The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044410	Escherichia coli strain ecMN1F chromosome, complete genome	4658503	955001	1003685	4658503	transposase,integrase	Streptococcus_phage(20.0%)	49	969487:969546	1003795:1003854
WP_000006255.1|955001_955499_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|955722_957462_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|957421_958192_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|958262_959318_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|959369_959663_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|959665_960064_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|960073_960526_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|960831_961098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|961030_961567_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|961623_963081_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|963341_963800_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|963891_965136_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|965193_965595_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|965633_966689_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|966976_968080_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|968091_969345_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
969487:969546	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|969916_970258_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|970278_970596_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|970614_970836_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|970844_971321_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|971336_971795_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|971892_972132_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|972208_972676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|972698_973142_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|973141_973369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|973772_974594_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|974685_975549_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|975877_976771_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|977191_978343_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|980689_981706_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|981913_983317_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|983303_984236_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|984344_985391_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|986612_986951_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|986973_987324_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|987417_988572_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|988866_989775_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|989789_991757_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|991983_993366_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|993377_994988_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|994992_995751_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|995889_996894_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|998088_998820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|998910_999537_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|999808_1000507_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1000533_1001388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1001506_1001731_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1001727_1002168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1002284_1003685_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
1003795:1003854	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP044410	Escherichia coli strain ecMN1F chromosome, complete genome	4658503	1225722	1288681	4658503	integrase,lysis,terminase,tRNA,transposase,protease	Enterobacteria_phage(50.0%)	65	1271339:1271385	1292641:1292687
WP_001295836.1|1225722_1226346_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1226316_1227003_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1226999_1229414_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1229844_1234125_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1234164_1234533_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1235223_1235484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1236715_1237810_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1237878_1238805_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1239034_1239517_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1239594_1240410_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1240499_1242281_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1242293_1243070_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1243169_1244048_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1244216_1245671_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1245730_1247092_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1247148_1248450_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1248471_1249617_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1249844_1250630_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1250640_1251876_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1251897_1252947_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1253263_1254931_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1254940_1256200_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1256210_1257026_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1257022_1257916_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1258110_1259178_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1259174_1259684_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1259801_1260524_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1260526_1261021_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1261194_1262580_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1262615_1263137_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1263244_1263457_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1263458_1264325_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1264795_1265338_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1265557_1266250_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1266280_1268884_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1268862_1269903_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1269913_1270429_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1270431_1271064_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1271339:1271385	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1271398_1272562_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1272681_1272945_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1273267_1273363_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|1273425_1274587_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|1274898_1275231_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1275278_1275428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1275485_1277012_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1277476_1278028_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1278037_1278835_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1278951_1279053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1279049_1279505_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1279504_1279675_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1279667_1279958_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1279954_1280317_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1280313_1280454_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1280539_1280923_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1281320_1282337_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|1282341_1283409_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|1283981_1284197_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1284196_1284694_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1284910_1285093_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1285183_1285477_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1285767_1286178_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1286463_1286670_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1286834_1287029_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1287417_1287963_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1287937_1288681_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1292641:1292687	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP044410	Escherichia coli strain ecMN1F chromosome, complete genome	4658503	1899425	1920816	4658503	integrase,portal,tRNA,tail,plate	Shigella_phage(31.58%)	31	1891420:1891434	1927519:1927533
1891420:1891434	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1899425_1900532_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1900585_1901047_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1901056_1901710_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1901881_1903132_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1903625_1904291_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1904291_1904996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1905453_1906347_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1906437_1907565_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1907545_1907791_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1907827_1908139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1908255_1908597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1908534_1908843_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1909017_1909692_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1909782_1909983_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1910026_1910584_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1910759_1910939_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1910928_1912296_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1912307_1912490_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1912489_1912963_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1912889_1913681_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1913671_1914256_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554707.1|1914259_1915048_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000548498.1|1915047_1915650_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|1915621_1916035_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000905001.1|1916442_1916997_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1917103_1917937_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|1918170_1918335_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1918437_1918761_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1919296_1919407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1919459_1919864_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1920084_1920816_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1927519:1927533	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP044410	Escherichia coli strain ecMN1F chromosome, complete genome	4658503	2101633	2142450	4658503	integrase,lysis,tRNA,tail,transposase	Escherichia_phage(43.33%)	43	2102780:2102798	2133154:2133172
WP_010723085.1|2101633_2102650_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
2102780:2102798	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|2102922_2103180_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|2103229_2104180_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|2104331_2105084_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_000945011.1|2105278_2105794_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|2105804_2107331_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|2107367_2108813_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000444929.1|2108812_2110123_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_000885458.1|2110298_2111207_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|2111536_2112100_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|2112120_2113353_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2113607_2114591_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2115068_2116442_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2116570_2117506_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2117557_2118793_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2118794_2119010_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2119088_2119298_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2119290_2119485_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2119541_2120351_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2120343_2122944_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2123045_2123321_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2123395_2123566_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2123565_2123787_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2124228_2124717_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2124713_2124869_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|2124879_2125014_-	phage protein	NA	NA	NA	NA	NA
WP_000948459.1|2125322_2125799_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2125922_2126219_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2126241_2126664_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000788970.1|2127539_2128286_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2128308_2128869_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2128956_2129142_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2129338_2130796_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2130933_2131197_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2131177_2131537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2133302_2134283_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2133154:2133172	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|2134605_2137968_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|2137967_2138543_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2138640_2139231_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2139547_2139781_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2139849_2139963_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2140741_2141176_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2141316_2142450_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NZ_CP044410	Escherichia coli strain ecMN1F chromosome, complete genome	4658503	2335007	2354218	4658503	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2335007_2336468_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2336556_2337840_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2338444_2338558_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2338626_2338860_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|2339176_2339767_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2339864_2340440_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2340439_2341402_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2341352_2341922_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2342310_2342544_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2342601_2343012_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2343163_2343337_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2343508_2343664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2343742_2343808_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2343810_2343999_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2344009_2344222_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2344584_2345082_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2345078_2345612_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2345608_2345920_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2345924_2346140_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2346893_2347109_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2347409_2347622_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2347676_2347766_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2348043_2348796_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|2348809_2349859_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|2349860_2350139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2350205_2350457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2350673_2350829_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2350900_2351188_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2351187_2351427_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2351451_2351757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2351959_2352292_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2352728_2352878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2353174_2353405_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2353488_2353896_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2354062_2354218_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP044410	Escherichia coli strain ecMN1F chromosome, complete genome	4658503	2813197	2821868	4658503		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2813197_2814301_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2814308_2815556_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2815552_2816110_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2816109_2816991_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2817048_2817948_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2817947_2819033_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2819405_2820299_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2820473_2821868_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 7
NZ_CP044410	Escherichia coli strain ecMN1F chromosome, complete genome	4658503	3171266	3182476	4658503	integrase,tail	Enterobacteria_phage(50.0%)	17	3169241:3169257	3186151:3186167
3169241:3169257	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3171266_3172199_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3172510_3173668_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3173820_3174183_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3174179_3175100_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3175096_3176428_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3176462_3176744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3177042_3177483_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3177509_3178028_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3178077_3178353_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3178352_3178847_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3178843_3179212_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3179569_3179932_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3179997_3180822_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3180949_3181486_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3181476_3181839_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3181838_3182144_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3182275_3182476_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3186151:3186167	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP044410	Escherichia coli strain ecMN1F chromosome, complete genome	4658503	3563053	3570192	4658503		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3563053_3565615_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3565720_3566377_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|3566427_3567195_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|3567390_3568299_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3568295_3569462_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|3569553_3570192_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
