The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043311	Pseudomonas sp. PE08 chromosome, complete genome	6056953	2241176	2278595	6056953	head,terminase,integrase,capsid,portal	Pseudomonas_phage(42.86%)	57	2242065:2242081	2288538:2288554
WP_151133147.1|2241176_2242766_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.8	3.2e-59
2242065:2242081	attL	CGGGAACAGGCGCAGCT	NA	NA	NA	NA
WP_151133148.1|2242786_2243980_-|integrase	tyrosine-type recombinase/integrase	integrase	J7HXC4	Pseudomonas_phage	61.3	4.9e-129
WP_151133149.1|2244191_2244377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151133150.1|2244431_2244662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151133151.1|2244658_2244958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151133152.1|2244950_2245514_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	51.9	4.7e-13
WP_151133153.1|2245510_2245708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151133154.1|2245704_2246010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151133155.1|2246006_2246342_-	DUF4406 domain-containing protein	NA	A0A2K8I958	Pseudomonas_phage	59.2	5.8e-27
WP_151133156.1|2246338_2246809_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_151133157.1|2247006_2247270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133158.1|2247373_2247742_-	hypothetical protein	NA	B5WZW7	Pseudomonas_phage	70.7	1.7e-43
WP_151133159.1|2247794_2248556_+	hypothetical protein	NA	K4NXB8	Burkholderia_phage	32.1	5.4e-12
WP_151133160.1|2249037_2249286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133161.1|2249303_2250227_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_151133162.1|2250339_2250687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133163.1|2250733_2251612_-	hypothetical protein	NA	A0A2H4J418	uncultured_Caudovirales_phage	54.3	3.3e-90
WP_151133164.1|2251897_2252395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133165.1|2252509_2253199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133166.1|2253222_2253438_-	hypothetical protein	NA	A0A0U1UNR9	Pseudomonas_phage	57.8	1.1e-10
WP_151133167.1|2253760_2254312_-	hypothetical protein	NA	A0A1B0VMB1	Pseudomonas_phage	34.7	5.6e-19
WP_151133168.1|2255419_2255689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151133169.1|2256091_2256340_-	DUF1654 domain-containing protein	NA	A0A0H5ARP1	Pseudomonas_phage	42.9	1.4e-09
WP_151133170.1|2256460_2256703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133171.1|2256755_2257148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151133172.1|2257132_2257312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151138732.1|2257518_2257932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151133173.1|2258043_2258697_-	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	46.5	8.9e-40
WP_151133174.1|2258805_2259003_+	Cro/Cl family transcriptional regulator	NA	M4R204	Salicola_phage	55.6	3.2e-09
WP_151133175.1|2259139_2259358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151133176.1|2259432_2260044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133177.1|2260102_2260843_+	DNA-binding protein	NA	A0A0U4J8Z7	Pseudomonas_phage	46.8	1.7e-47
WP_151133178.1|2260839_2261670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151138734.1|2261642_2262344_+	replication P family protein	NA	A0A1B0YZY6	Pseudomonas_phage	42.5	4.1e-43
WP_151133179.1|2262343_2262841_+	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	70.3	1.0e-56
WP_151133180.1|2262849_2263077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151138736.1|2263076_2263433_+	recombinase	NA	NA	NA	NA	NA
WP_151133181.1|2263429_2264410_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	39.7	2.6e-59
WP_151133182.1|2264460_2264841_+	endodeoxyribonuclease RusA	NA	A0A088F6Y8	Sulfitobacter_phage	42.9	5.0e-11
WP_151133183.1|2264840_2265152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133184.1|2265166_2265745_+	hypothetical protein	NA	A0A0U4KL14	Pseudomonas_phage	65.1	2.9e-66
WP_151138738.1|2266733_2267012_+	hypothetical protein	NA	W6MYB2	Pseudomonas_phage	49.3	1.6e-11
WP_151133185.1|2267200_2267722_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	39.4	1.1e-21
WP_151133186.1|2267702_2269811_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	46.7	3.4e-181
WP_151133187.1|2269810_2270041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133188.1|2270040_2271492_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	38.9	3.4e-84
WP_151133189.1|2271538_2272939_+	S49 family peptidase	NA	A4JX00	Burkholderia_virus	36.0	5.2e-37
WP_151133190.1|2272944_2273307_+|head	head decoration protein	head	R9TP46	Rhizobium_phage	43.5	7.9e-14
WP_151133191.1|2273345_2274338_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	48.8	7.1e-81
WP_151133192.1|2274337_2274670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133193.1|2274666_2275284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133194.1|2275280_2275748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133195.1|2275752_2275947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151133196.1|2275939_2276683_+	hypothetical protein	NA	A0A0M4U7A4	Ralstonia_phage	30.6	7.5e-11
WP_151133197.1|2276719_2277187_-	helix-turn-helix domain-containing protein	NA	A0A2H4JA00	uncultured_Caudovirales_phage	35.1	9.5e-12
WP_151133198.1|2277373_2277529_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_151133199.1|2277602_2278595_+	hypothetical protein	NA	G9L6D8	Escherichia_phage	45.5	8.1e-61
2288538:2288554	attR	AGCTGCGCCTGTTCCCG	NA	NA	NA	NA
>prophage 2
NZ_CP043311	Pseudomonas sp. PE08 chromosome, complete genome	6056953	3289457	3345975	6056953	head,terminase,plate,tail,holin,integrase,capsid,protease,portal,lysis,tRNA	uncultured_Caudovirales_phage(53.33%)	66	3288069:3288098	3328594:3328623
3288069:3288098	attL	AGATGGCGGAGGCGGTGAGATTCGAACTCA	NA	NA	NA	NA
WP_151133995.1|3289457_3290441_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	79.6	1.3e-151
WP_151133996.1|3290440_3292201_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	88.2	6.9e-297
WP_151133997.1|3292345_3293185_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.4	1.3e-67
WP_151133998.1|3293211_3294222_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	64.8	7.6e-123
