The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	1223623	1245792	5395711	tail,transposase,holin,integrase	Stx2-converting_phage(40.0%)	28	1215270:1215284	1246663:1246677
1215270:1215284	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1223623_1224829_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1224830_1226144_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1226140_1227772_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1227772_1228171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1228268_1228682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150579.1|1229077_1230310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1230385_1230688_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1230723_1231479_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1231814_1232381_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1232355_1232967_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1232963_1233629_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1233625_1234249_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1234501_1235245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1235330_1235498_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143064.1|1235905_1237759_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000284517.1|1237908_1238124_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1238128_1238473_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1238829_1239210_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1239206_1239554_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001303014.1|1239603_1240170_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_001023396.1|1240171_1240441_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1240601_1241024_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1241153_1242212_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1242290_1242941_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1243123_1243714_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|1243700_1243820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|1244215_1244464_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1245309_1245792_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1246663:1246677	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	1522546	1527933	5395711	integrase	Enterobacteria_phage(50.0%)	6	1513661:1513677	1530129:1530145
1513661:1513677	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001005794.1|1522546_1523077_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1523076_1523544_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523530_1524211_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1524220_1525357_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525531_1526689_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1527000_1527933_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1530129:1530145	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	1772215	1844229	5395711	holin,portal,tail,protease,tRNA,terminase,integrase	Enterobacteria_phage(52.94%)	81	1774690:1774710	1819648:1819668
WP_000569336.1|1772215_1773142_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1773146_1773878_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1773858_1773966_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1774025_1774727_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1774690:1774710	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1774747_1776034_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1776067_1776322_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1776340_1776475_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1776478_1776721_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1776808_1777171_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_001289954.1|1778032_1778980_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1778976_1779198_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1779296_1779578_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1779588_1779780_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1779752_1779935_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1779934_1780612_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1780608_1781394_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1781399_1781696_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1781771_1782062_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1782565_1784173_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1784279_1784972_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1785335_1785875_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001417283.1|1785961_1786891_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_000788906.1|1786887_1787589_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1787585_1787870_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1788097_1788295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1788338_1788620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1788710_1788812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1788808_1789264_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1789263_1789434_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1789426_1789717_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1789713_1790076_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1790072_1790213_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1790298_1790733_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_015971135.1|1790721_1790967_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_001356551.1|1790981_1791134_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1791937_1793884_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1794021_1794201_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1794241_1794487_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1794564_1794780_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1794784_1795318_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1795588_1796158_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1796157_1796304_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1796531_1796717_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1797234_1797711_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1797707_1799831_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1799827_1800040_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1800039_1801542_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114424.1|1801486_1803511_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1803598_1803925_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1803917_1804199_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1804201_1804825_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1804837_1805236_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1805243_1805996_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1806009_1806432_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1806458_1806767_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_115333668.1|1806810_1809456_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|1809452_1809782_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032256908.1|1809781_1810480_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_072619021.1|1810490_1811234_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	2.5e-147
WP_134791867.1|1811179_1811812_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_000514788.1|1812060_1815540_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|1815607_1816207_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_072619025.1|1816271_1817441_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|1817442_1817712_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1817872_1818289_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1818370_1819012_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_029208404.1|1819042_1819177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261939.1|1819173_1819422_-	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1819936_1821622_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1819648:1819668	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1821618_1822338_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1822384_1822855_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1822896_1823358_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1823482_1825486_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1825482_1826619_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1826611_1827343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1827361_1828891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1828901_1829990_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1831230_1831548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1831609_1835239_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1836952_1838233_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1842195_1844229_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	1959186	2072100	5395711	holin,portal,tail,protease,transposase,terminase,integrase,head	Escherichia_phage(31.46%)	130	1955804:1955818	2032307:2032321
1955804:1955818	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|1959186_1960365_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1960345_1960537_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1960614_1960959_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1961146_1961497_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|1962358_1963306_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1963302_1963524_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1963622_1963904_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|1963914_1964106_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1964078_1964261_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_054191702.1|1964257_1964935_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.3e-130
WP_001302855.1|1964931_1965717_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|1965722_1966019_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1966093_1966237_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1966205_1966370_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1966442_1966811_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1966993_1967245_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1967303_1967576_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1967553_1967736_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1968304_1968826_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1969327_1970023_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1970096_1970312_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1970453_1970750_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_085948178.1|1970902_1972115_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072190087.1|1972081_1972177_+|transposase	transposase	transposase	A0A0N7BTS3	Escherichia_phage	100.0	2.4e-07
