415	attR	CCAGTTTTTCGGGTAA	NA	NA	NA	NA
>prophage 11
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	3259445	3318108	5553457	integrase,head,portal,transposase,capsid,holin,terminase,tail	Stx2-converting_phage(25.42%)	75	3303675:3303695	3324765:3324785
WP_000085256.1|3259445_3260675_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3260923_3262045_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|3262093_3263320_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3263569_3264706_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3264689_3265553_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|3265583_3265796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|3265916_3267278_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3267338_3267614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3267693_3267819_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301984.1|3269922_3273324_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3273914_3276263_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3276282_3276372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3276384_3276621_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967274.1|3276566_3277304_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	99.6	9.1e-150
WP_000835336.1|3277357_3278236_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3278538_3278649_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3278758_3279013_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3279029_3279728_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3279727_3280069_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3280061_3283304_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3283351_3283561_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3283656_3284031_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3284045_3284762_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3284827_3285172_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3285168_3285615_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3285611_3285962_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_054428291.1|3285971_3286298_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	1.6e-53
WP_000267295.1|3286300_3288880_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3288825_3289047_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3289091_3291029_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_151310751.1|3291092_3292469_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	7.1e-257
WP_085952403.1|3292452_3293666_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000958387.1|3294064_3294628_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_071526897.1|3294819_3294951_-	DNase	NA	H6WZK7	Escherichia_phage	100.0	2.4e-05
WP_000279796.1|3294919_3295285_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3295326_3295512_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3295641_3295782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3296138_3296363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3296427_3296634_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3296861_3297008_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3297007_3297577_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3297847_3298381_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3298431_3298776_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3298780_3298996_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3299071_3299341_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3299378_3299561_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3299708_3301646_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3301960_3302128_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3302724_3303546_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3303542_3303917_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3303675:3303695	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3303929_3304979_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3304980_3305259_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3305426_3305639_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3305827_3305932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3306047_3306635_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3306637_3306829_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3306830_3307268_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3307254_3307572_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3307525_3307843_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3307832_3308135_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|3308131_3308449_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|3308445_3309162_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|3309195_3309618_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001457513.1|3309649_3310687_-	primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	79.5	1.5e-89
WP_000693915.1|3310755_3311181_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3311164_3311488_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3311612_3312089_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3312404_3312557_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_054428263.1|3312671_3313187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3313319_3313709_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3313770_3314040_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3314008_3315127_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3315293_3316088_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3316084_3317131_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3317286_3318108_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3324765:3324785	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	3579899	3635370	5553457	integrase,head,portal,transposase,holin,protease,tail	Escherichia_phage(28.26%)	71	3581834:3581849	3637135:3637150
WP_000003653.1|3579899_3580487_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3580483_3581191_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3581209_3583003_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3581834:3581849	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3582999_3584118_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|3584735_3584918_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|3586250_3586520_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3586521_3587835_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230466.1|3587899_3588499_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_151547395.1|3588566_3592040_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3592173_3592701_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_001303882.1|3592731_3592938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151310946.1|3592891_3593524_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.7e-104
WP_000194760.1|3593469_3594213_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3594223_3594922_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3594921_3595251_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_134790849.1|3595247_3596012_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_001455418.1|3595963_3597826_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_000533402.1|3597806_3598220_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3598246_3598678_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3598691_3599432_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3599413_3599680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3599737_3600085_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3600121_3601627_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3601616_3603209_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3603205_3603412_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|3605282_3605525_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3605574_3607113_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3607162_3607510_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000235421.1|3607962_3608238_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3608988_3609195_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3609157_3609502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3609450_3609723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3609655_3609850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3609882_3610416_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3610636_3610750_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3610971_3611157_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3611684_3611999_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|3612203_3613417_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000874392.1|3613592_3615443_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|3615560_3615764_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3616210_3616924_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3617018_3617258_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3617544_3618363_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3618514_3618886_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3618875_3619247_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3619259_3620309_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3620310_3620589_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3620756_3620969_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3621013_3621151_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3621516_3622290_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3622641_3623055_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3623070_3623841_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3623862_3624609_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3624615_3625707_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3625785_3626241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3626447_3626873_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3626856_3627129_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3627237_3627639_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3627666_3627858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3627857_3628145_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071526892.1|3628146_3628365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3628422_3628578_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3628719_3629109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3629295_3629481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3629482_3629788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3630054_3630243_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3630239_3630431_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_103656106.1|3630524_3632996_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3633063_3633306_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3633283_3634303_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3634710_3635370_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3637135:3637150	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	3866303	3904399	5553457	integrase,portal,lysis,holin,protease,terminase,tail	Enterobacteria_phage(51.16%)	53	3865888:3865902	3904473:3904487
