The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044506	Lactobacillus rhamnosus strain BIO6870 chromosome, complete genome	3006715	405874	524680	3006715	transposase	Faecalibacterium_phage(15.0%)	100	NA	NA
WP_014568877.1|405874_406891_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569064.1|408036_408894_+	transketolase	NA	NA	NA	NA	NA
WP_014569065.1|408886_409903_+	transketolase	NA	NA	NA	NA	NA
WP_014569066.1|410094_410949_+	ROK family protein	NA	NA	NA	NA	NA
WP_005714899.1|410998_411757_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_014569067.1|411997_412471_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_005714903.1|412475_412805_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569068.1|412829_413936_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_014568877.1|414099_415116_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569069.1|415196_416012_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_005714906.1|416033_416927_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_005714907.1|417471_417948_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569071.1|417919_418348_-	PTS mannose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569072.1|418365_420054_-	PTS mannose transporter subunit IICD	NA	NA	NA	NA	NA
WP_005714910.1|420093_420804_-	transaldolase	NA	NA	NA	NA	NA
WP_087307801.1|420995_422039_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569074.1|422277_423192_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569075.1|423224_423575_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_005714931.1|423576_423939_+	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_005714932.1|423999_425295_+	membrane protein	NA	NA	NA	NA	NA
WP_014569076.1|425324_426209_+	hydrolase	NA	NA	NA	NA	NA
WP_005714935.1|426201_427308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569077.1|427298_428471_+	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_014569078.1|428472_429702_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_014569079.1|430029_430866_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_005691490.1|430948_431509_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014569080.1|431510_433211_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	3.8e-18
WP_014569081.1|433207_434035_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_014569082.1|434386_435520_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_003660077.1|436349_438164_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569083.1|438633_439545_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	8.4e-20
WP_003601979.1|439886_440537_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_002819966.1|440542_440827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076638850.1|441565_441781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016382272.1|441904_442303_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_014569086.1|442773_443853_-	class C sortase	NA	NA	NA	NA	NA
WP_014569087.1|443926_444931_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569088.1|444933_445659_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003587111.1|449303_452126_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	3.1e-73
WP_003582045.1|452185_452449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101495030.1|452500_452848_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107755080.1|453049_453901_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	1.3e-43
WP_014569096.1|454234_455026_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	2.0e-147
WP_014569095.1|455079_455331_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.8	1.1e-35
WP_014569018.1|455624_457121_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569094.1|457238_459329_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014569093.1|459325_461113_+	AAA family ATPase	NA	U5PSZ2	Bacillus_phage	25.9	1.7e-08
WP_014569090.1|462151_462709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014568877.1|463387_464404_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_095691959.1|464695_465483_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014569099.1|465532_466207_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	1.2e-58
WP_107755082.1|466289_466391_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_029944056.1|467049_468606_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003574021.1|468956_469877_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_014569101.1|469911_471165_-	MFS transporter	NA	NA	NA	NA	NA
WP_014569018.1|471263_472760_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569102.1|472761_474084_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014569105.1|475443_478422_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	1.5e-147
WP_005714951.1|478454_479936_+	amino acid permease	NA	NA	NA	NA	NA
WP_015764844.1|480083_481541_+	amino acid permease	NA	NA	NA	NA	NA
WP_005714953.1|481808_482663_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569107.1|482823_485040_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014569108.1|485273_486473_+	MFS transporter	NA	NA	NA	NA	NA
WP_014569109.1|486496_487927_+	amidohydrolase	NA	NA	NA	NA	NA
WP_014569110.1|488012_489074_-	membrane protein	NA	NA	NA	NA	NA
WP_014569111.1|489070_489823_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.9e-22
WP_014569112.1|489832_490711_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014569113.1|490724_491393_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014569114.1|491389_492076_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014569115.1|492544_493282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076638895.1|493517_493763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569116.1|494008_494554_+	DNA-directed RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_005686332.1|494670_494823_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_014569117.1|494834_495599_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CCE6	Lactobacillus_phage	52.0	2.3e-47
WP_014569118.1|495819_496617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569119.1|496867_497371_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569120.1|497378_498440_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014569121.1|498444_499134_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.8e-28
WP_014569123.1|499422_500793_-	NAD(FAD)-dependent dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.2e-09