WP_000807954.1|1974064_1974406_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|1974405_1975104_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_001302649.1|1975120_1975441_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1975548_1975722_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|1975792_1976716_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|1976769_1977507_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|1977452_1978085_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_115333686.1|1978344_1981824_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	99.7	0.0e+00
WP_001230314.1|1981890_1982490_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|1982554_1983868_+	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|1983869_1984139_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|1984279_1985155_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|1985379_1986030_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_012779375.1|1986014_1986299_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	100.0	1.2e-49
WP_001322269.1|1986744_1986939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322268.1|1986878_1987010_+	hypothetical protein	NA	O64339	Escherichia_phage	59.5	1.5e-07
WP_001303036.1|1987353_1988520_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|1988638_1989112_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|1989310_1990369_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1990540_1990870_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|1990970_1991153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|1991641_1991755_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|1991767_1991962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|1992420_1992789_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|1992862_1993084_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_054427709.1|1993146_1993623_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|1993637_1994117_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|1994198_1995020_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|1995240_1995651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|1995666_1996350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|1996485_1997556_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|1997552_1998458_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_032174098.1|1998454_1999354_-	vimentin yjdA	NA	NA	NA	NA	NA
WP_085952406.1|1999319_2000533_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
WP_000966626.1|2000904_2003052_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071525094.1|2003158_2003341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|2004499_2006038_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2006087_2006435_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2006431_2006812_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2007173_2007719_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2007715_2008459_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2008470_2009550_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2009611_2010547_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2011003_2011921_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2012022_2012973_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2013090_2014734_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2015359_2016076_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2016418_2017873_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2017974_2019291_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2019604_2020657_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_139120752.1|2020918_2021527_-	adhesin	NA	NA	NA	NA	NA
WP_085952403.1|2021535_2022749_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001302302.1|2029904_2030702_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2030937_2031960_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2031959_2032163_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2032221_2034693_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2032307:2032321	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2034788_2034977_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2034973_2035162_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2035641_2035794_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2036068_2036713_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2036810_2037038_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2037034_2037460_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2037528_2038566_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|2038597_2039020_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2039054_2039753_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2039774_2039999_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2039995_2040352_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2040384_2040537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2040533_2040845_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2040971_2041535_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2041644_2041749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2041935_2042148_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2042189_2042375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2042315_2042594_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2042595_2043645_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2043657_2044017_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2044013_2044703_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|2044733_2044856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115333687.1|2046242_2048093_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_085948178.1|2048174_2049388_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2049707_2049914_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2049918_2050263_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2050313_2050847_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2051002_2051185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2051197_2051329_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2051556_2051742_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2052268_2052583_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2052664_2052889_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2053283_2053793_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2055678_2055885_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831795.1|2055881_2057474_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	8.7e-182
WP_001254002.1|2057463_2058969_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2059005_2059353_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2059410_2059677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2059658_2060399_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2060412_2060844_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2060870_2061284_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_072619027.1|2061264_2063844_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000847298.1|2063840_2064170_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|2064169_2064868_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_072619021.1|2064878_2065622_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	2.5e-147
WP_134791867.1|2065567_2066200_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_000514788.1|2066448_2069928_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|2069995_2070595_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_072619025.1|2070659_2071829_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023407.1|2071830_2072100_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 5
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	2449035	2564499	5395711	capsid,holin,portal,tail,protease,terminase,transposase,head	Escherichia_phage(31.9%)	143	NA	NA
WP_001260835.1|2449035_2449857_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2449956_2450040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2450132_2450468_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2450864_2452118_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2452224_2453118_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2453252_2454473_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2454597_2455293_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2455245_2456538_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2456695_2457310_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2457352_2458207_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2458208_2458826_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2458836_2461260_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2461320_2463747_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2463945_2464251_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2464358_2465069_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2465071_2465632_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2465666_2466008_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2466142_2466469_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2466641_2466767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2467457_2467694_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000102182.1|2467781_2470226_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	1.4e-175
WP_000092782.1|2470318_2470507_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2470503_2470692_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2471179_2471332_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2471501_2471891_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2471993_2472269_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2472252_2472678_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2472700_2473654_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2473660_2474401_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_025840156.1|2474430_2475201_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	1.4e-81
