The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	662863	671229	4126713		Synechococcus_phage(50.0%)	8	NA	NA
WP_015715438.1|662863_664159_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	4.5e-19
WP_029726599.1|664232_664958_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003219409.1|664950_665205_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_029726600.1|665201_665885_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_029726601.1|665868_668097_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	7.2e-158
WP_003233947.1|668072_669503_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_003233945.1|669604_670645_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_015252651.1|670641_671229_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 2
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	1160634	1204832	4126713	coat,tRNA	Planktothrix_phage(25.0%)	50	NA	NA
WP_003232972.1|1160634_1160874_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|1161038_1161977_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|1161999_1163241_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003232967.1|1163316_1164102_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|1164293_1165280_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|1165276_1166266_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_003245082.1|1166353_1167985_+	oligopeptide-binding protein AppA	NA	NA	NA	NA	NA
WP_003245828.1|1168060_1169011_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_003232961.1|1169027_1169939_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|1170143_1170896_+	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|1170930_1171923_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003232957.1|1172666_1174304_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|1174411_1175347_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|1175350_1176268_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_014906294.1|1176272_1177349_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1177350_1178268_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_010886478.1|1178374_1179592_+	MFS transporter	NA	NA	NA	NA	NA
WP_003244921.1|1179755_1180334_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003245483.1|1180514_1180910_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003232944.1|1180952_1181609_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_121572562.1|1181778_1181919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015383354.1|1181885_1182542_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_029726275.1|1182701_1183853_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_009967010.1|1183899_1185912_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1185949_1186117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032678802.1|1186212_1186413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|1186431_1187331_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1187327_1187726_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_072692654.1|1187980_1188526_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	60.4	3.7e-39
WP_014479452.1|1188729_1189302_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_038427600.1|1189426_1189795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1189823_1190459_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1190477_1191278_+	NAD kinase	NA	NA	NA	NA	NA
WP_010886481.1|1191340_1192192_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003244765.1|1192204_1192939_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	25.0	3.2e-06
WP_003232910.1|1193173_1195018_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003232909.1|1195266_1195977_+	thiaminase II	NA	NA	NA	NA	NA
WP_003232908.1|1195951_1196569_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_029726273.1|1196552_1197662_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072173897.1|1197661_1197862_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003232902.1|1197858_1198629_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003232900.1|1198625_1199636_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014479462.1|1199654_1200470_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1200605_1201382_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_072692635.1|1201482_1202166_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|1202258_1202708_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|1202835_1203324_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_015252341.1|1203475_1203988_-|coat	Spore coat protein X	coat	NA	NA	NA	NA
WP_015252340.1|1204082_1204406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726269.1|1204445_1204832_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	1269225	1301877	4126713	terminase,portal,plate	Bacillus_phage(29.63%)	40	NA	NA
WP_003245490.1|1269225_1270497_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_010886491.1|1270641_1271778_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	8.3e-94
WP_003245487.1|1271767_1271902_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_003232731.1|1271932_1272190_-	YciI family protein	NA	NA	NA	NA	NA
WP_003244876.1|1272310_1273264_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	74.1	7.3e-67
WP_003245254.1|1273303_1273681_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	6.1e-17
WP_003244789.1|1273786_1274389_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245071.1|1274465_1275302_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|1275345_1275942_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1276104_1276446_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|1276623_1276803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245799.1|1276789_1277626_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_010886492.1|1277525_1278326_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003245588.1|1278325_1278493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245290.1|1278577_1278928_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_109789043.1|1278931_1279126_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_003245797.1|1279246_1279756_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