WP_015764848.1|501039_501858_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005691594.1|501980_502253_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_014569124.1|502401_503166_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_014569125.1|503575_504004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003605947.1|505837_507256_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_005709607.1|507520_507802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569127.1|507780_508638_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014569128.1|508847_509864_+	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	28.8	8.4e-21
WP_014569129.1|510043_511009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714981.1|511279_512974_-	oleate hydratase	NA	NA	NA	NA	NA
WP_005686371.1|512985_513114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005691618.1|513202_513769_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005686376.1|513858_514227_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_014569130.1|514502_515084_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_014569131.1|515070_516090_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_014569132.1|516283_516712_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014569133.1|517170_517854_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	1.1e-24
WP_014569134.1|517860_519033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569018.1|519432_520929_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569137.1|522299_523136_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569138.1|523183_524680_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP044506	Lactobacillus rhamnosus strain BIO6870 chromosome, complete genome	3006715	1100902	1140628	3006715	portal,head,terminase,integrase,holin,tail	Lactobacillus_phage(85.42%)	60	1090761:1090774	1127616:1127629
1090761:1090774	attL	CATGGCTGATACTG	NA	NA	NA	NA
WP_014569455.1|1100902_1102087_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	7.3e-226
WP_005716132.1|1102257_1102464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569456.1|1102431_1103433_-	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	23.3	4.4e-06
WP_005716134.1|1103543_1103747_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	85.1	8.6e-26
WP_015764910.1|1103770_1104196_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	94.3	2.5e-59
WP_003606997.1|1104578_1104800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606998.1|1104800_1105556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569458.1|1105662_1106364_-	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	39.3	5.1e-25
WP_014569459.1|1106423_1106846_-	toxin	NA	A0A1B0YA58	Lactobacillus_phage	93.5	5.1e-73
WP_003574523.1|1106835_1107174_-	helix-turn-helix domain-containing protein	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	6.6e-55
WP_014569460.1|1107308_1107551_+	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	95.0	4.6e-34
WP_029943629.1|1107547_1107796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569461.1|1107792_1108020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569463.1|1108331_1108880_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	97.8	1.0e-97
WP_015764912.1|1108858_1109089_+	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	98.6	5.5e-37
WP_014569466.1|1109232_1109460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569467.1|1109666_1110542_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	52.2	5.7e-58
WP_014569468.1|1110561_1111326_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	54.0	4.0e-76
WP_014569469.1|1111341_1112298_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	90.9	2.0e-128
WP_014569470.1|1112310_1112796_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	86.3	8.8e-61
WP_014569471.1|1112813_1113029_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	91.4	6.1e-30
WP_015764330.1|1113025_1113217_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569472.1|1113586_1114036_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	93.2	6.2e-69
WP_014569473.1|1114082_1114337_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	94.0	4.6e-37
WP_014569474.1|1114333_1114735_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	2.6e-50
WP_014569475.1|1114747_1115212_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	98.0	7.2e-20
WP_014569476.1|1115223_1115409_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	88.5	5.1e-25
WP_014569477.1|1115405_1115912_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	72.9	8.6e-59
WP_015764915.1|1115901_1116081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029943632.1|1116067_1116271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569478.1|1116260_1116692_+	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	69.9	1.1e-49
WP_101495024.1|1116685_1117051_+	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	58.0	3.2e-31
WP_014569479.1|1117047_1117287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029943634.1|1117336_1117519_+	hypothetical protein	NA	A0A0P0I365	Lactobacillus_phage	61.7	1.6e-15
WP_101495025.1|1117524_1117596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711378.1|1117813_1118242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569480.1|1119269_1120418_+	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	98.7	2.4e-221
WP_014569481.1|1120430_1120973_+	endonuclease	NA	B4XYU1	Lactobacillus_phage	100.0	1.1e-107
WP_015764918.1|1120965_1121286_+	ribonucleoside-diphosphate reductase	NA	A8YQN5	Lactobacillus_phage	92.4	9.0e-54
WP_014569483.1|1121322_1121856_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.1	2.7e-63
WP_029943635.1|1121833_1123189_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	59.1	4.9e-149
WP_014569485.1|1123193_1124621_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	90.6	2.7e-243
WP_014569486.1|1124586_1125579_+	hypothetical protein	NA	A0A0P0ID43	Lactobacillus_phage	95.5	6.2e-178
WP_014569487.1|1125703_1126360_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	80.0	4.3e-58
WP_014569488.1|1126375_1127389_+	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	26.5	3.1e-23
WP_014569489.1|1127616_1127991_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	91.9	3.2e-58
1127616:1127629	attR	CATGGCTGATACTG	NA	NA	NA	NA
WP_014569490.1|1127995_1128298_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	93.0	6.3e-49