WP_001118161.1|2475216_2475612_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2475668_2476025_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2476073_2476286_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2476321_2476693_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2476689_2477052_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2477167_2477272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2477460_2477673_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001304183.1|2478184_2478463_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_001302870.1|2478464_2479514_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904137.1|2479526_2479901_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|2479897_2480719_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|2480945_2481143_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2481293_2482352_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_024748518.1|2482843_2484694_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|2485141_2485348_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075112.1|2485347_2485845_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2486061_2486247_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2486773_2487088_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2487169_2487394_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2487435_2487801_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_001303051.1|2488089_2488653_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_115333667.1|2488649_2490311_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.6	0.0e+00
WP_000172999.1|2490374_2492312_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2492356_2492578_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_115333682.1|2492523_2495103_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.1	0.0e+00
WP_000126019.1|2495105_2495432_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2495441_2495792_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2495788_2496235_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2496231_2496576_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2496634_2497351_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2497356_2497731_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2497826_2498036_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2498088_2501331_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2501323_2501665_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2501664_2502102_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_085949318.1|2502223_2503437_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_105626756.1|2503602_2506863_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001304111.1|2506865_2507081_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2507148_2507748_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2507812_2509036_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2509037_2509307_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2509420_2509996_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_010917823.1|2510373_2510721_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001121225.1|2510705_2511356_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998084.1|2511938_2513477_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	2.2e-299
WP_000612591.1|2513526_2513874_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2513870_2514251_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2515213_2515528_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2516166_2517411_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2517503_2517692_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2517688_2517877_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2518441_2518651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2518651_2519290_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2519301_2519454_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2519746_2520085_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2520476_2520719_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2520702_2521128_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2521196_2522240_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|2522271_2522694_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000603384.1|2523435_2523717_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2523713_2523941_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2523933_2524245_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2524372_2524591_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2524592_2525150_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2525383_2525596_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2525715_2526060_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2526181_2526454_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2526455_2527505_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2527517_2527823_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2527885_2528440_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2528664_2528862_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2528997_2529711_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2530161_2530593_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_064234946.1|2531070_2532921_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000411805.1|2533369_2533576_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2533580_2533925_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2533975_2534509_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2534779_2535349_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2535348_2535495_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2535717_2535903_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2536428_2536743_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2536824_2537049_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|2537064_2537322_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867498.1|2537435_2537981_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2537955_2539881_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2539877_2540084_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2540080_2541682_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2541662_2542982_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2542991_2543324_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2543379_2544405_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2544446_2544845_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2544856_2545210_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2545224_2545758_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2545754_2546150_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2546157_2546910_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2546923_2547346_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2547372_2547786_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_097340392.1|2547766_2550379_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|2550375_2550705_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2550704_2551403_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_072619021.1|2551413_2552157_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	2.5e-147
WP_134791867.1|2552102_2552735_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_000514788.1|2552983_2556463_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|2556530_2557130_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_024748460.1|2557194_2558508_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2558509_2558779_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2558892_2559468_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2559540_2560170_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2560251_2560893_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001480712.1|2560923_2561058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241229.1|2561054_2561369_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|2562799_2564260_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2564295_2564499_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 6
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	2830343	2904485	5395711	capsid,holin,portal,tail,protease,transposase,terminase,integrase,head	Stx2-converting_phage(36.36%)	84	2845845:2845872	2904622:2904649
WP_000422055.1|2830343_2831393_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2831612_2832371_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2832367_2832958_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2832997_2833870_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2834082_2835666_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2835693_2836314_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2836310_2837192_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2837329_2837374_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2837465_2839028_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2839027_2840623_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001416116.1|2840626_2841985_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000209521.1|2841996_2843190_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2843189_2843996_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2844376_2844556_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2844641_2845142_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2845187_2845694_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2845845:2845872	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|2846195_2846414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|2847007_2847436_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|2849164_2849755_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2849938_2850586_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2850722_2850869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2851296_2851575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2851914_2852295_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2852291_2852639_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2852688_2854227_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_024262009.1|2856435_2856624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025672.1|2856891_2858217_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2859243_2859513_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2859514_2860828_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2860979_2861579_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2861646_2863992_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2863943_2865119_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2865461_2866094_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2866039_2866783_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_072619016.1|2866793_2867492_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2867491_2867833_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|2867825_2871068_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2871120_2871330_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2871425_2871800_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2871805_2872522_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2872580_2872925_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2872921_2873368_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2873364_2873715_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2873724_2874051_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_115245565.1|2874130_2876632_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.0	0.0e+00
