The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	1219861	1240548	5503501	holin,integrase,tail,transposase	Stx2-converting_phage(46.15%)	24	1211508:1211522	1244271:1244285
1211508:1211522	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1219861_1221067_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1221068_1222382_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1222378_1224010_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1224010_1224409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1224506_1224920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151538850.1|1225315_1226632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1226707_1227010_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1227045_1227801_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_151538852.1|1228106_1228673_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	5.1e-108
WP_001223948.1|1228647_1229259_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1229255_1229921_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1229917_1230541_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1230793_1231537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1231622_1231790_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143065.1|1232197_1234051_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1234200_1234416_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1234420_1234765_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1235121_1235502_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1235498_1235846_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001303014.1|1235895_1236462_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_001023396.1|1236463_1236733_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_085948178.1|1237209_1238423_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001301665.1|1238760_1239819_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1239897_1240548_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
1244271:1244285	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	1521005	1526392	5503501	integrase	Enterobacteria_phage(50.0%)	6	1509954:1509970	1528588:1528604
1509954:1509970	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001005794.1|1521005_1521536_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1521535_1522003_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1521989_1522670_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1522679_1523816_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1523990_1525148_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1525459_1526392_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1528588:1528604	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	1770789	1841360	5503501	protease,integrase,tRNA,portal,holin,tail,terminase	Enterobacteria_phage(52.17%)	83	1773264:1773284	1816779:1816799
WP_000569336.1|1770789_1771716_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1771720_1772452_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1772432_1772540_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1772599_1773301_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1773264:1773284	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1773321_1774608_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1774641_1774896_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1774914_1775049_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1775052_1775295_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1775382_1775745_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1775741_1776098_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|1776174_1776462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|1776431_1776608_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1776609_1777557_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1777553_1777775_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1777873_1778155_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1778165_1778357_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1778329_1778512_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1778511_1779189_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1779185_1779971_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1779976_1780273_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1780348_1780639_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1781142_1782750_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1782856_1783549_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1783912_1784452_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001417283.1|1784538_1785468_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_000788906.1|1785464_1786166_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1786162_1786447_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1786674_1786872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1786915_1787197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1787287_1787389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1787385_1787841_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1787840_1788011_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1788003_1788294_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1788290_1788653_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1788649_1788790_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1788875_1789310_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_015971135.1|1789298_1789544_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_001356551.1|1789558_1789711_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1790514_1792461_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1792598_1792778_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1792818_1793064_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1793141_1793357_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1793361_1793895_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1794165_1794735_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1794734_1794881_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1795108_1795294_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1795811_1796288_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1796284_1798408_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1798404_1798617_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1798616_1800119_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114424.1|1800063_1802088_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1802175_1802502_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1802494_1802776_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1802778_1803402_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1803414_1803813_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1803820_1804573_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1804586_1805009_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1805035_1805344_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_151538881.1|1805387_1808033_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|1808029_1808359_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1808358_1809057_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1809067_1809811_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|1809756_1810386_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_001230508.1|1812738_1813338_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151538883.1|1813402_1814572_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|1814573_1814843_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1815003_1815420_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1815501_1816143_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_029208404.1|1816173_1816308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261939.1|1816304_1816553_-	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1817067_1818753_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1816779:1816799	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1818749_1819469_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1819515_1819986_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1820027_1820489_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1820613_1822617_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1822613_1823750_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1823742_1824474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1824492_1826022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1826032_1827121_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1828361_1828679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1828740_1832370_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1834083_1835364_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1839326_1841360_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	1956328	2031136	5503501	protease,integrase,portal,holin,tail,lysis,head,capsid,terminase,transposase	Stx2-converting_phage(55.95%)	100	1947279:1947293	1964010:1964024
1947279:1947293	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|1956328_1957507_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1957487_1957679_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_085948178.1|1957785_1958999_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001281188.1|1959069_1959414_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1959601_1959952_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|1960813_1961761_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1961757_1961979_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1962077_1962359_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|1962369_1962561_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1962533_1962716_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|1962712_1963393_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|1963389_1964175_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
1964010:1964024	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_151538890.1|1964180_1964477_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	99.0	1.6e-49
WP_000372937.1|1964551_1964695_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1964663_1964828_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1964900_1965269_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1965451_1965703_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1965761_1966034_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1966011_1966194_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1966762_1967284_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1967785_1968481_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1968555_1968771_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1968912_1969209_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000539354.1|1969389_1970211_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001220560.1|1971661_1972273_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000105280.1|1972519_1972735_+	hypothetical protein	NA	A0A0P0ZC82	Stx2-converting_phage	100.0	1.8e-34
WP_001303053.1|1972847_1973069_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	1.1e-37
WP_000103678.1|1973201_1973417_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1973427_1973664_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1973620_1974067_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1974063_1974591_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1974587_1974770_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|1975044_1975809_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|1975883_1976606_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1976605_1977211_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1977207_1977879_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1977869_1978358_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1979008_1979968_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1979979_1980249_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1980545_1980869_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_151538892.1|1981112_1983050_+	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	99.7	0.0e+00