WP_015764920.1|1128294_1128660_+	HK97 gp10 family phage protein	NA	A0A0P0IUZ3	Lactobacillus_phage	96.7	2.0e-57
WP_014569492.1|1128660_1129065_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	3.0e-70
WP_014569493.1|1129076_1129679_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.5	2.4e-100
WP_014569494.1|1129765_1130098_+	hypothetical protein	NA	A0A0P0IQQ6	Lactobacillus_phage	94.5	2.4e-49
WP_015764921.1|1130202_1130556_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	96.6	5.3e-55
WP_014569496.1|1130548_1133638_+	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	88.0	1.4e-263
WP_015764922.1|1133640_1135629_+|tail	phage tail protein	tail	B4XYQ4	Lactobacillus_phage	85.9	0.0e+00
WP_087307829.1|1135625_1138136_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	82.6	0.0e+00
WP_005686996.1|1138145_1138469_+	hypothetical protein	NA	B4XYQ6	Lactobacillus_phage	98.1	1.1e-51
WP_014569499.1|1138461_1138593_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	2.5e-18
WP_014569500.1|1138622_1138916_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
WP_014569501.1|1138905_1139319_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	97.9	1.4e-43
WP_014569502.1|1139329_1140628_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	99.1	1.2e-232
>prophage 3
NZ_CP044506	Lactobacillus rhamnosus strain BIO6870 chromosome, complete genome	3006715	1493913	1593866	3006715	portal,head,capsid,transposase,tRNA,terminase,integrase,holin,tail	Lactobacillus_phage(36.11%)	99	1526697:1526756	1561309:1561469
WP_005685893.1|1493913_1495212_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	28.2	2.9e-50
WP_005685894.1|1495235_1496411_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005685895.1|1496463_1496955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569663.1|1497032_1497215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685896.1|1497229_1500031_-	DNA helicase	NA	A0A1X9I5C8	Streptococcus_phage	33.3	1.1e-54
WP_005685897.1|1500074_1503785_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.2	6.4e-18
WP_005685898.1|1503781_1507321_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_005685900.1|1507735_1508671_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_005685903.1|1508678_1509683_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_005685905.1|1509648_1510683_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_014569664.1|1510789_1512121_-	23S rRNA methyltransferase	NA	NA	NA	NA	NA
WP_005685909.1|1512107_1513064_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015764955.1|1513060_1513243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685911.1|1513265_1514009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685914.1|1514124_1514475_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_151433393.1|1514508_1514697_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_014569665.1|1514904_1515039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685919.1|1515154_1516660_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005685921.1|1516625_1518356_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.3	1.5e-06
WP_005685922.1|1518730_1519525_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_005685924.1|1519511_1520222_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005685926.1|1520410_1521661_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	1.1e-38
WP_005685928.1|1521674_1523444_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.4	8.2e-56
WP_014569666.1|1523629_1525699_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005685932.1|1525700_1526597_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
1526697:1526756	attL	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTC	NA	NA	NA	NA
WP_014569667.1|1527002_1528172_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.8	2.6e-42
WP_029943783.1|1528214_1528541_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087307815.1|1528647_1528830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569668.1|1529376_1529763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569669.1|1529953_1531108_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	66.2	9.9e-143
WP_014569670.1|1531110_1531443_-|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	2.0e-32
WP_003579629.1|1531455_1531689_-	hypothetical protein	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	2.6e-34
WP_005689480.1|1531713_1531845_-	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.7	4.2e-18
WP_014569672.1|1531837_1532161_-	hypothetical protein	NA	B4XYQ6	Lactobacillus_phage	99.1	5.0e-52
WP_014569673.1|1532170_1535104_-|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	68.7	1.1e-311
WP_014569674.1|1535109_1537167_-|tail	tail protein	tail	Q6J1X4	Lactobacillus_phage	48.1	1.3e-153
WP_015764958.1|1537167_1541334_-|tail	tail protein	tail	A8YQJ9	Lactobacillus_phage	79.4	0.0e+00
WP_021354705.1|1541339_1541570_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	5.0e-38
WP_014569677.1|1541547_1541898_-|tail	tail protein	tail	Q6J1X6	Lactobacillus_phage	95.7	2.2e-53
WP_014569678.1|1542052_1542688_-|tail	tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	89.6	9.1e-98
WP_015764960.1|1542688_1543069_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.9	9.0e-61
WP_014569680.1|1543065_1543485_-	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.6	1.9e-64
WP_029943782.1|1543487_1543832_-|head	phage head closure protein	head	A8YQJ4	Lactobacillus_phage	85.8	1.1e-49
WP_014569682.1|1543821_1544112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569683.1|1544183_1546112_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	46.1	1.2e-68
WP_015764961.1|1546111_1547212_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	43.6	9.6e-79
WP_029943780.1|1547208_1547391_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_014569685.1|1547514_1549407_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.0	3.5e-153
WP_014569686.1|1549400_1549865_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	39.7	3.1e-23
WP_015764963.1|1550346_1550907_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.2	2.5e-35
WP_107755075.1|1551139_1551316_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569687.1|1551312_1552062_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014569018.1|1552127_1553624_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569688.1|1554280_1554559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764964.1|1554551_1554992_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	54.0	9.3e-25