WP_001063099.1|2876577_2876799_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2876843_2878781_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2878844_2880506_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2880502_2881066_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_015994246.1|2881355_2881721_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2881762_2881990_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2882414_2882600_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2882827_2882974_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2882973_2883543_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2883813_2884347_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2884397_2884742_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2884746_2884953_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000143071.1|2885401_2887252_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_064761991.1|2887371_2887557_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000935548.1|2888048_2889107_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2889257_2889455_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2889696_2890227_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2890235_2890595_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2890607_2891654_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_069198811.1|2891655_2891934_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2892003_2892261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2892481_2892694_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2892972_2893731_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2894429_2894594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2894590_2895172_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|2895358_2895781_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|2895812_2896853_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2896824_2897376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2897359_2897587_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2897663_2898071_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2898334_2898634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2898706_2898925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2898947_2899355_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2899332_2899566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2899559_2899727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2900124_2900313_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2900309_2900501_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000113189.1|2903128_2903377_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2903354_2904485_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2904622:2904649	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 7
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	2951181	3046186	5395711	capsid,holin,portal,tail,tRNA,protease,transposase,terminase,integrase,lysis,head	Enterobacteria_phage(46.43%)	103	2974379:2974394	3040089:3040104
WP_001299679.1|2951181_2952438_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2952651_2953275_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2953274_2954126_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2954276_2955224_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2955348_2957028_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|2957082_2957361_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2957638_2958223_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2958339_2959431_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|2960274_2963160_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|2963259_2965179_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|2965885_2966497_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|2966596_2967511_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|2967606_2969343_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|2969445_2969535_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_085949318.1|2969500_2970714_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_000197859.1|2971051_2972122_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2972131_2973430_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|2973792_2975325_+	SpoVR family protein	NA	NA	NA	NA	NA
2974379:2974394	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|2975376_2976096_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|2976317_2977859_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|2978004_2978535_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_001690819.1|2978580_2979849_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	2.5e-208
WP_000897378.1|2979848_2980268_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|2980640_2981552_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2981758_2982220_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2982296_2982956_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2983027_2983321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2983561_2983963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|2984065_2984434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|2984953_2985649_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2985672_2986485_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2986488_2986755_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|2987986_2988571_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|2989069_2990023_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|2990209_2991694_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|2991996_2993535_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2993584_2993932_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2993928_2994309_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|2994384_2994633_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|2994689_2995358_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|2995855_2996038_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|2996116_2996617_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|2996653_2997160_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|2997178_2998069_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|2998188_2998770_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|2998769_3001685_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3001749_3002349_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3002415_3005814_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3005874_3006507_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3006443_3007187_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3007192_3007891_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3007890_3008220_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_143371049.1|3008216_3009299_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.5	3.0e-149
WP_085948178.1|3009307_3010521_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000459457.1|3012071_3012506_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3012487_3012910_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3012925_3013666_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3013673_3014069_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3014065_3014644_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3014655_3015009_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3015020_3015419_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3015460_3016486_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3016540_3016873_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3016882_3018202_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3018182_3019784_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3019780_3019987_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3019983_3021909_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3021883_3022429_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3022817_3023012_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3023176_3023383_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001690806.1|3023668_3024079_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	3.0e-70
WP_000738495.1|3024370_3024664_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3024754_3024937_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3025153_3025630_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3025616_3025922_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3026243_3026933_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3026929_3027070_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3027066_3027429_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3027425_3027716_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3027708_3027879_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3027878_3028334_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|3028524_3028716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|3028835_3030362_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3030419_3030542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3030606_3030939_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3031006_3031309_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3031305_3032007_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3032003_3032828_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|3032931_3033168_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3033157_3034300_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3034413_3035664_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3035835_3036489_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3036498_3036960_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3037013_3038120_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3038155_3038797_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3038800_3040171_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3040089:3040104	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3040339_3041011_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3041010_3042471_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3043071_3043353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3043608_3044151_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3044356_3044770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3044782_3045118_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3045130_3046186_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 8