WP_000143458.1|1983186_1983366_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1983406_1983679_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1983755_1983971_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1983970_1984468_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1984464_1984902_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1985104_1985602_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1985598_1985856_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1986318_1986546_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1986587_1986953_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_085952407.1|1986949_1987129_+	hypothetical protein	NA	H6WZK7	Escherichia_phage	83.9	1.2e-18
WP_000958396.1|1987244_1987808_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001301491.1|1987804_1989466_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|1989529_1991467_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1991511_1991733_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|1991678_1994180_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1994259_1994586_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1994595_1994946_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1994942_1995389_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1995385_1995730_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1995788_1996505_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1996510_1996885_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1996980_1997190_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_151538894.1|1997241_2000484_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.5	0.0e+00
WP_000807954.1|2000476_2000818_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2000817_2001516_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_001302649.1|2001532_2001853_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2001960_2002134_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2002204_2003128_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2003181_2003919_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2003864_2004497_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_151538896.1|2004756_2008236_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	99.9	0.0e+00
WP_087497997.1|2008302_2008902_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.5	1.2e-110
WP_151538898.1|2008966_2010280_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	5.3e-84
WP_001023452.1|2010281_2010551_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2010691_2011567_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2011791_2012442_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_012779375.1|2012426_2012711_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	100.0	1.2e-49
WP_001322269.1|2013156_2013351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322268.1|2013290_2013422_+	hypothetical protein	NA	O64339	Escherichia_phage	59.5	1.5e-07
WP_001303036.1|2013765_2014932_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2015050_2015524_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2015722_2016781_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2016952_2017282_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2017382_2017565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2018053_2018167_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2018179_2018374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2018832_2019201_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2019274_2019496_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2019558_2020035_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2020049_2020529_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2020610_2021432_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2021652_2022063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2022078_2022762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2022897_2023968_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2023964_2024870_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_061069249.1|2024866_2025721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966626.1|2026002_2028150_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071525094.1|2028256_2028439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|2029597_2031136_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	2054722	2096017	5503501	integrase,portal,holin,tail,head,terminase,transposase	Escherichia_phage(36.59%)	53	2035792:2035806	2058847:2058861
2035792:2035806	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2054722_2055745_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2055744_2055948_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2056006_2058478_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2058573_2058762_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2058758_2058947_-	cell division inhibitor	NA	NA	NA	NA	NA
2058847:2058861	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2059426_2059579_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2059853_2060498_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2060595_2060823_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2060819_2061245_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2061313_2062351_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|2062382_2062805_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2062839_2063538_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2063559_2063784_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2063780_2064137_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2064169_2064322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2064318_2064630_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2064756_2065320_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2065429_2065534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2065720_2065933_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2065974_2066160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2066100_2066379_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_032106091.1|2066380_2067430_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	4.5e-110
WP_000904141.1|2067442_2067802_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_115443435.1|2067798_2068488_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.7	1.3e-57
WP_001302069.1|2068518_2068641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023257.1|2070027_2071878_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|2071959_2073173_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2073492_2073699_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2073703_2074048_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2074098_2074632_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2074787_2074970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2074982_2075114_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2075341_2075527_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2076053_2076368_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2076449_2076674_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2077068_2077578_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2079462_2079669_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2079665_2081258_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2081247_2082753_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2082789_2083137_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2083194_2083461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2083442_2084183_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2084196_2084628_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2084654_2085068_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_151538900.1|2085048_2087628_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|2087624_2087954_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032256908.1|2087953_2088652_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_072619021.1|2088662_2089406_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	2.5e-147
WP_151539049.1|2089351_2089984_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	2.9e-104
WP_151539048.1|2090290_2093701_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.2	0.0e+00
WP_001230508.1|2093768_2094368_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151538902.1|2094432_2095746_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2095747_2096017_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	2153539	2174839	5503501	tail,integrase,transposase	Enterobacteria_phage(75.0%)	28	2167975:2167988	2177981:2177994
WP_151538904.1|2153539_2154640_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	1.6e-41
WP_085948178.1|2154691_2155904_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000005444.1|2156421_2157606_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2157605_2158118_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2158172_2158538_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|2158573_2158702_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|2161504_2161993_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2162149_2162722_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|2162765_2163182_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|2164387_2164702_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2164706_2165666_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2165742_2168565_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2167975:2167988	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2168571_2168937_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|2169009_2169240_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|2169562_2169862_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2169858_2170125_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2170121_2170325_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2170348_2170765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2170857_2170971_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2170967_2171210_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2171221_2171500_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2171510_2171861_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2171882_2172086_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2172157_2172295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2172384_2172789_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2172804_2173455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2173484_2173832_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_151538905.1|2173837_2174839_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	2.1e-104
2177981:2177994	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	2240797	2329704	5503501	protease,integrase,tRNA,holin,tail,lysis,head,capsid,terminase	Escherichia_phage(44.78%)	106	2232598:2232612	2273595:2273609
2232598:2232612	attL	TGGTGCGTGAACTGC	NA	NA	NA	NA
WP_000916763.1|2240797_2241028_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|2241166_2241541_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|2241544_2242417_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|2242429_2242771_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189085.1|2243163_2244240_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_005127484.1|2244205_2244487_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_151538908.1|2244593_2244782_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	93.5	8.8e-25
WP_010989194.1|2244774_2244969_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_001004413.1|2245032_2246085_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	62.5	2.3e-114
WP_069192725.1|2246096_2249246_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	74.1	0.0e+00
WP_151538909.1|2249346_2249622_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	8.3e-40
WP_000358365.1|2249696_2249867_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	67.9	2.0e-15
WP_000560219.1|2249866_2250088_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.5e-36
WP_001312793.1|2250528_2251017_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2251013_2251169_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|2251179_2251314_-	phage protein	NA	NA	NA	NA	NA
WP_015695616.1|2251346_2251565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|2251601_2252021_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2252100_2252355_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2252351_2252774_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|2252851_2253640_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|2253646_2254393_+	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|2254415_2255177_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|2255192_2255615_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935424.1|2255720_2255933_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	95.7	2.8e-35
