The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032669	Listeria monocytogenes strain 52869 chromosome, complete genome	2935335	93909	137912	2935335	terminase,plate,capsid,tail,holin,integrase,portal	Listeria_phage(95.16%)	67	94984:95028	135894:135938
WP_046335603.1|93909_94866_+	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.3	1.4e-30
94984:95028	attL	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
WP_023546303.1|95132_96335_-|integrase	site-specific integrase	integrase	A0A0B5CTW8	Listeria_phage	99.2	1.5e-221
WP_077411725.1|96429_96966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003737372.1|97014_97182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003734808.1|97339_97816_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	62.7	1.2e-41
WP_023546301.1|97971_98214_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010990191.1|98210_98477_+	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	98.9	1.2e-40
WP_003727744.1|98405_98636_-	hypothetical protein	NA	Q9T185	Listeria_phage	100.0	4.6e-36
WP_003727745.1|98701_98896_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	96.9	6.3e-26
WP_003733634.1|98907_99144_+	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_061728999.1|99140_99422_+	hypothetical protein	NA	A0A0B5CTX3	Listeria_phage	96.8	1.2e-38
WP_010990193.1|99607_99850_-	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	98.8	6.8e-38
WP_061729004.1|99913_100693_+	antirepressor	NA	A0A0B5CTU1	Listeria_phage	96.1	7.6e-139
WP_061729011.1|100817_101342_+	hypothetical protein	NA	A0A059T5F0	Listeria_phage	99.4	8.3e-89
WP_003731816.1|101348_101534_+	helix-turn-helix domain-containing protein	NA	A0A059T674	Listeria_phage	100.0	1.1e-27
WP_061385621.1|101549_101738_+	hypothetical protein	NA	A0A0B5CU43	Listeria_phage	96.8	5.0e-28
WP_077949712.1|101969_102929_+	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	99.1	1.8e-177
WP_012582380.1|102928_103744_+	recombinase RecT	NA	A0A0B5CTU3	Listeria_phage	99.3	5.9e-150
WP_150978822.1|103764_104679_+	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	90.8	1.6e-140
WP_003722560.1|104675_105488_+	DNA adenine methylase	NA	Q8W5X3	Listeria_phage	95.6	4.8e-152
WP_003722559.1|105484_106081_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	53.5	7.5e-54
WP_003722558.1|106083_106281_+	hypothetical protein	NA	A0A0B5CU49	Listeria_phage	95.4	2.0e-27
WP_003722557.1|106277_106721_+	hypothetical protein	NA	A8ASP1	Listeria_phage	87.1	2.1e-45
WP_003722556.1|106717_107188_+	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	89.7	2.9e-40
WP_003722555.1|107184_107646_+	hypothetical protein	NA	D9J0I6	Brochothrix_phage	35.9	6.7e-18
WP_003733878.1|107642_107822_+	hypothetical protein	NA	A0A076G7F4	Listeria_phage	87.3	8.1e-20
WP_003722552.1|107818_108301_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	98.8	2.0e-81
WP_009924219.1|108319_108502_+	hypothetical protein	NA	A8ASP6	Listeria_phage	77.8	1.4e-16
WP_010989958.1|108446_108851_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	85.8	1.2e-58
WP_009924217.1|108854_109238_+	DUF2481 domain-containing protein	NA	A0A0B5CYS3	Listeria_phage	97.6	2.0e-63
WP_003727776.1|109366_109531_+	hypothetical protein	NA	A8ASQ0	Listeria_phage	92.6	2.5e-20
WP_003735131.1|109549_109984_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
WP_003734122.1|110349_110889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989957.1|110934_111729_+|terminase	terminase	terminase	A8ASJ1	Listeria_phage	70.4	1.6e-11
WP_150978823.1|111697_113029_+|terminase	PBSX family phage terminase large subunit	terminase	Q9T1C1	Listeria_phage	97.7	1.3e-258
WP_009925050.1|113041_114811_+|portal	phage portal protein	portal	A8ASJ3	Listeria_phage	91.0	5.0e-263
WP_039381673.1|114811_115951_+	hypothetical protein	NA	A8ASJ4	Listeria_phage	96.0	1.3e-200
WP_009925047.1|116029_116599_+	scaffold protein	NA	A0A0B5CTV7	Listeria_phage	97.9	1.2e-80
WP_031645714.1|116622_117522_+|capsid	phage major capsid protein	capsid	Q9T1B7	Listeria_phage	99.7	1.0e-166
WP_009925045.1|117521_117680_+	hypothetical protein	NA	A8ASJ7	Listeria_phage	92.3	9.6e-17
WP_009925044.1|117681_118077_+	hypothetical protein	NA	A0A059T5E3	Listeria_phage	82.4	2.2e-54
WP_150978824.1|118076_118439_+|capsid	minor capsid protein	capsid	A0A059T658	Listeria_phage	94.2	9.5e-60
WP_029508830.1|118438_118777_+	hypothetical protein	NA	A0A0B5CTV8	Listeria_phage	95.5	5.4e-57
WP_003737937.1|118776_119184_+	hypothetical protein	NA	A8ASK1	Listeria_phage	99.3	2.0e-66
WP_009925981.1|119186_119621_+|tail	tail protein	tail	Q9T1B1	Listeria_phage	97.9	3.0e-76
WP_003727790.1|119550_119883_+	hypothetical protein	NA	Q9T1B0	Listeria_phage	99.1	1.8e-49
WP_003727791.1|119937_120360_+	hypothetical protein	NA	Q9T1A9	Listeria_phage	100.0	4.1e-70
WP_003722531.1|120365_120971_+	hypothetical protein	NA	Q9T1A8	Listeria_phage	100.0	1.3e-109
WP_150978825.1|120981_126345_+	tape measure protein	NA	A0A0B5CU25	Listeria_phage	85.7	0.0e+00
WP_061663756.1|126346_127165_+|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	97.1	2.0e-153
WP_150978826.1|127173_128199_+	hypothetical protein	NA	Q9T1A5	Listeria_phage	93.5	3.0e-191
WP_014931687.1|128199_129228_+	hypothetical protein	NA	Q9T1A4	Listeria_phage	98.8	2.1e-189