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	3314592	3369938	5395711	holin,portal,tail,protease,transposase,integrase,head	Escherichia_phage(28.26%)	72	3316527:3316542	3371703:3371718
WP_000003653.1|3314592_3315180_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3315176_3315884_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3315902_3317696_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3316527:3316542	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3317692_3318811_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|3319428_3319611_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023407.1|3320804_3321074_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3321075_3322389_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3322453_3323053_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_115245580.1|3323120_3326594_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.3	0.0e+00
WP_000649827.1|3326727_3327255_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_001303882.1|3327285_3327492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050546863.1|3327445_3328078_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3328023_3328767_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001302968.1|3328777_3329476_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3329475_3329805_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3329801_3332381_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3332361_3332775_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3332801_3333233_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3333246_3333987_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3333968_3334235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3334292_3334640_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3334676_3336182_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831795.1|3336171_3337764_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	8.7e-182
WP_000259002.1|3337760_3337967_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|3339851_3340094_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3340143_3341682_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3341731_3342079_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3342075_3342456_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3342531_3342807_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3343557_3343764_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3343726_3344071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3344019_3344292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3344224_3344419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3344451_3344985_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3345205_3345319_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3345540_3345726_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3346253_3346568_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|3346772_3347986_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_115333675.1|3348161_3350012_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_042853491.1|3350129_3350333_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3350778_3351492_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3351586_3351826_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3352112_3352931_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3353082_3353454_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3353443_3353815_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3353827_3354877_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3354878_3355157_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3355324_3355537_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3355581_3355719_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_097561939.1|3355881_3356073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160654.1|3356084_3356858_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3357209_3357623_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3357638_3358409_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3358430_3359177_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3359183_3360275_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3360353_3360809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3361015_3361441_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3361424_3361697_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3361805_3362207_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3362234_3362426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3362425_3362713_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|3362714_3362933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3362990_3363146_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3363287_3363677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3363863_3364049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3364050_3364356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3364622_3364811_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3364807_3364999_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3365092_3367564_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3367631_3367874_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3367851_3368871_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3369278_3369938_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3371703:3371718	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 9
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	3600872	3641418	5395711	holin,portal,tail,protease,terminase,transposase,integrase,lysis	Enterobacteria_phage(46.67%)	55	3600457:3600471	3641492:3641506
3600457:3600471	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3600872_3601571_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_096976694.1|3601623_3601827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951026.1|3601801_3602683_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3602851_3603013_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3603509_3604529_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3604562_3605543_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3605719_3605989_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3605990_3607307_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3607366_3607966_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3611510_3612119_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3612055_3612799_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3612804_3613503_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3613512_3613842_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3613841_3616907_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3616878_3617208_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3617216_3617603_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3617663_3618407_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3618417_3618819_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3618815_3619394_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3619405_3619681_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_032245376.1|3619673_3619964_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	2.7e-41
WP_001171554.1|3620023_3620404_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3620400_3620748_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3620797_3622336_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001136598.1|3622533_3624561_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3624505_3624841_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3624962_3626087_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3626014_3626227_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001690735.1|3626223_3628326_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.1	0.0e+00
WP_000349509.1|3628325_3628817_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_024179345.1|3628806_3629085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3629491_3629644_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3629631_3630099_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3630095_3630593_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3630592_3630808_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3630950_3631349_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3631429_3631588_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3631673_3632417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3632600_3633290_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3633304_3633427_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3633764_3634724_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3634935_3635601_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3635597_3636218_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3636210_3636381_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3636377_3636560_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3637257_3637938_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3637934_3638117_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3638089_3638281_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3638291_3638573_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3638671_3638893_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3639103_3639706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3639830_3640016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3639948_3640116_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3640155_3640374_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|3640536_3641418_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
3641492:3641506	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 10
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	4184547	4267729	5395711	capsid,holin,portal,tail,protease,transposase,terminase,integrase,lysis,head,plate	Shigella_phage(41.54%)	104	4222979:4223025	4263827:4263873