WP_000209148.1|2255965_2256184_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000208018.1|2256458_2256620_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|2256698_2256944_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|2257375_2258527_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|2258494_2259484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|2259483_2260875_-	ATPase	NA	NA	NA	NA	NA
WP_069192817.1|2261374_2261974_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	1.0e-103
WP_000228038.1|2261973_2262264_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000640148.1|2262260_2262815_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000211416.1|2263088_2263670_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_001369585.1|2263912_2264110_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.0e-27
WP_151538910.1|2264244_2264958_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044805529.1|2265405_2265837_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.6	6.0e-69
WP_151538911.1|2266315_2268253_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.6	0.0e+00
WP_000143458.1|2268390_2268570_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2268610_2268856_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284522.1|2268933_2269149_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731215.1|2269153_2269738_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	90.0	6.7e-55
WP_032241040.1|2270178_2270712_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	3.6e-100
WP_032241041.1|2271010_2271478_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	77.4	1.7e-56
WP_072130446.1|2271474_2271708_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.0	6.0e-15
WP_071526390.1|2271629_2271881_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	95.7	3.2e-30
WP_000828070.1|2271816_2272143_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_001340952.1|2272274_2272415_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.7	2.6e-18
WP_000829192.1|2272515_2272881_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958366.1|2273169_2273733_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
2273595:2273609	attR	GCAGTTCACGCACCA	NA	NA	NA	NA
WP_151538912.1|2273729_2275391_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	97.8	0.0e+00
WP_069722247.1|2275454_2277392_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001063096.1|2277436_2277658_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000126019.1|2280507_2280834_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2280843_2281194_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2281190_2281637_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2281633_2281978_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2282036_2282753_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2282758_2283133_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2283228_2283438_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_151538894.1|2283489_2286732_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.5	0.0e+00
WP_000807954.1|2286724_2287066_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_151538913.1|2287065_2287764_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	99.1	1.1e-131
WP_137540389.1|2287769_2288513_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.8	2.0e-149
WP_151539051.1|2288458_2289091_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	3.0e-109
WP_151538915.1|2289337_2292814_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	96.3	0.0e+00
WP_001360257.1|2292882_2293506_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_151538917.1|2293570_2294884_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_053921583.1|2294885_2295155_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	9.3e-44
WP_122988840.1|2295265_2295343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001364738.1|2295364_2295556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|2295557_2296571_+	peptidase M85	NA	NA	NA	NA	NA
WP_000812736.1|2297303_2297960_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_001296140.1|2297960_2298152_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2298256_2298493_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001302304.1|2298610_2300050_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001302055.1|2300130_2302764_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|2302732_2304016_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2304145_2304643_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431368.1|2304739_2305438_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|2305457_2307506_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|2307697_2308579_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127211.1|2308624_2309998_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262182.1|2310174_2310966_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211007.1|2311109_2311349_-	membrane protein	NA	NA	NA	NA	NA
WP_000714550.1|2311508_2311652_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006862.1|2311726_2312014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|2312683_2312827_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2312839_2313049_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010147.1|2313214_2314024_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|2314020_2314587_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156258.1|2315016_2315475_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|2315529_2316381_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|2316393_2317194_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|2317256_2318228_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|2318690_2320247_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001302042.1|2320250_2321849_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624305.1|2321979_2323344_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|2323527_2324106_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854987.1|2324109_2325471_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
WP_000457334.1|2325544_2325724_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|2325843_2326203_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2326564_2326909_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2327040_2328951_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220997.1|2329008_2329704_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	2548221	2666502	5503501	protease,portal,holin,tail,head,capsid,terminase,transposase	Escherichia_phage(33.9%)	146	NA	NA
WP_001260835.1|2548221_2549043_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2549142_2549226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2549318_2549654_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2550050_2551304_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2551410_2552304_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2552438_2553659_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2553783_2554479_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2554431_2555724_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2555881_2556496_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2556538_2557393_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2557394_2558012_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2558022_2560446_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2560506_2562933_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2563131_2563437_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2563544_2564255_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2564257_2564818_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2564852_2565194_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2565328_2565655_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2565827_2565953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|2566636_2567849_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151538938.1|2567815_2567944_+	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	9.5e-07
WP_001296941.1|2567956_2568193_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_085952403.1|2569662_2570876_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000092782.1|2572130_2572319_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2572315_2572504_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2572991_2573144_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2573313_2573703_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2573805_2574081_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2574064_2574490_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2574512_2575466_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2575472_2576213_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2576242_2577013_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2577028_2577424_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2577480_2577837_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2577885_2578098_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2578133_2578505_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2578501_2578864_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2578979_2579084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2579272_2579485_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001304183.1|2579996_2580275_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_001302870.1|2580276_2581326_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904137.1|2581338_2581713_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|2581709_2582531_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|2582757_2582955_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2583105_2584164_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_151538940.1|2584655_2586506_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411802.1|2586952_2587159_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075112.1|2587158_2587656_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2587872_2588058_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2588584_2588899_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2588980_2589205_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2589246_2589612_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|2589900_2590464_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001301491.1|2590460_2592122_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173024.1|2592185_2594123_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|2594167_2594389_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|2597077_2597404_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2597413_2597764_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2597760_2598207_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2598203_2598548_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2598606_2599323_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2599328_2599703_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2599798_2600008_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_151538942.1|2600060_2603303_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.6	0.0e+00
WP_000807954.1|2603295_2603637_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2603636_2604074_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_085949318.1|2604195_2605409_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_151538944.1|2605574_2608835_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|2608837_2609053_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2609120_2609720_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_151538946.1|2609784_2611008_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	92.6	8.7e-81
WP_001023362.1|2611009_2611279_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2611392_2611968_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_010917823.1|2612345_2612693_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001121225.1|2612677_2613328_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998084.1|2613910_2615449_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	2.2e-299