WP_003244697.1|1279871_1280669_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_151433385.1|1280665_1281967_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	2.6e-152
WP_003245427.1|1281970_1283458_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003245836.1|1283477_1284305_+	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_003232690.1|1284330_1285266_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|1285287_1285671_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|1285667_1286024_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_003245226.1|1286020_1286506_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_029726235.1|1286518_1286959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232679.1|1286962_1287181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245369.1|1287177_1288578_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232677.1|1288579_1289023_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_015715734.1|1289113_1289560_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.7	5.9e-11
WP_072692631.1|1289601_1289742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046664098.1|1289742_1294824_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	1.1e-41
WP_029727048.1|1294816_1295476_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
WP_003245730.1|1295491_1296469_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_015715735.1|1296468_1296735_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_015715736.1|1296792_1297218_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	6.6e-12
WP_015715737.1|1297210_1298257_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	2.4e-71
WP_015483131.1|1298240_1298819_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	5.1e-15
WP_015715738.1|1298815_1299088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727046.1|1301550_1301877_+|portal	phage portal protein	portal	NA	NA	NA	NA
>prophage 4
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	1814509	1902606	4126713	capsid,holin,tail,terminase,integrase,head,protease,tRNA,portal,plate	Bacillus_phage(62.96%)	98	1832838:1832897	1876201:1876298
WP_029726462.1|1814509_1815838_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.2	1.6e-27
WP_014476869.1|1816062_1816296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245758.1|1816575_1817283_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_003245175.1|1817352_1817805_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003245163.1|1817818_1818172_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_009967307.1|1818185_1818503_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_029317825.1|1818638_1818914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231769.1|1819002_1819416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726461.1|1819515_1820460_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|1820499_1820721_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014479841.1|1820916_1821189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|1821270_1821501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|1821743_1822136_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1822095_1824198_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1824215_1825205_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1825254_1825875_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014476879.1|1825938_1826706_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	5.3e-52
WP_003231746.1|1827338_1828307_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_015483254.1|1828439_1829702_+	GTPase HflX	NA	NA	NA	NA	NA
WP_029726458.1|1829719_1830985_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|1831094_1831502_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_015252037.1|1831560_1832895_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
1832838:1832897	attL	TATGTTCCGCACACAAGTTCATCCTTGGGAGCGCGAACAGTATATGTCTCAGTATTAATC	NA	NA	NA	NA
WP_072692613.1|1833007_1834162_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	9.1e-64
WP_072692612.1|1834174_1835233_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JAE0	uncultured_Caudovirales_phage	33.3	2.2e-11
WP_072692611.1|1835229_1835571_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.0	1.6e-08
WP_059335915.1|1835666_1835903_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_128992114.1|1836009_1836771_+	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	44.7	1.8e-44
WP_072692610.1|1836785_1837097_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072692609.1|1837115_1837355_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	55.3	6.8e-06
WP_072692608.1|1837351_1837627_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	45.3	6.8e-18
WP_072692607.1|1837616_1837844_+	hypothetical protein	NA	D6R417	Bacillus_phage	87.5	9.3e-05
WP_072692606.1|1837942_1838497_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	95.7	1.2e-93
WP_072692605.1|1838500_1839439_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	92.6	4.1e-163
WP_072692604.1|1839428_1839626_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	85.4	1.4e-17
WP_072692603.1|1839650_1840091_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	96.6	2.1e-77
WP_072692602.1|1840151_1842569_+	DNA primase	NA	D6R422	Bacillus_phage	89.1	0.0e+00
WP_072693002.1|1842767_1843205_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
WP_072693003.1|1843201_1843741_+	nuclease	NA	Q9ZXC2	Bacillus_phage	96.1	2.0e-93
WP_072693005.1|1844466_1844664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072693006.1|1844670_1844856_+	hypothetical protein	NA	M4ZR07	Bacillus_phage	50.0	1.7e-09