WP_000998048.1|4184547_4186086_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4186135_4186483_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4186479_4186860_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4187123_4187387_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4187386_4187527_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4187596_4187788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303810.1|4187849_4188140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4188612_4189155_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4189229_4189817_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4189874_4190543_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4190568_4193094_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265657.1|4193083_4194727_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4194695_4195406_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4195718_4196048_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4196295_4196910_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000070685.1|4197327_4198017_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4198013_4198970_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667043.1|4198966_4201165_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4201174_4202131_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4202309_4203437_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4203578_4204637_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4204882_4205785_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4206487_4206766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4206932_4207655_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4207753_4208653_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4209328_4210285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4210417_4212751_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4212764_4213088_-	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_001071227.1|4213087_4213309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4213305_4213863_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4213859_4214120_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_085948178.1|4215566_4216780_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000968317.1|4217116_4217668_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4217673_4217946_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_100068595.1|4218093_4218297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|4218355_4218922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4218921_4219512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4219542_4220175_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4220167_4220626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4220625_4221243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4221215_4221632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4221635_4222817_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4222979:4223025	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4223779_4224523_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355484.1|4225347_4226121_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4226181_4226736_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145352.1|4226766_4227285_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000368084.1|4227284_4227887_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|4227858_4228302_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_032195359.1|4228322_4228718_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_000383550.1|4228988_4229573_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4229563_4230622_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4230608_4231034_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4231033_4231582_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4231581_4232661_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4232657_4233986_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4234046_4235882_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_001303047.1|4235868_4236057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661054.1|4236023_4236293_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4236292_4236649_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4236648_4238145_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4238128_4238299_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4238307_4238868_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4238864_4239371_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4239345_4239756_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4239752_4240076_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4240154_4241384_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4241394_4241997_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4241989_4243216_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_128484532.1|4243363_4244860_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4245093_4245588_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_001135207.1|4245713_4246064_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_001337714.1|4246356_4246497_-	hypothetical protein	NA	U5P461	Shigella_phage	81.0	3.5e-10
WP_000738423.1|4246589_4246883_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4246973_4247156_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4247372_4247849_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4247852_4248188_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4248324_4248618_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4248896_4249130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4249273_4249813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575470.1|4249846_4250026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4250026_4250779_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4250792_4251782_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4251789_4252599_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4252618_4253008_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4253004_4253331_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4253327_4253981_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072131649.1|4253980_4254475_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_000104949.1|4254471_4255413_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4255402_4255582_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4255757_4256309_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4256301_4256562_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4256659_4257352_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_085952403.1|4257804_4259017_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_115333674.1|4258983_4259118_+	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	77.4	8.4e-06
WP_000141753.1|4259156_4259402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|4259845_4261059_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000008235.1|4261228_4261765_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4261755_4262118_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4262117_4262423_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077769569.1|4262338_4262773_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000051887.1|4262649_4263813_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4264017_4265271_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4263827:4263873	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4265282_4266386_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4266673_4267729_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 11
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	4286515	4311772	5395711	transposase,plate	uncultured_Caudovirales_phage(75.0%)	21	NA	NA
WP_000027427.1|4286515_4287688_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4287768_4287954_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4287868_4288132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4288333_4290094_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4290096_4291233_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|4291340_4291631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001506588.1|4291978_4292518_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_085949308.1|4292586_4294119_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.2e-24
WP_000995683.1|4294276_4294993_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_115245597.1|4295132_4299365_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103335.1|4299440_4301582_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4301791_4302310_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4303006_4303507_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4303541_4303766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4303816_4305208_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4305298_4305712_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001690667.1|4305715_4307566_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4307529_4308612_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4308636_4309917_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4309913_4310438_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246414.1|4310440_4311772_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 12
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	4566502	4645079	5395711	capsid,holin,tail,tRNA,terminase,integrase,head	Enterobacteria_phage(31.15%)	84	4592496:4592521	4648141:4648166
WP_001223147.1|4566502_4567189_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4567588_4567729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4567824_4568541_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920320.1|4568600_4569953_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219596.1|4570010_4571435_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	2.1e-09
WP_001188676.1|4571434_4572124_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|4572136_4572610_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4572820_4573690_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4573686_4574334_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001302485.1|4574385_4574898_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4575044_4575371_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|4575460_4577398_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4577608_4579276_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093817.1|4579583_4580816_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	4.7e-82
WP_001029698.1|4580836_4582219_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|4582267_4583236_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000105832.1|4584013_4585030_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566150.1|4585061_4585325_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224877.1|4585485_4586205_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4586261_4587485_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4587536_4588859_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|4588985_4589765_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001088410.1|4591543_4592407_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
4592496:4592521	attL	CGGATGCGGCGTGAACGCCTTATCCG	NA	NA	NA	NA
WP_000563014.1|4592620_4593403_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000531527.1|4593399_4594473_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4594594_4594756_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001301888.1|4594882_4595488_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_024179336.1|4595880_4597467_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217541.1|4597686_4597935_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_044861088.1|4598095_4598737_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	2.8e-107