3865888:3865902	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3866303_3867002_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_096976694.1|3867054_3867258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951026.1|3867232_3868114_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3868282_3868444_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3868940_3869960_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3869993_3870974_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3871150_3871420_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3871421_3872738_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3872797_3873397_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3873467_3876881_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3876941_3877550_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3877486_3878230_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3878235_3878934_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3878943_3879273_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3879272_3882338_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3882309_3882639_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3882647_3883034_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3883094_3883838_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3883848_3884250_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3884246_3884825_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3884836_3885112_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3885104_3885428_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3885514_3887542_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3887486_3887822_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3887943_3889068_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3888995_3889208_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3889204_3891307_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3891306_3891798_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|3891787_3892066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3892472_3892625_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3892612_3893080_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3893076_3893574_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3893573_3893789_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3893931_3894330_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3894410_3894569_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3894654_3895398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3895581_3896271_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3896285_3896408_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3896745_3897705_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3897916_3898582_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3898578_3899199_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3899191_3899362_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3899358_3899541_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3900238_3900919_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3900915_3901098_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3901070_3901262_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3901272_3901554_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3901652_3901874_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3902084_3902687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3902811_3902997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3902929_3903097_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3903136_3903355_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|3903517_3904399_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
3904473:3904487	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	4447545	4502319	5553457	tail,transposase	Escherichia_phage(36.36%)	55	NA	NA
WP_000998048.1|4447545_4449084_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4449133_4449481_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000803998.1|4450121_4450385_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4450384_4450525_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4450594_4450786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303810.1|4450847_4451138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4451610_4452153_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4452227_4452815_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4452872_4453541_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4453566_4456092_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265657.1|4456081_4457725_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4457693_4458404_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4458716_4459046_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4459293_4459908_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000070685.1|4460325_4461015_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4461011_4461968_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667044.1|4461964_4464163_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4464172_4465129_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4465307_4466435_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4466576_4467635_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4467880_4468783_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4469485_4469764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|4470361_4471575_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000687183.1|4472065_4472965_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4473640_4474597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4474729_4477063_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4477076_4477400_-	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_001071227.1|4477399_4477621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4477617_4478175_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4478171_4478432_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4479365_4480118_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4480114_4480666_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4480671_4480944_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_100068595.1|4481091_4481295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|4481353_4481920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4482541_4483174_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4483166_4483625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4483624_4484242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4484214_4484631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|4485043_4486256_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151547397.1|4488091_4488835_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4489658_4490432_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4490489_4491044_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4491073_4491568_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4491567_4492161_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4492132_4492576_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_151547398.1|4492596_4493301_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	77.9	6.8e-54
WP_000788819.1|4493300_4493612_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251067.1|4494563_4494857_-	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000437875.1|4494975_4495176_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4495276_4495990_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_085948178.1|4497095_4498308_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303805.1|4498635_4498881_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4499950_4501204_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4501215_4502319_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
>prophage 15
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	4522448	4547724	5553457	plate,transposase	uncultured_Caudovirales_phage(75.0%)	20	NA	NA
WP_000027427.1|4522448_4523621_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4523701_4523887_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4523801_4524065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4524266_4526027_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4526029_4527166_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|4527273_4527564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356573.1|4527911_4528469_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_085949308.1|4528537_4530070_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.2e-24