WP_072693007.1|1844855_1845218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072693008.1|1845214_1845616_+	hypothetical protein	NA	M4ZR14	Bacillus_phage	92.5	2.8e-60
WP_072693009.1|1845628_1845835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072693035.1|1845920_1846334_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	99.2	1.2e-63
WP_072693010.1|1846778_1847294_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072693011.1|1847418_1847733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072693012.1|1847785_1848046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072693013.1|1848105_1848471_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	5.1e-29
WP_019846969.1|1848698_1849214_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
WP_072693015.1|1849210_1850920_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	1.1e-206
WP_072693016.1|1851108_1852389_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	64.3	4.3e-155
WP_072693017.1|1852351_1852978_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	75.4	3.8e-80
WP_072693018.1|1853016_1854312_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.1	2.3e-92
WP_068947596.1|1854335_1854797_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.9	1.8e-10
WP_041057207.1|1854814_1855117_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	2.1e-12
WP_072693019.1|1855106_1855421_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	4.9e-12
WP_041057201.1|1855420_1855819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041057199.1|1855815_1856208_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_072693020.1|1856222_1856834_+|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.6e-11
WP_072693021.1|1856900_1857278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072693022.1|1857477_1861965_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	2.0e-66
WP_072693023.1|1861958_1862798_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	59.0	8.9e-93
WP_072693024.1|1862812_1864516_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.6	1.9e-179
WP_072693025.1|1864567_1866466_+	teichoic acid biosynthesis protein	NA	A0A185AMX0	Staphylococcus_phage	32.5	3.3e-42
WP_072693026.1|1866481_1866790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128471876.1|1866972_1868556_+|plate	phage baseplate upper protein	plate	A0A1P8CWR7	Bacillus_phage	48.0	2.8e-63
WP_072693028.1|1868569_1868938_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	48.4	2.0e-17
WP_072693029.1|1868937_1869111_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	73.7	5.6e-18
WP_031600555.1|1869162_1869375_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_069837321.1|1869389_1869653_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.1e-24
WP_072693030.1|1869707_1870685_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.2	2.4e-65
WP_038427712.1|1870725_1871025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072693032.1|1871031_1872879_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	5.1e-125
WP_128992116.1|1874503_1874692_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	55.0	2.9e-12
WP_072693034.1|1874888_1875926_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_029726456.1|1877869_1878091_+	hypothetical protein	NA	A0A0U4B0C8	Bacillus_phage	50.0	1.6e-09
1876201:1876298	attR	TATGTTCCGCACACAAGTTCATCCTTGGGAGCGCGAACAGTATATGTCTCAGTATTAATCTTTCAACCCCTTGGCACTATTGGTGTCAGGGGATTTTT	NA	NA	NA	NA
WP_029726455.1|1878170_1878968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726454.1|1879152_1879905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726453.1|1879997_1880444_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.2	1.6e-37
WP_029726452.1|1880506_1881304_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	25.3	3.5e-06
WP_029726451.1|1881520_1881937_-	pilus assembly protein HicB	NA	D6R430	Bacillus_phage	89.1	2.9e-68
WP_029726450.1|1882008_1882191_-	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	78.3	5.7e-21
WP_029726449.1|1882363_1882729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726448.1|1882876_1883581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053581880.1|1883772_1884195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072693039.1|1884661_1885027_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	3.3e-28
WP_029726445.1|1885255_1885771_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	42.8	1.1e-32
WP_029726443.1|1886301_1886481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726442.1|1886539_1887394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726441.1|1888553_1888844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726440.1|1889082_1889571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947603.1|1890603_1895949_+	S-layer family protein	NA	NA	NA	NA	NA
WP_029726887.1|1896052_1896724_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_029726888.1|1896720_1897428_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_029726889.1|1897414_1898521_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_051673223.1|1898517_1899894_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_029726893.1|1901088_1901625_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029726894.1|1901703_1902606_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	2074015	2081893	4126713		Bacillus_phage(71.43%)	12	NA	NA
WP_015714072.1|2074015_2076616_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.5	5.6e-45
WP_015714073.1|2077073_2077715_-	endo-1,4-beta-xylanase XynA	NA	NA	NA	NA	NA
WP_029727214.1|2078050_2078245_+	hypothetical protein	NA	O64196	Bacillus_phage	52.8	1.1e-06
WP_029727213.1|2078347_2078587_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	65.8	1.2e-18
WP_038427749.1|2078757_2079096_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	31.7	5.5e-09