WP_072128817.1|4598818_4599235_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	94.2	2.8e-71
WP_001023417.1|4599395_4599665_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000279034.1|4599666_4600980_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.2e-77
WP_001216290.1|4601044_4601668_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_115333673.1|4601736_4605213_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.4	0.0e+00
WP_136767425.1|4605459_4606092_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.0	6.9e-98
WP_052915450.1|4606037_4606781_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	8.0e-146
WP_115333672.1|4606786_4607485_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.1	1.1e-131
WP_000807964.1|4607484_4607826_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_115333671.1|4607818_4611061_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.5	0.0e+00
WP_122993099.1|4611108_4611318_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_001030063.1|4611413_4611788_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_115333670.1|4611793_4612510_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	8.6e-129
WP_000133388.1|4612568_4612913_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|4612909_4613356_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|4613352_4613703_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125996.1|4613713_4614040_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001063096.1|4616566_4616788_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173031.1|4616832_4618770_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001299337.1|4618833_4620495_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_000958366.1|4620491_4621055_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_085952407.1|4621170_4621350_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	83.9	1.2e-18
WP_001365481.1|4621346_4621712_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_032321890.1|4621753_4621978_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	7.8e-20
WP_001303878.1|4622059_4622374_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|4622901_4623087_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|4623303_4623801_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|4623800_4624007_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_115333669.1|4624453_4626304_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001339373.1|4627121_4627274_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_024166409.1|4627288_4627498_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	2.0e-25
WP_001047110.1|4627583_4628336_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001365028.1|4628349_4629339_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.6e-194
WP_001061423.1|4629346_4630189_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	91.8	2.2e-139
WP_000767119.1|4630208_4630598_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	7.8e-68
WP_000210183.1|4630594_4630921_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	2.3e-52
WP_000066917.1|4630917_4631571_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_072128822.1|4631570_4632065_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	1.4e-85
WP_000061510.1|4632061_4632880_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	90.8	2.6e-129
WP_000620689.1|4632876_4633101_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	3.7e-38
WP_001087325.1|4633097_4634246_-	peptidase	NA	A5LH69	Enterobacteria_phage	99.2	1.2e-212
WP_000526663.1|4634242_4634794_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	98.9	6.4e-100
WP_001191669.1|4634786_4635047_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_071532484.1|4635027_4635171_-	amino acid permease	NA	NA	NA	NA	NA
WP_001311077.1|4635144_4635837_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001323606.1|4635892_4636171_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	3.0e-13
WP_000135680.1|4636559_4636922_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081316.1|4636987_4637812_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008198.1|4637939_4638476_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_001242723.1|4638466_4638829_+	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000206803.1|4638828_4639449_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_001061361.1|4639448_4639643_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	96.9	1.3e-31
WP_001159680.1|4639845_4643673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218278.1|4643855_4645079_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.3	1.2e-234
4648141:4648166	attR	CGGATGCGGCGTGAACGCCTTATCCG	NA	NA	NA	NA
>prophage 13
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	4754495	4767071	5395711		Enterobacteria_phage(81.82%)	16	NA	NA
WP_001301682.1|4754495_4755323_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4755540_4755735_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4756090_4758424_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4758438_4758759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459287.1|4758894_4759350_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4759342_4759630_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4759622_4760213_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4760209_4760476_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4761027_4761762_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4761758_4762259_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446132.1|4762332_4762905_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_071525797.1|4762957_4763221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095622.1|4763230_4764475_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4764512_4765247_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4765323_4765629_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4765796_4767071_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
>prophage 14
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	4799509	4858536	5395711	transposase,protease	Klosneuvirus(11.11%)	59	NA	NA
WP_001162171.1|4799509_4800862_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4800955_4801507_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4801662_4803036_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4803211_4804210_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4804242_4805238_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4805224_4806247_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4806260_4807763_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4807902_4808859_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001691111.1|4809168_4809699_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	9.4e-56
WP_000239579.1|4809778_4810129_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4810122_4810374_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|4810585_4810927_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001691110.1|4810929_4814709_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269308.1|4814705_4816439_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4816644_4817283_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4817605_4818949_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4819044_4819251_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4819575_4820130_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4820192_4821131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4821342_4822083_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4822272_4824216_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|4824333_4824714_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4824802_4825663_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4825770_4826736_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4826843_4827506_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4827550_4828963_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4829271_4829892_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4830109_4830748_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4830882_4832091_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4832098_4832530_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4833152_4833947_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4834017_4834467_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4834508_4834736_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4834740_4835055_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4835061_4835457_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4835783_4836059_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4836187_4836874_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4836873_4837728_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4837737_4838388_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4838401_4838866_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4838875_4839181_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4839196_4840594_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4842120_4842876_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000254636.1|4843802_4844132_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4844280_4844556_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4844672_4846298_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4846381_4847545_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4847547_4848186_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4848195_4848594_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4848611_4849271_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4849321_4850020_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4850038_4850440_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4850566_4851298_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4851478_4853920_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4853958_4854384_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4854588_4855887_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4855990_4856188_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4856269_4857274_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4857276_4858536_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 15
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	4995416	5010081	5395711	tail,tRNA,integrase	Enterobacteria_phage(37.5%)	19	4991257:4991272	5008786:5008801