WP_000612591.1|2615498_2615846_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2615842_2616223_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2617185_2617500_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2618138_2619383_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2619475_2619664_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2619660_2619849_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2620413_2620623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2620623_2621262_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2621273_2621426_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2621718_2622057_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2622448_2622691_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2622674_2623100_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2623168_2624212_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|2624243_2624666_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|2624699_2625416_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2625448_2625730_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2625726_2625954_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2625946_2626258_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2626385_2626604_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2626605_2627163_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2627396_2627609_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2627728_2628073_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2628194_2628467_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2628468_2629518_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2629530_2629836_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2629898_2630453_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2630677_2630875_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2631010_2631724_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2632174_2632606_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023202.1|2633083_2634934_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411805.1|2635382_2635589_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2635593_2635938_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2635988_2636522_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2636792_2637362_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2637361_2637508_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2637730_2637916_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2638441_2638756_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2638837_2639062_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|2639077_2639335_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867498.1|2639448_2639994_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_151538948.1|2639968_2641894_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000198153.1|2641890_2642097_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2642093_2643695_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2643675_2644995_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2645004_2645337_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2645392_2646418_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2646459_2646858_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2646869_2647223_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2647237_2647771_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2647767_2648163_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2648170_2648923_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2648936_2649359_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2649385_2649799_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_151538950.1|2649779_2652392_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2652388_2652718_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032256908.1|2652717_2653416_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_072619021.1|2653426_2654170_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	2.5e-147
WP_151539049.1|2654115_2654748_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	2.9e-104
WP_151539048.1|2655054_2658465_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.2	0.0e+00
WP_001230508.1|2658532_2659132_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_024748460.1|2659196_2660510_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2660511_2660781_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2660894_2661470_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001508802.1|2661542_2662172_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	2.7e-78
WP_001143804.1|2662253_2662895_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001480712.1|2662925_2663060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241229.1|2663056_2663371_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2663430_2664714_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2664802_2666263_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2666298_2666502_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	2936597	3010739	5503501	protease,integrase,portal,tail,holin,head,capsid,terminase,transposase	Stx2-converting_phage(35.71%)	85	2952099:2952126	3010876:3010903
WP_000422055.1|2936597_2937647_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2937866_2938625_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2938621_2939212_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2939251_2940124_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_151538968.1|2940336_2941920_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2941947_2942568_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2942564_2943446_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2943583_2943628_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2943719_2945282_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2945281_2946877_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001416116.1|2946880_2948239_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_151538970.1|2948250_2949444_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2949443_2950250_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2950630_2950810_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2950895_2951396_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2951441_2951948_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2952099:2952126	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|2952449_2952668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|2953261_2953690_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|2955418_2956009_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2956192_2956840_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2956976_2957123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2957550_2957829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2958168_2958549_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2958545_2958893_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2958942_2960481_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_024262009.1|2962689_2962878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025672.1|2963145_2964471_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2965497_2965767_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2965768_2967082_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2967233_2967833_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2967900_2970246_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2970197_2971373_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2971715_2972348_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2972293_2973037_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_072619016.1|2973047_2973746_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2973745_2974087_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_151538894.1|2974079_2977322_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.5	0.0e+00
WP_001453698.1|2977373_2977583_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2977678_2978053_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2978058_2978775_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2978833_2979178_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2979174_2979621_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2979617_2979968_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2979977_2980304_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2980383_2982885_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2982830_2983052_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2983096_2985034_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2985097_2986759_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2986755_2987319_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_015994246.1|2987608_2987974_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2988015_2988243_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2988667_2988853_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2989080_2989227_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2989226_2989796_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2990066_2990600_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2990650_2990995_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2990999_2991206_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000143071.1|2991654_2993505_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_064761991.1|2993624_2993810_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000935548.1|2994301_2995360_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2995510_2995708_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2995949_2996480_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2996488_2996848_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2996860_2997907_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2997908_2998187_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2998256_2998514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2998734_2998947_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2999225_2999984_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3000682_3000847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3000843_3001425_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|3001611_3002034_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|3002065_3003106_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3003077_3003629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3003612_3003840_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3003916_3004324_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3004587_3004887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3004959_3005178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3005200_3005608_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3005585_3005819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3005812_3005980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3006377_3006566_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3006562_3006754_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048549.1|3006846_3009318_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_000113189.1|3009382_3009631_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3009608_3010739_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3010876:3010903	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	3057435	3151123	5503501	protease,tRNA,integrase,portal,tail,holin,lysis,head,capsid,terminase,transposase	Enterobacteria_phage(48.15%)	101	3080633:3080648	3145026:3145041
WP_001299679.1|3057435_3058692_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3058905_3059529_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3059528_3060380_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3060530_3061478_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3061602_3063282_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3063336_3063615_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3063892_3064477_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3064593_3065685_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3066528_3069414_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3069513_3071433_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3072139_3072751_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3072850_3073765_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3073860_3075597_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|3075699_3075789_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_085949318.1|3075754_3076968_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_000197859.1|3077305_3078376_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3078385_3079684_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3080046_3081579_+	SpoVR family protein	NA	NA	NA	NA	NA