WP_004399488.1|2079129_2079486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727212.1|2079587_2079872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029318060.1|2079905_2080235_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_029727211.1|2080713_2081025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727210.1|2081180_2081393_-	hypothetical protein	NA	O64089	Bacillus_phage	77.5	6.0e-22
WP_029727209.1|2081396_2081648_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	97.6	4.6e-37
WP_080282471.1|2081713_2081893_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.3	6.0e-23
>prophage 6
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	2308508	2314604	4126713		Staphylococcus_phage(66.67%)	8	NA	NA
WP_003223904.1|2308508_2309102_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_015714192.1|2309091_2309847_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	9.4e-09
WP_015251790.1|2310127_2310652_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2310665_2311040_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2311152_2311617_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_014480160.1|2311649_2312846_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_029726753.1|2312860_2313508_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_004398763.1|2313518_2314604_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
>prophage 7
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	2549945	2589150	4126713	capsid,holin,tail,terminase,portal,plate	uncultured_Caudovirales_phage(29.03%)	56	NA	NA
WP_068947614.1|2549945_2551541_+	type II toxin-antitoxin system toxin ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	60.5	6.5e-76
WP_009967790.1|2551555_2552134_+	type II toxin-antitoxin system antitoxin YqcF	NA	NA	NA	NA	NA
WP_009967791.1|2552251_2552398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229947.1|2552394_2552757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399085.1|2552772_2553252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697459.1|2553416_2554235_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.8	3.8e-64
WP_017697460.1|2554279_2554702_-|holin	holin family protein	holin	D6R405	Bacillus_phage	72.9	1.7e-47
WP_032722160.1|2554747_2555641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229944.1|2555728_2555893_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_009967793.1|2555889_2556225_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_032722161.1|2556234_2557335_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_032722163.1|2557338_2557611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722164.1|2557607_2558186_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.9e-14
WP_032722165.1|2558169_2559216_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	4.8e-72
WP_032722166.1|2559208_2559634_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	33.3	5.6e-11
WP_032722167.1|2559646_2559913_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_032722168.1|2559909_2560890_-	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	1.6e-40
WP_032722169.1|2560902_2561562_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	2.1e-25
WP_043940167.1|2561554_2566312_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.8e-44
WP_003229934.1|2566314_2566452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697468.1|2566493_2566943_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	40.2	5.9e-11
WP_106610765.1|2567099_2567186_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_017697469.1|2567444_2567888_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	2.5e-25
WP_017697470.1|2567890_2569291_-|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	39.3	4.8e-75
WP_033880532.1|2569291_2569483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697472.1|2569479_2569917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697473.1|2569929_2570433_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.5	1.7e-38
WP_017697474.1|2570429_2570792_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_017697475.1|2570788_2571184_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_068947615.1|2571188_2571500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947616.1|2571510_2572446_-|capsid	major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.4	8.6e-105
WP_068947617.1|2572464_2573439_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	56.6	6.3e-58
WP_040082428.1|2573595_2574501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947618.1|2574545_2575463_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.6	5.2e-54
WP_068947619.1|2575459_2576992_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	52.0	1.0e-147
WP_072692701.1|2576995_2578291_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.2	1.6e-154
WP_017697483.1|2578283_2579003_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	61.3	1.3e-60
WP_068947621.1|2579078_2579837_-	DNA-directed RNA polymerase	NA	NA	NA	NA	NA
WP_017697601.1|2579952_2580420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697600.1|2580563_2581019_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	73.5	3.1e-60
WP_017697599.1|2581109_2581868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697598.1|2582077_2582437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017697597.1|2582584_2582794_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.7	2.7e-19
WP_017697596.1|2582875_2583304_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	67.2	1.6e-42
WP_072692702.1|2583398_2583548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072692704.1|2583538_2584480_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	2.1e-58
WP_128992198.1|2584361_2585039_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	32.2	1.1e-05
WP_017697591.1|2585115_2585970_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	77.6	5.1e-120
WP_068947622.1|2585972_2586932_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	74.2	1.3e-135