WP_015764965.1|1555090_1555495_-	single-stranded DNA-binding protein	NA	L0P8Q2	Lactobacillus_phage	40.0	1.4e-14
WP_014569689.1|1555481_1556249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764966.1|1556249_1556456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080503223.1|1556516_1557119_-	hypothetical protein	NA	M1NMU3	Moumouvirus	33.8	5.9e-14
WP_014569690.1|1557504_1558743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029944087.1|1558781_1559009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685933.1|1561587_1562115_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1561309:1561469	attR	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTCGAAAACGCCAATCACATTCACCACCATCAGGCTTACACTATCCCTGACTCGCTTGGGTTTGGTACAAATGCGACCCTTTTTCTCATCACCGATTCAATTTC	NA	NA	NA	NA
WP_005685935.1|1562211_1562841_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_005685938.1|1562837_1563551_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.7e-12
WP_005687657.1|1564205_1564517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687658.1|1564667_1565483_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_005687659.1|1565482_1566385_-	GTPase Era	NA	NA	NA	NA	NA
WP_005713928.1|1566381_1566771_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_005687661.1|1566774_1567173_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_005687662.1|1567156_1567615_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_005687663.1|1567618_1568605_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	45.2	3.2e-49
WP_005689529.1|1569171_1569615_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	39.0	9.7e-14
WP_005687665.1|1569633_1569810_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005687666.1|1570082_1570913_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_005687667.1|1570909_1571797_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	27.0	2.1e-20
WP_005687668.1|1571944_1572865_-	YitT family protein	NA	NA	NA	NA	NA
WP_005687669.1|1573169_1573616_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_005687670.1|1573701_1575507_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014569692.1|1575508_1576792_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_080503224.1|1576895_1577117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687672.1|1577345_1578854_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005687673.1|1578850_1579726_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	5.4e-24
WP_005687674.1|1579925_1580372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687675.1|1580459_1581782_+	SH3 domain-containing protein	NA	J9PV86	Bacillus_phage	30.2	3.0e-10
WP_005687676.1|1581883_1582510_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_005687677.1|1582509_1582956_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_005687678.1|1583082_1585308_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.1	3.1e-07
WP_005687679.1|1585612_1585936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569694.1|1585973_1586702_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005687681.1|1586740_1587685_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005687682.1|1587765_1588260_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_005687683.1|1588256_1588862_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_005687684.1|1588967_1589216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687685.1|1589284_1589671_-	YxeA family protein	NA	NA	NA	NA	NA
WP_005687686.1|1589955_1590135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687687.1|1590134_1590521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687688.1|1590938_1591529_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
WP_005687689.1|1591531_1592089_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569018.1|1592369_1593866_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP044506	Lactobacillus rhamnosus strain BIO6870 chromosome, complete genome	3006715	2104815	2111688	3006715		Lactococcus_phage(33.33%)	9	NA	NA
WP_014569868.1|2104815_2105745_-	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	38.1	4.5e-53
WP_101495023.1|2105756_2106083_-	hypothetical protein	NA	Q9AZG1	Lactococcus_phage	39.6	4.8e-10
WP_005715269.1|2106376_2106877_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	29.3	4.7e-09
WP_014569870.1|2106993_2107707_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_005712952.1|2107703_2107928_-	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	40.4	4.3e-10
WP_005686244.1|2108208_2108520_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569871.1|2108767_2109406_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_005692769.1|2109650_2110634_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	33.0	1.7e-10
WP_005692768.1|2110635_2111688_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-20
>prophage 5
NZ_CP044506	Lactobacillus rhamnosus strain BIO6870 chromosome, complete genome	3006715	2403453	2466523	3006715	protease,bacteriocin	Bacillus_phage(30.0%)	60	NA	NA
WP_014570039.1|2403453_2404284_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014570040.1|2404297_2405314_-	membrane protein	NA	NA	NA	NA	NA
WP_014570041.1|2405310_2405697_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014570042.1|2405828_2407457_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015765046.1|2407954_2409271_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005686113.1|2410371_2411487_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_014570045.1|2411507_2412872_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005686110.1|2412891_2413431_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	4.4e-37
WP_076638839.1|2413570_2413696_-	acetyltransferase	NA	NA	NA	NA	NA
WP_014570046.1|2413692_2413875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570047.1|2414071_2414362_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014570048.1|2414656_2415976_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	2.3e-63
WP_005714538.1|2416120_2417467_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.5	1.3e-72
WP_014570049.1|2417683_2418784_+	ABC transporter	NA	NA	NA	NA	NA
WP_015765048.1|2418783_2419977_+	ABC transporter	NA	NA	NA	NA	NA
WP_005686102.1|2419990_2420866_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.1e-12
WP_014570051.1|2421017_2423072_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	32.9	2.1e-63
WP_014570052.1|2423278_2425909_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.9	2.8e-84