WP_014931686.1|129227_130301_+|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	96.9	7.4e-193
WP_003727798.1|130312_130630_+	hypothetical protein	NA	Q9T1A2	Listeria_phage	92.4	1.3e-49
WP_003734113.1|130634_130793_+	hypothetical protein	NA	Q9T1A1	Listeria_phage	98.1	3.0e-18
WP_003722523.1|130821_131187_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|131199_131481_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_150978827.1|131480_132326_+	M15 family peptidase	NA	A0A059T7Y8	Listeria_phage	93.6	1.7e-136
WP_010989943.1|132819_133371_+	hypothetical protein	NA	A8ASL6	Listeria_phage	95.6	7.4e-96
WP_009926666.1|133447_133945_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	97.6	1.8e-88
WP_031669445.1|133969_134419_-	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	99.3	6.9e-76
WP_003722517.1|134424_134796_-	anti-CRISPR protein AcrIIA2	NA	A0A059T5F6	Listeria_phage	92.7	5.3e-58
WP_009924649.1|134824_135058_-	hypothetical protein	NA	A8ATW9	Listeria_phage	48.1	9.2e-08
WP_077411716.1|135357_135591_+	hypothetical protein	NA	A8ATX0	Listeria_phage	98.7	7.3e-37
WP_015987062.1|135587_135794_+	hypothetical protein	NA	A8ASL9	Listeria_phage	100.0	1.8e-31
WP_014600363.1|136498_137287_+	hypothetical protein	NA	NA	NA	NA	NA
135894:135938	attR	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
WP_014600364.1|137288_137912_+	TIR domain-containing protein	NA	A0A0S2MYG4	Enterococcus_phage	32.8	5.5e-15
>prophage 2
NZ_CP032669	Listeria monocytogenes strain 52869 chromosome, complete genome	2935335	172903	179428	2935335	tail	Listeria_phage(33.33%)	10	NA	NA
WP_014601579.1|172903_173356_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	5.2e-31
WP_003721740.1|173361_173697_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|173913_174342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732220.1|174353_174770_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_046335627.1|175047_175437_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|175449_175962_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003740132.1|176009_176312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009911444.1|176353_176758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335629.1|176744_178613_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003721748.1|178609_179428_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	4.2e-39
>prophage 3
NZ_CP032669	Listeria monocytogenes strain 52869 chromosome, complete genome	2935335	1177456	1184879	2935335		Hokovirus(33.33%)	8	NA	NA
WP_003721506.1|1177456_1177840_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_014600722.1|1177861_1178845_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.3	3.1e-12
WP_046336022.1|1178859_1179873_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	4.6e-11
WP_003721509.1|1180081_1181572_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|1181583_1182408_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_023549061.1|1182420_1182729_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003732712.1|1182789_1183194_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_020246560.1|1183322_1184879_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 4
NZ_CP032669	Listeria monocytogenes strain 52869 chromosome, complete genome	2935335	1316414	1375854	2935335	tRNA,protease	Bacillus_virus(16.67%)	59	NA	NA
WP_031671806.1|1316414_1317554_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_031645072.1|1317634_1318030_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1318180_1318396_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1318514_1319048_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1319065_1319731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1319992_1320931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1321045_1322329_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1322514_1323774_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_014601954.1|1323892_1324459_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_009924619.1|1324493_1325063_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1325164_1325707_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1325716_1326580_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1326576_1327362_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1327495_1328356_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003732799.1|1328627_1330706_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_003723999.1|1330768_1332073_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1332355_1333258_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1333278_1333818_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_031645070.1|1333831_1335241_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	1.7e-43
WP_003726695.1|1335261_1336041_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003732801.1|1336017_1336212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003724129.1|1336143_1336563_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003724130.1|1336584_1336896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932949.1|1336898_1337771_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724132.1|1337812_1338409_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003732802.1|1338566_1338974_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003723731.1|1339154_1341122_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	6.7e-123