WP_068947623.1|2587037_2587232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122060486.1|2587191_2587365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714340.1|2587361_2587619_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_068947624.1|2587615_2588185_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_003229902.1|2588258_2588399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947625.1|2588431_2588641_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021480133.1|2588796_2589150_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	48.6	8.0e-11
>prophage 8
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	2742648	2796087	4126713	coat,protease,tRNA	Faustovirus(14.29%)	51	NA	NA
WP_029727124.1|2742648_2743812_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_038427815.1|2743928_2745035_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_029318181.1|2745021_2745891_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_029727122.1|2745844_2747440_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_029727121.1|2747542_2748730_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|2748689_2749232_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_029727120.1|2749255_2750113_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2750129_2750573_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_029727119.1|2750633_2751920_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|2751953_2752532_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2752609_2752732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2752852_2753137_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2753149_2753488_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2753490_2753799_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004398649.1|2753945_2754812_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_029727118.1|2754804_2755599_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_004398624.1|2755747_2756554_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2756555_2757236_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2757288_2757807_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|2757803_2758676_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2758706_2759720_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_015251546.1|2759811_2760507_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004398496.1|2760543_2761113_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_038427816.1|2761265_2762261_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072692713.1|2762394_2763141_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_038427817.1|2763282_2764575_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_029727115.1|2764634_2767277_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	4.9e-161
WP_003222590.1|2767724_2767916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727114.1|2767934_2768960_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_029727113.1|2768992_2770720_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015384279.1|2770850_2772143_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_029727112.1|2772172_2773147_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_029727111.1|2773143_2773932_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_072692716.1|2773921_2774866_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2774898_2775729_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|2775736_2777104_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|2777333_2777831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|2777852_2778440_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_029726365.1|2778436_2780761_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_029726366.1|2780941_2782600_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2782753_2784016_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_015714466.1|2784287_2785562_-	trigger factor	NA	NA	NA	NA	NA
WP_029726367.1|2785789_2786794_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_029726368.1|2786912_2787512_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003229604.1|2787524_2788943_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004399139.1|2788992_2790090_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_038427818.1|2790110_2791667_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	38.5	1.3e-09
WP_029726371.1|2791653_2792682_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004399096.1|2792705_2793224_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_029726372.1|2793220_2794945_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.4	2.2e-61
WP_029726373.1|2795760_2796087_+|coat	inner spore coat protein CotQ	coat	NA	NA	NA	NA
>prophage 9
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	3358731	3366466	4126713	holin	Organic_Lake_phycodnavirus(50.0%)	9	NA	NA
WP_038427914.1|3358731_3359412_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_038427915.1|3359428_3360349_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3360360_3361014_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_038427916.1|3361030_3362176_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.3	6.0e-15
WP_014478002.1|3362459_3362993_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038427917.1|3363024_3363699_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_072692820.1|3363716_3364628_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038427919.1|3364647_3365301_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|3365323_3366466_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 10
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	3740217	3763730	4126713	protease,tRNA,bacteriocin	Staphylococcus_phage(66.67%)	27	NA	NA
WP_038427988.1|3740217_3741888_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|3741884_3742313_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3742625_3742757_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3742713_3742866_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_038427989.1|3742890_3744237_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3744249_3744411_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_029726076.1|3744407_3745127_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	5.6e-19