3080633:3080648	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3081630_3082350_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3082571_3084113_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3084258_3084789_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3084834_3086103_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3086102_3086522_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3086894_3087806_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3088012_3088474_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3088550_3089210_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3089281_3089575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3089815_3090217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|3090319_3090688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3091207_3091903_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3091926_3092739_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3092742_3093009_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3094240_3094825_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3095323_3096277_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3096463_3097948_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3098250_3099789_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3099838_3100186_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3100182_3100563_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3100638_3100887_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3100943_3101612_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3102109_3102292_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3102370_3102871_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3102907_3103414_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3103432_3104323_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3104442_3105024_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3105023_3107939_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3108003_3108603_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000090920.1|3112124_3112757_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3112693_3113437_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3113442_3114141_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3114140_3114470_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3114466_3117016_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3117008_3117443_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3117424_3117847_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3117862_3118603_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3118610_3119006_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3119002_3119581_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3119592_3119946_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3119957_3120356_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3120397_3121423_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3121477_3121810_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3121819_3123139_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3123119_3124721_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3124717_3124924_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_151538972.1|3124920_3126846_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3126820_3127366_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3127754_3127949_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3128113_3128320_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001403557.1|3128605_3129016_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_000738495.1|3129307_3129601_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3129691_3129874_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3130090_3130567_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3130553_3130859_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3131180_3131870_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3131866_3132007_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3132003_3132366_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3132362_3132653_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3132645_3132816_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3132815_3133271_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|3133461_3133653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151538974.1|3133772_3135299_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	9.3e-32
WP_001302833.1|3135356_3135479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3135543_3135876_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3135943_3136246_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3136242_3136944_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3136940_3137765_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|3137868_3138105_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3138094_3139237_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3139350_3140601_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3140772_3141426_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3141435_3141897_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3141950_3143057_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3143092_3143734_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3143737_3145108_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3145026:3145041	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3145276_3145948_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3145947_3147408_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3148008_3148290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3148545_3149088_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3149293_3149707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3149719_3150055_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3150067_3151123_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 11
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	3157215	3217190	5503501	integrase,portal,tail,holin,head,capsid,terminase,transposase	Stx2-converting_phage(26.67%)	76	3202757:3202777	3223847:3223867
WP_032174463.1|3157215_3158433_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_085952403.1|3158431_3159644_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001301987.1|3160006_3161128_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|3161176_3162403_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3162652_3163789_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3163772_3164636_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|3164666_3164879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|3164999_3166361_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3166421_3166697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3166776_3166902_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_085948178.1|3168173_3169386_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001301984.1|3170318_3173720_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3174310_3176659_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3176678_3176768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3176780_3177017_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3176962_3177700_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3177753_3178632_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3178934_3179045_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3179154_3179409_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3179425_3180124_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3180123_3180465_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3180457_3183700_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_122993099.1|3183747_3183957_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_000710952.1|3184052_3184427_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3184441_3185158_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3185223_3185568_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3185564_3186011_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3186007_3186358_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125996.1|3186367_3186694_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_000267295.1|3186696_3189276_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3189221_3189443_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3189487_3191425_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3191488_3193150_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3193146_3193710_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_071526897.1|3193901_3194033_-	DNase	NA	H6WZK7	Escherichia_phage	100.0	2.4e-05
WP_000279796.1|3194001_3194367_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3194408_3194594_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3194723_3194864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3195220_3195445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3195509_3195716_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3195943_3196090_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3196089_3196659_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3196929_3197463_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3197513_3197858_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3197862_3198078_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3198153_3198423_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3198460_3198643_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023167.1|3198790_3200728_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3201042_3201210_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3201806_3202628_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3202624_3202999_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3202757:3202777	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3203011_3204061_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3204062_3204341_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3204508_3204721_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3204909_3205014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3205129_3205717_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3205719_3205911_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3205912_3206350_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3206336_3206654_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3206607_3206925_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3206914_3207217_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|3207213_3207531_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451014.1|3207527_3208244_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.2	6.9e-70
WP_001301518.1|3208277_3208700_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|3208731_3209769_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693962.1|3209837_3210263_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3210246_3210570_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3210694_3211171_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3211486_3211639_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3211753_3212269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3212401_3212791_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3212852_3213122_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3213090_3214209_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3214375_3215170_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3215166_3216213_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3216368_3217190_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3223847:3223867	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	3346632	3379642	5503501	protease,transposase	Stx2-converting_phage(38.46%)	39	NA	NA