4991257:4991272	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|4995416_4996832_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|4996914_4997898_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|4998063_4998306_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|4998439_4999477_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|4999565_5000663_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5000724_5000973_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5001133_5001775_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5001856_5002486_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5002558_5003131_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5003242_5003512_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5003513_5004827_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5004891_5005491_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5006812_5007349_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5007339_5007690_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5007686_5007971_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|5007980_5008160_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|5008306_5008504_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5008848_5009130_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5008786:5008801	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|5009547_5010081_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 16
NZ_CP032793	Escherichia coli strain NZRM3614 chromosome, complete genome	5395711	5162625	5213242	5395711	holin,capsid,portal,tail,protease,terminase,integrase,lysis,head,plate	Escherichia_phage(42.22%)	65	5180055:5180101	5210454:5210500
WP_000208242.1|5162625_5163156_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|5163165_5164497_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001308187.1|5164563_5165490_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|5165582_5166068_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001301616.1|5166127_5166802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000232687.1|5166924_5167551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296623.1|5167589_5167835_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|5168260_5169106_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|5169128_5170637_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250658.1|5170866_5171877_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796310.1|5171973_5172720_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|5172724_5173153_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|5173179_5173479_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|5173690_5174131_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|5174231_5174831_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|5174938_5175706_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|5175760_5176516_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045681.1|5176622_5177612_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|5177930_5178893_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|5179073_5179976_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
5180055:5180101	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|5180212_5180431_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882927.1|5180512_5181676_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	96.9	5.0e-203
WP_000978907.1|5181675_5182155_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069918.1|5182169_5184617_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	91.7	0.0e+00
WP_000785970.1|5184609_5184729_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|5184761_5185037_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|5185093_5185612_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001690909.1|5185624_5186815_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.4e-224
WP_001690910.1|5186874_5187468_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.4	1.6e-101
WP_001127577.1|5187498_5187903_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	43.1	5.5e-16
WP_000639074.1|5187911_5188307_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_001008235.1|5188278_5188722_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	1.2e-80
WP_115915210.1|5188742_5189942_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.5	7.7e-215
WP_001285307.1|5189938_5190550_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_001121488.1|5190542_5191451_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	3.7e-161
WP_000127163.1|5191455_5191803_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093730.1|5191799_5192435_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	9.3e-111
WP_001001780.1|5192501_5192954_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917162.1|5192946_5193414_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	5.7e-81
WP_001440152.1|5193376_5193550_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040680.1|5193521_5193947_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	94.3	1.7e-63
WP_000736576.1|5193934_5194360_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	7.2e-59
WP_001144101.1|5194374_5194872_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|5194871_5195153_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|5195156_5195360_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|5195359_5195869_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203462.1|5195968_5196712_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_001248539.1|5196715_5197789_-|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	99.2	4.3e-201
WP_001085953.1|5197847_5198702_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156861.1|5198875_5200648_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038188.1|5200647_5201682_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_000423599.1|5202112_5204320_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000268614.1|5204550_5206839_-	replication endonuclease	NA	Q858T4	Yersinia_virus	96.3	0.0e+00
WP_000027664.1|5206828_5207104_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|5207100_5207325_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277903.1|5207324_5207627_-	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	96.0	2.5e-45
WP_000557698.1|5207626_5207851_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|5207914_5208415_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308180.1|5208411_5208609_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	7.3e-30
WP_001308179.1|5208584_5208857_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|5208993_5209287_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|5209356_5210337_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|5210523_5211024_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
5210454:5210500	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|5211173_5211872_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|5211868_5213242_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP032794	Escherichia coli strain NZRM3614 plasmid pNZRM3614, complete sequence	92653	8214	63485	92653	integrase,protease,transposase	Stx2-converting_phage(35.29%)	52	41838:41852	63210:63224
WP_001034097.1|8214_12117_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_071525077.1|13515_13695_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14296_15118_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15117_16224_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16313_18035_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18108_19107_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|19415_19796_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|19792_20140_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|20294_20675_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|20671_21019_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|21068_22607_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_115333691.1|22648_24178_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	4.2e-298
WP_072141201.1|24877_27574_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|27660_28536_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|28593_30504_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|30503_32009_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|32010_33234_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|33264_33699_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|33695_34250_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|34264_34612_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|34608_35208_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|35204_36182_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|36220_37393_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|37379_37892_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|37949_38783_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|38874_39276_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|41407_41923_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
41838:41852	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|41924_44921_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_074454670.1|44970_47091_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	9.3e-46
WP_001213545.1|47094_48534_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|48600_48795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|48824_49109_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|49109_49307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|49277_49508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|49628_50369_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|50653_51631_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|51943_52132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|52038_52239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|52235_52856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|52852_53536_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|53994_54213_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|54214_54520_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_024165790.1|54520_55327_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|56003_56084_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|56049_57263_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001690782.1|57338_58094_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.2	3.2e-142
WP_000772446.1|58681_59848_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|59847_60819_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001349526.1|61203_61476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|61513_62416_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|62419_62725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|62801_63485_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
63210:63224	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