WP_000509109.1|4531084_4535317_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103335.1|4535392_4537534_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4537743_4538262_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4538958_4539459_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4539493_4539718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4539768_4541160_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4541250_4541664_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4541667_4543518_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4543481_4544564_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4544588_4545869_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4545865_4546390_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4546392_4547724_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 16
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	4985984	5045012	5553457	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4985984_4987337_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4987430_4987982_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4988137_4989511_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4989686_4990685_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4990717_4991713_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4991699_4992722_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4992735_4994238_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4994377_4995334_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4995643_4996174_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4996253_4996604_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4996597_4996849_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|4997060_4997402_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4997404_5001184_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|5001180_5002914_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|5003119_5003758_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|5004080_5005424_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|5005519_5005726_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|5006050_5006605_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|5006667_5007606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5007817_5008558_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|5008747_5010691_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|5010808_5011189_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5011277_5012138_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5012245_5013211_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5013318_5013981_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5014025_5015438_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5015746_5016367_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5016584_5017223_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5017357_5018566_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5018573_5019005_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5019627_5020422_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5020492_5020942_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5020983_5021211_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5021215_5021530_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5021536_5021932_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5022258_5022534_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5022662_5023349_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|5023348_5024203_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5024212_5024863_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5024876_5025341_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5025350_5025656_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5025671_5027069_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5028595_5029351_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5029347_5030097_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5030278_5030608_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5030756_5031032_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|5031148_5032774_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5032857_5034021_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5034023_5034662_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5034671_5035070_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5035087_5035747_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5035797_5036496_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5036514_5036916_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5037042_5037774_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5037954_5040396_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5040434_5040860_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5041064_5042363_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5042466_5042664_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5042745_5043750_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5043752_5045012_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 17
NZ_CP032803	Escherichia coli strain ERL05-1306 chromosome, complete genome	5553457	5181892	5196557	5553457	tRNA,integrase,tail	Enterobacteria_phage(37.5%)	18	5177733:5177748	5195262:5195277
5177733:5177748	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5181892_5183308_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000891404.1|5184539_5184782_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5184915_5185953_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5186041_5187139_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5187200_5187449_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5187609_5188251_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5188332_5188962_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5189034_5189607_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5189718_5189988_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5189989_5191303_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5191367_5191967_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5193288_5193825_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5193815_5194166_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5194162_5194447_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|5194456_5194636_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|5194782_5194980_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5195324_5195606_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5195262:5195277	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|5196023_5196557_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP032804	Escherichia coli strain ERL05-1306 plasmid pERL05-1306, complete sequence	91253	7745	58789	91253	integrase,transposase,protease	Macacine_betaherpesvirus(45.45%)	47	9001:9015	51310:51324
WP_085948178.1|7745_8959_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
9001:9015	attL	CCGGGGCGGTTCAGT	NA	NA	NA	NA
WP_071525077.1|13948_14128_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14729_15551_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15550_16657_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16746_18468_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18541_19540_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001302198.1|20144_20360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358886.1|20422_23119_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|23205_24081_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|24138_26049_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|26048_27554_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|27555_28779_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|28809_29244_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|29240_29795_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|29809_30157_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|30153_30753_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|30749_31727_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|31765_32938_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|32924_33437_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|33494_34328_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|34419_34821_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|36711_37227_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|37228_40225_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|40274_42395_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|42398_43838_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|43904_44099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|44128_44413_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|44413_44611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|44581_44812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|44932_45673_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|45957_46935_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|47247_47436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|47342_47543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|47539_48160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|48156_48840_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|49298_49517_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|49518_49824_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|49824_50631_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|51307_51388_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
51310:51324	attR	ACTGAACCGCCCCGG	NA	NA	NA	NA
WP_085948178.1|51353_52567_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000852148.1|52642_53398_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|53985_55152_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|55151_56123_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001349526.1|56507_56780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|56817_57720_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|57723_58029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|58105_58789_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