WP_001182418.1|3346632_3347712_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_151538978.1|3347711_3348668_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_151538980.1|3348678_3349887_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3349904_3350372_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3350632_3350962_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3350948_3351290_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3352232_3353846_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3353876_3354227_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3354223_3354649_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397129.1|3356986_3357658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302565.1|3357845_3358097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001687190.1|3358074_3358254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817755.1|3358315_3358597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3358528_3358669_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_001310151.1|3358660_3359017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803992.1|3358970_3359234_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3360445_3361063_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3361074_3361749_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3361749_3362214_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3362223_3363927_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3363919_3364240_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3364248_3364551_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3364641_3365340_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3365720_3365996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3366220_3367840_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3367932_3368292_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_071525024.1|3368427_3368676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303893.1|3368701_3368902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|3368977_3369268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3369291_3369543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|3369625_3370838_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_151538982.1|3370804_3370924_+	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.2e-06
WP_028913479.1|3370903_3371509_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_151538984.1|3371555_3372188_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.4	1.8e-53
WP_085948178.1|3372153_3373367_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001171554.1|3374212_3374593_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3374589_3374937_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3374986_3376525_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000233452.1|3377281_3379642_-	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
>prophage 13
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	3478384	3533585	5503501	protease,integrase,portal,tail,holin,head,terminase,transposase	Escherichia_phage(27.66%)	72	3480319:3480334	3535350:3535365
WP_000003653.1|3478384_3478972_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3478968_3479676_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3479694_3481488_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3480319:3480334	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3481484_3482603_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|3483220_3483403_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023407.1|3484454_3484724_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3484725_3486039_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_151538986.1|3486103_3486703_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	7.5e-110
WP_115245580.1|3486770_3490244_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.3	0.0e+00
WP_000649827.1|3490377_3490905_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_001303882.1|3490935_3491142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050546863.1|3491095_3491728_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_072618966.1|3491673_3492417_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	8.6e-148
WP_032256908.1|3492427_3493126_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|3493125_3493455_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_151538900.1|3493451_3496031_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3496011_3496425_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3496451_3496883_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3496896_3497637_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3497618_3497885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3497942_3498290_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3498326_3499832_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831795.1|3499821_3501414_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	8.7e-182
WP_000259002.1|3501410_3501617_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3501600_3503529_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001301919.1|3503500_3503743_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3503792_3505331_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3505380_3505728_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3505724_3506105_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3506180_3506456_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3507206_3507413_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3507375_3507720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3507668_3507941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3507873_3508068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3508100_3508634_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3508854_3508968_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3509189_3509375_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3509901_3510216_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|3510420_3511634_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000874392.1|3511809_3513660_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|3513777_3513981_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3514425_3515139_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3515233_3515473_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3515759_3516578_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3516729_3517101_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3517090_3517462_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3517474_3518524_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3518525_3518804_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3518971_3519184_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3519228_3519366_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3519731_3520505_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3520856_3521270_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3521285_3522056_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3522077_3522824_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3522830_3523922_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3524000_3524456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3524662_3525088_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3525071_3525344_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3525452_3525854_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3525881_3526073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3526072_3526360_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|3526361_3526580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3526637_3526793_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3526934_3527324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3527510_3527696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3527697_3528003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3528269_3528458_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3528454_3528646_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3528739_3531211_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3531278_3531521_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3531498_3532518_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3532925_3533585_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3535350:3535365	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 14
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	3764518	3798671	5503501	protease,integrase,tail,holin,lysis,transposase	Enterobacteria_phage(47.37%)	48	3764103:3764117	3798745:3798759
3764103:3764117	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3764518_3765217_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_096976694.1|3765269_3765473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951026.1|3765447_3766329_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3766497_3766659_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3767155_3768175_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3768208_3769189_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3769365_3769635_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3769636_3770953_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3771012_3771612_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3775156_3775765_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3775701_3776445_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3776450_3777149_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3777158_3777488_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3777487_3780553_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3780524_3780854_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3780862_3781249_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3781309_3782053_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3782063_3782465_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3782461_3783040_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3783051_3783327_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3783319_3783643_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_151538997.1|3783729_3784458_-	peptidase	NA	A5LH30	Enterobacteria_phage	100.0	1.3e-129
WP_085948178.1|3784512_3785726_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303851.1|3786060_3786339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3786745_3786898_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3786885_3787353_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3787349_3787847_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3787846_3788062_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3788204_3788603_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3788683_3788842_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_123163510.1|3788927_3789671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3789854_3790544_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3790558_3790681_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3791017_3791977_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3792188_3792854_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3792850_3793471_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3793463_3793634_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3793630_3793813_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3794510_3795191_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3795187_3795370_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3795342_3795534_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3795544_3795826_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3795924_3796146_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3796356_3796959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3797083_3797269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3797201_3797369_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3797408_3797627_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|3797789_3798671_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
3798745:3798759	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 15
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	4341830	4422384	5503501	plate,protease,integrase,portal,tail,holin,lysis,head,capsid,terminase,transposase	Shigella_phage(42.86%)	101	4378947:4378993	4418482:4418528