WP_038427990.1|3745119_3746430_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_072692833.1|3746419_3747580_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003227558.1|3747584_3748865_+	insulinase family protein	NA	NA	NA	NA	NA
WP_038427991.1|3748861_3749563_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_038427992.1|3749568_3750942_-	YncE family protein	NA	NA	NA	NA	NA
WP_038427993.1|3750984_3752340_-	YncE family protein	NA	NA	NA	NA	NA
WP_009968328.1|3752336_3752567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029318693.1|3752569_3753715_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.0	1.4e-77
WP_009968329.1|3753698_3753818_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_038427994.1|3754070_3754550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714893.1|3754698_3755487_+	membrane protein	NA	NA	NA	NA	NA
WP_015714894.1|3755473_3756148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427995.1|3756148_3756955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714896.1|3756957_3757605_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	7.7e-28
WP_015714897.1|3757597_3758158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227545.1|3758206_3759079_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3759139_3759970_-	spermidine synthase	NA	NA	NA	NA	NA
WP_038427996.1|3760170_3762246_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_015250981.1|3762538_3763057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|3763070_3763730_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 11
NZ_CP044498	Bacillus subtilis strain ms-2 chromosome, complete genome	4126713	3793342	3842371	4126713	coat,holin	Enterobacteria_phage(25.0%)	51	NA	NA
WP_014481242.1|3793342_3793798_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_015250965.1|3793790_3794642_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
WP_003244201.1|3794655_3795603_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_014478328.1|3795602_3796343_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_038428003.1|3796367_3797387_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_038428004.1|3797389_3798112_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_029726215.1|3798104_3799226_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_029726214.1|3799225_3800095_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481249.1|3800095_3801265_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
WP_029726213.1|3801285_3802710_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015250957.1|3802714_3803485_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_015714913.1|3803477_3803657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481253.1|3803804_3804350_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3804393_3804765_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_029726212.1|3804826_3806149_-	purine permease	NA	NA	NA	NA	NA
WP_029726211.1|3806168_3806486_-	YwdI family protein	NA	NA	NA	NA	NA
WP_029726210.1|3806653_3808024_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014478341.1|3808048_3808726_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_015250953.1|3808738_3809545_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014665830.1|3809735_3810551_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|3810641_3810890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726209.1|3810983_3812423_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.4	3.1e-21
WP_029726208.1|3812419_3813805_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481261.1|3814106_3814877_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227423.1|3814915_3815746_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|3815785_3816088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726207.1|3816617_3819038_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
WP_029726206.1|3819075_3820077_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014478349.1|3820250_3821000_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_015250943.1|3821106_3822288_-	cell shape-determining peptidoglycan glycosyltransferase RodA	NA	NA	NA	NA	NA
WP_003227411.1|3822784_3823048_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_003227410.1|3823089_3823464_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003227409.1|3823465_3824080_-	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
WP_003227407.1|3824093_3826043_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010886637.1|3826070_3827036_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_009968363.1|3827551_3827797_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_038428006.1|3827867_3829409_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_015250940.1|3829412_3830585_-	galactokinase	NA	NA	NA	NA	NA
WP_029726203.1|3830667_3831051_-	GtrA family protein	NA	NA	NA	NA	NA
WP_014478350.1|3831068_3831740_-	transcriptional regulator SlrC	NA	NA	NA	NA	NA
WP_003243648.1|3832094_3832253_+	transcriptional regulator SlrA	NA	NA	NA	NA	NA
WP_029726202.1|3832695_3833004_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_029726201.1|3833000_3834542_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_029726200.1|3834572_3835175_-	DsbA family protein	NA	NA	NA	NA	NA
WP_029318658.1|3835457_3836708_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_029726199.1|3836726_3837884_-	iron uptake system lipoprotein EfeM	NA	NA	NA	NA	NA
WP_029726198.1|3837880_3839326_-	ferrous ion permease EfeU	NA	NA	NA	NA	NA
WP_015250933.1|3839482_3840151_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_029726196.1|3840147_3840966_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_015250931.1|3840973_3841879_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227375.1|3841984_3842371_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