WP_010989723.1|1341118_1343578_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	4.7e-102
WP_009913867.1|1343660_1344128_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_012951574.1|1344454_1346188_+	LapB repeat-containing protein	NA	NA	NA	NA	NA
WP_012951575.1|1346519_1348316_+	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_012951576.1|1348349_1350218_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	31.9	6.5e-43
WP_009925395.1|1350430_1351129_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	9.9e-13
WP_046335985.1|1351361_1353038_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_012951578.1|1353163_1354081_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003719566.1|1354203_1354437_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_022741839.1|1354547_1355771_+	GTPase HflX	NA	NA	NA	NA	NA
WP_010989728.1|1355763_1356990_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003719570.1|1357193_1357562_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723435.1|1357632_1358967_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003723436.1|1359110_1360406_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	61.6	1.8e-145
WP_003723437.1|1360449_1360971_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003723438.1|1361000_1361615_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003723439.1|1361771_1362101_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_014601966.1|1362192_1362420_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_031645059.1|1362566_1364561_+	transketolase	NA	NA	NA	NA	NA
WP_003723442.1|1364781_1365021_+	YneF family protein	NA	NA	NA	NA	NA
WP_010989731.1|1365071_1365914_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_046335982.1|1365932_1366664_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.7	3.4e-80
WP_003723445.1|1366685_1367192_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	4.0e-56
WP_003723446.1|1367201_1368506_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	9.5e-134
WP_072217143.1|1368495_1369701_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	47.1	3.7e-92
WP_003723448.1|1369678_1370053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|1370345_1371074_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|1371073_1371631_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003732812.1|1371860_1372619_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003732813.1|1372632_1373421_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010989733.1|1373435_1374578_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003723454.1|1374591_1375854_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 5
NZ_CP032669	Listeria monocytogenes strain 52869 chromosome, complete genome	2935335	1870062	1878348	2935335		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1870062_1870629_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_009933235.1|1870625_1871675_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.2	1.0e-61
WP_010989807.1|1871693_1873121_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.9	8.1e-54
WP_046335569.1|1873105_1875325_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	1.5e-160
WP_003733240.1|1875317_1876001_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015454911.1|1876004_1876250_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_010989809.1|1876261_1876975_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.3e-41
WP_003733238.1|1877055_1878348_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	7.2e-17
>prophage 6
NZ_CP032669	Listeria monocytogenes strain 52869 chromosome, complete genome	2935335	2541091	2548935	2935335		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2541091_2542063_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_046336559.1|2542070_2543039_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	1.1e-67
WP_010990001.1|2543040_2543916_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
WP_150978855.1|2544023_2545754_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	2.1e-173
WP_077286972.1|2545795_2546857_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009924988.1|2546873_2547857_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	2.6e-51
WP_003722610.1|2547975_2548935_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NZ_CP032669	Listeria monocytogenes strain 52869 chromosome, complete genome	2935335	2827782	2837814	2935335		Tupanvirus(33.33%)	8	NA	NA
WP_026750054.1|2827782_2829936_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	1.3e-42
WP_003732117.1|2829959_2831732_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_003722118.1|2831892_2833359_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_003739952.1|2833382_2833517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026750053.1|2833646_2834177_-	ADP-ribose-binding protein	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	44.4	2.2e-28
WP_046335726.1|2834234_2835845_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.3e-47
WP_072215787.1|2836023_2836332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009924391.1|2836359_2837814_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