WP_000998048.1|4341830_4343369_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4343418_4343766_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4343762_4344143_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4344406_4344670_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4344669_4344810_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4344879_4345071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303810.1|4345132_4345423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4345895_4346438_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4346512_4347100_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4347157_4347826_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4347851_4350377_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265657.1|4350366_4352010_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4351978_4352689_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4353001_4353331_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4353578_4354193_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000070685.1|4354610_4355300_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4355296_4356253_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667043.1|4356249_4358448_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4358457_4359414_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4359592_4360720_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4360861_4361920_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4362165_4363068_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4363770_4364049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4364215_4364938_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4365036_4365936_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4366611_4367568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4367700_4370034_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4370047_4370371_-	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_001071227.1|4370370_4370592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4370588_4371146_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4371142_4371403_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4372336_4373089_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4373085_4373637_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4373642_4373915_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_100068595.1|4374062_4374266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|4374324_4374891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151539017.1|4374890_4375481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4375511_4376144_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4376136_4376595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4377183_4377600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4377603_4378785_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4378947:4378993	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4379747_4380491_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355484.1|4381315_4382089_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4382149_4382704_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145352.1|4382734_4383253_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000368084.1|4383252_4383855_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|4383826_4384270_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_032195359.1|4384290_4384686_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_000383550.1|4384956_4385541_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4385531_4386590_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4386576_4387002_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4387001_4387550_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4387549_4388629_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4388625_4389954_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4390014_4391850_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_001303047.1|4391836_4392025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661054.1|4391991_4392261_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4392260_4392617_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4392616_4394113_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4394096_4394267_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4394275_4394836_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4394832_4395339_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4395313_4395724_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4395720_4396044_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4396122_4397352_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4397362_4397965_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4397957_4399184_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_128484532.1|4399331_4400828_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4401061_4401556_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_001135207.1|4401681_4402032_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_001337714.1|4402324_4402465_-	hypothetical protein	NA	U5P461	Shigella_phage	81.0	3.5e-10
WP_000738423.1|4402557_4402851_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4402941_4403124_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4403340_4403817_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4403820_4404156_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4404292_4404586_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4404864_4405098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4405241_4405781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4405995_4406748_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4406761_4407751_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4407758_4408568_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4408587_4408977_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4408973_4409300_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4409296_4409950_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072131649.1|4409949_4410444_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_000104949.1|4410440_4411382_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4411371_4411551_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001191674.1|4412269_4412530_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4412627_4413320_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4413597_4413894_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000141753.1|4413811_4414057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151539019.1|4414308_4414569_-	hypothetical protein	NA	A5LH65	Enterobacteria_phage	86.8	4.5e-19
WP_085948178.1|4414534_4415748_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000008235.1|4415883_4416420_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4416410_4416773_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4416772_4417078_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077769569.1|4416993_4417428_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000051887.1|4417304_4418468_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4418672_4419926_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4418482:4418528	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4419937_4421041_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4421328_4422384_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 16
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	4441170	4502050	5503501	plate,tRNA,transposase	uncultured_Caudovirales_phage(33.33%)	48	NA	NA
WP_000027427.1|4441170_4442343_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4442423_4442609_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4442523_4442787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4442988_4444749_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4444751_4445888_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|4445995_4446286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356573.1|4446633_4447191_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_085949308.1|4447259_4448792_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.2e-24
WP_000995683.1|4448949_4449666_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000103335.1|4454113_4456255_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4456464_4456983_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4457679_4458180_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4458214_4458439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4458489_4459881_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4459971_4460385_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4460388_4462239_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4462202_4463285_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4463309_4464590_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4464586_4465111_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246414.1|4465113_4466445_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343292.1|4466449_4467211_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_085948178.1|4468738_4469952_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000088854.1|4471306_4472050_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240517.1|4472054_4473467_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001303798.1|4473603_4477038_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_151539021.1|4477048_4478458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|4478423_4478903_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000002701.1|4478923_4479145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4479223_4479820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4479822_4480272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000583960.1|4480268_4480565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086136.1|4480749_4481550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301976.1|4482087_4482819_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4482883_4483351_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|4483347_4484070_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4484103_4484859_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4484930_4486289_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|4486336_4487107_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4487184_4487985_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4488225_4489140_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4489136_4489940_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4495699_4496275_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4496462_4497494_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4497486_4498140_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4498179_4498995_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4499112_4499517_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4499513_4500221_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4500331_4502050_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	4906045	4965067	5503501	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4906045_4907398_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4907491_4908043_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4908198_4909572_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4909747_4910746_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4910778_4911774_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_151539055.1|4911760_4912777_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4912790_4914293_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4914432_4915389_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4915698_4916229_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4916308_4916659_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4916652_4916904_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|4917115_4917457_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4917459_4921239_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269308.1|4921235_4922969_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4923174_4923813_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4924135_4925479_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4925574_4925781_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4926105_4926660_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4926722_4927661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4927872_4928613_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4928802_4930746_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|4930863_4931244_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4931332_4932193_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4932300_4933266_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4933373_4934036_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4934080_4935493_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4935801_4936422_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4936639_4937278_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4937412_4938621_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4938628_4939060_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4939682_4940477_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