WP_076638835.1|2426208_2426796_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005692313.1|2426967_2427639_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014570054.1|2427796_2428915_+	bacitracin ABC transporter permease	NA	NA	NA	NA	NA
WP_005686095.1|2428933_2429218_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_014570055.1|2429463_2430579_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_005686092.1|2430741_2430951_-	CsbD family protein	NA	NA	NA	NA	NA
WP_014570056.1|2431516_2431705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570057.1|2431716_2431914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686089.1|2432708_2432966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686086.1|2433155_2433362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570058.1|2433590_2433806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764702.1|2434375_2435608_+	MFS transporter	NA	NA	NA	NA	NA
WP_014570059.1|2435677_2436934_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	6.0e-109
WP_005698939.1|2437014_2437851_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.9	7.4e-47
WP_005692296.1|2438299_2438485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570061.1|2439061_2439604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570062.1|2439833_2440658_-	class C sortase	NA	NA	NA	NA	NA
WP_014570063.1|2440664_2442218_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_014570064.1|2442208_2443564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080503225.1|2443565_2446496_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014570066.1|2446791_2447349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570067.1|2447517_2448726_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_014570068.1|2448918_2449974_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_014570069.1|2450266_2450914_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	38.7	2.2e-06
WP_005687855.1|2451044_2451377_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014570070.1|2451373_2452159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570071.1|2452202_2452979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570072.1|2453006_2453297_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_048653151.1|2453424_2454507_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014570074.1|2454532_2454715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005711099.1|2454809_2456165_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005692253.1|2456341_2456752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570076.1|2456812_2458192_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_014570077.1|2458204_2460397_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	3.6e-37
WP_005692249.1|2460645_2460780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570078.1|2460955_2462269_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_014570079.1|2462261_2463050_+	LytR domain-containing response regulator	NA	NA	NA	NA	NA
WP_076638842.1|2463786_2463972_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005711116.1|2464688_2464871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005716468.1|2465393_2465639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570081.1|2465888_2466188_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005686855.1|2466364_2466523_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP044506	Lactobacillus rhamnosus strain BIO6870 chromosome, complete genome	3006715	2930424	2957842	3006715	portal,capsid,transposase,terminase,integrase	Lactobacillus_phage(22.22%)	32	2945557:2945577	2959686:2959706
WP_107755086.1|2930424_2931318_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	1.9e-37
WP_005685752.1|2931511_2932906_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_029944068.1|2933052_2933628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685750.1|2933741_2934161_-	YjdF family protein	NA	NA	NA	NA	NA
WP_005685749.1|2934444_2934735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685748.1|2934828_2935077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570217.1|2936523_2937849_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	52.9	2.1e-16
WP_014570218.1|2937995_2939531_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005685744.1|2939527_2940217_+	response regulator	NA	NA	NA	NA	NA
WP_005685743.1|2940402_2940918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685741.1|2941166_2941559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570220.1|2941791_2942646_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087307847.1|2942968_2943355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685738.1|2943539_2944220_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_005685737.1|2944398_2945328_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
2945557:2945577	attL	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_014570221.1|2945674_2946832_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
WP_014570222.1|2946949_2947561_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029944073.1|2947675_2947888_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570223.1|2947912_2948188_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570224.1|2948255_2948477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570225.1|2948587_2948779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570226.1|2948823_2949096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015765113.1|2949092_2949281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570227.1|2949264_2950092_+	DNA replication protein	NA	Q854C1	Mycobacterium_phage	34.9	4.5e-12
WP_014570228.1|2950084_2951509_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	6.6e-64
WP_014570229.1|2951788_2952211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015764285.1|2952241_2952667_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	40.5	7.1e-14
WP_014570231.1|2952791_2953262_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_014570232.1|2953258_2954962_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.6	5.4e-121
WP_015765114.1|2954927_2955107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570233.1|2955111_2956296_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.4	2.4e-59
WP_014570234.1|2956282_2957842_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	29.8	3.3e-32
2959686:2959706	attR	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