4940547_4940997_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4941038_4941266_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4941270_4941585_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4941591_4941987_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4942313_4942589_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4942717_4943404_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4943403_4944258_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4944267_4944918_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4944931_4945396_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4945405_4945711_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4945726_4947124_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4948650_4949406_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4949402_4950152_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4950333_4950663_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4950811_4951087_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4951203_4952829_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4952912_4954076_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4954078_4954717_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4954726_4955125_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4955142_4955802_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4955852_4956551_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4956569_4956971_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4957097_4957829_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4958009_4960451_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4960489_4960915_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4961119_4962418_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4962521_4962719_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4962800_4963805_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4963807_4965067_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 18
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	5101555	5116220	5503501	tail,tRNA,integrase	Enterobacteria_phage(37.5%)	19	5097396:5097411	5114925:5114940
5097396:5097411	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5101555_5102971_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5103053_5104037_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5104202_5104445_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5104578_5105616_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5105704_5106802_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5106863_5107112_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5107272_5107914_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5107995_5108625_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5108697_5109270_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5109381_5109651_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5109652_5110966_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5111030_5111630_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5112951_5113488_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5113478_5113829_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5113825_5114110_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|5114119_5114299_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|5114445_5114643_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5114987_5115269_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5114925:5114940	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|5115686_5116220_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 19
NZ_CP032789	Escherichia coli strain NZRM4169 chromosome, complete genome	5503501	5268765	5319381	5503501	plate,protease,portal,tail,holin,lysis,head,capsid,terminase	Escherichia_phage(44.19%)	63	NA	NA
WP_000208242.1|5268765_5269296_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|5269305_5270637_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001308187.1|5270703_5271630_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|5271722_5272208_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001301616.1|5272267_5272942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000232687.1|5273064_5273691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296623.1|5273729_5273975_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|5274400_5275246_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|5275268_5276777_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250658.1|5277006_5278017_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796310.1|5278113_5278860_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|5278864_5279293_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|5279319_5279619_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|5279830_5280271_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|5280371_5280971_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|5281078_5281846_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|5281900_5282656_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045681.1|5282762_5283752_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|5284070_5285033_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|5285213_5286116_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000468308.1|5286352_5286571_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882927.1|5286652_5287816_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	96.9	5.0e-203
WP_000978907.1|5287815_5288295_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069918.1|5288309_5290757_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	91.7	0.0e+00
WP_000785970.1|5290749_5290869_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|5290901_5291177_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|5291233_5291752_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001690909.1|5291764_5292955_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.4e-224
WP_000905105.1|5293014_5293608_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	3.3e-102
WP_001127577.1|5293638_5294043_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	43.1	5.5e-16
WP_000639074.1|5294051_5294447_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_001008235.1|5294418_5294862_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	1.2e-80
WP_115915210.1|5294882_5296082_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.5	7.7e-215
WP_001285307.1|5296078_5296690_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_001121488.1|5296682_5297591_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	3.7e-161
WP_000127163.1|5297595_5297943_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093730.1|5297939_5298575_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	9.3e-111
WP_001001780.1|5298641_5299094_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917162.1|5299086_5299554_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	5.7e-81
WP_001440152.1|5299516_5299690_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040680.1|5299661_5300087_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	94.3	1.7e-63
WP_000736576.1|5300074_5300500_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	7.2e-59
WP_001144101.1|5300514_5301012_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|5301011_5301293_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|5301296_5301500_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|5301499_5302009_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203462.1|5302108_5302852_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_001248539.1|5302855_5303929_-|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	99.2	4.3e-201
WP_001085953.1|5303987_5304842_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156861.1|5305015_5306788_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038188.1|5306787_5307822_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_000423599.1|5308252_5310460_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000268614.1|5310690_5312979_-	replication endonuclease	NA	Q858T4	Yersinia_virus	96.3	0.0e+00
WP_000027664.1|5312968_5313244_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|5313240_5313465_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277903.1|5313464_5313767_-	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	96.0	2.5e-45
WP_000557698.1|5313766_5313991_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|5314054_5314555_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|5314724_5314997_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|5315133_5315427_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001223800.1|5316662_5317163_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|5317312_5318011_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|5318007_5319381_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP032790	Escherichia coli strain NZRM4169 plasmid pNZRM4169, complete sequence	93284	8215	60792	93284	integrase,transposase,protease	Macacine_betaherpesvirus(30.77%)	49	36695:36709	60517:60531
WP_001034097.1|8215_12118_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_071525077.1|13514_13694_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14295_15117_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15116_16223_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16312_18034_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18107_19106_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001302198.1|19697_19913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072141201.1|19975_22672_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|22758_23634_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|23691_25602_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|25601_27107_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|27108_28332_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|28362_28797_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|28793_29348_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|29362_29710_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|29706_30306_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|30302_31280_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|31318_32491_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|32477_32990_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|33047_33881_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|33972_34374_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|36264_36780_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
36695:36709	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|36781_39778_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|39827_41948_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|41951_43391_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|43457_43652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|43681_43966_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|43966_44164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|44134_44365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|44811_46350_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|46399_46747_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|46743_47124_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000361615.1|47960_48938_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|49250_49439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|49345_49546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49542_50163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50159_50843_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51301_51520_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51521_51827_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|51827_52634_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|53310_53391_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_151539068.1|53356_54570_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	6.5e-169
WP_000852148.1|54645_55401_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|55988_57155_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|57154_58126_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001349526.1|58510_58783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|58820_59723_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|59726_60032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|60108_60792_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
60517:60531	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