WP_151133999.1|3294224_3294923_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	69.9	1.8e-83
WP_151134000.1|3295026_3295488_+|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	51.3	1.1e-36
WP_151134001.1|3295487_3295694_+|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	65.2	5.1e-18
WP_151134002.1|3295707_3296022_+|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	53.7	1.3e-20
WP_151134003.1|3296018_3296855_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	67.0	1.2e-92
WP_151134004.1|3296851_3297295_+|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	46.4	8.2e-21
WP_151134005.1|3297394_3297925_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	66.5	6.9e-51
WP_151134006.1|3297914_3298364_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	68.9	1.4e-47
WP_151134007.1|3298470_3299037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151134008.1|3299380_3299698_+	DUF1484 family protein	NA	NA	NA	NA	NA
WP_151134009.1|3299771_3300593_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	52.8	8.3e-35
WP_151134010.1|3300784_3301036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151134011.1|3301488_3303513_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_151134012.1|3303500_3304478_-	S1 family peptidase	NA	NA	NA	NA	NA
WP_151134013.1|3304643_3305378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151134014.1|3305455_3306022_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	50.8	4.4e-43
WP_151134015.1|3306018_3306363_+|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	64.9	2.6e-35
WP_151134016.1|3306359_3307280_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	50.7	8.9e-78
WP_151134017.1|3307272_3307836_+|tail	phage tail protein I	tail	A4PE44	Ralstonia_virus	58.8	1.4e-22
WP_151138843.1|3308687_3309437_+|tail	tail fiber protein	tail	A0A0F6YNJ5	Sinorhizobium_phage	61.2	1.7e-26
WP_151134018.1|3309445_3310228_+|tail	phage tail protein	tail	A0A077K9S5	Ralstonia_phage	41.0	5.5e-36
WP_151134019.1|3310533_3311328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151134020.1|3311444_3312614_+|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	76.0	2.1e-172
WP_151134021.1|3312690_3313206_+|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	78.4	5.1e-75
WP_151134022.1|3313224_3313533_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	73.7	1.1e-29
WP_151134023.1|3313541_3313661_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	74.4	8.5e-10
WP_151134024.1|3313650_3316194_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	59.9	1.7e-272
WP_151134025.1|3316199_3316631_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	77.6	6.6e-60
WP_151134026.1|3316627_3317650_+	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	59.8	4.8e-109
WP_151134027.1|3317692_3318019_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_151134028.1|3318015_3318492_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_151134029.1|3318629_3319796_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_151134030.1|3319967_3321008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151134031.1|3321268_3321988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151134032.1|3322062_3322368_-	transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	53.3	1.2e-18
WP_151134033.1|3322494_3322722_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	49.3	4.8e-09
WP_151134034.1|3322734_3322923_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	65.0	1.5e-13
WP_151134035.1|3322951_3323134_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	52.6	1.4e-06
WP_151134036.1|3323185_3323455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151134037.1|3323459_3323747_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	49.5	9.6e-15
WP_151134038.1|3323749_3324112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151134039.1|3324175_3324418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151134040.1|3324414_3327216_+	bifunctional DNA primase/helicase	NA	A0A2H4J936	uncultured_Caudovirales_phage	66.3	0.0e+00
WP_151134041.1|3327307_3328474_+|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	65.8	6.2e-153
WP_151134042.1|3328813_3329482_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	86.1	3.1e-96
3328594:3328623	attR	AGATGGCGGAGGCGGTGAGATTCGAACTCA	NA	NA	NA	NA
WP_151134043.1|3329595_3329988_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	76.0	1.5e-50
WP_151134044.1|3329989_3330346_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	60.2	1.7e-32
WP_151134045.1|3330345_3330648_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	63.0	5.7e-26
WP_151134046.1|3330644_3330980_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	74.8	2.8e-42
WP_151134047.1|3330976_3331960_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	76.1	6.4e-143
WP_151134048.1|3332045_3333059_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_151134049.1|3333043_3334438_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_151134050.1|3334559_3335840_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	6.3e-98
WP_151134051.1|3335856_3336231_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	41.7	3.0e-08
WP_151134052.1|3336227_3337553_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.4	1.6e-80
WP_151134053.1|3337565_3338192_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_151134054.1|3338221_3340633_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.8	7.2e-87
WP_151134055.1|3340899_3341850_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	2.4e-62
WP_151134056.1|3341889_3342570_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_151134057.1|3342624_3343332_+	arginyltransferase	NA	NA	NA	NA	NA
WP_016492441.1|3343432_3343651_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_151134058.1|3343704_3345975_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	2.1e-165
>prophage 3
NZ_CP043311	Pseudomonas sp. PE08 chromosome, complete genome	6056953	3634207	3642833	6056953		uncultured_Caudovirales_phage(71.43%)	11	NA	NA
WP_151134570.1|3634207_3636172_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.9	1.2e-26
WP_151134572.1|3636639_3637014_+	helix-turn-helix transcriptional regulator	NA	K7PH71	Enterobacterial_phage	50.0	1.1e-10
WP_151134574.1|3637354_3638020_+	YcbK family protein	NA	A0A1X9Q111	Human_gut_gokushovirus	42.7	6.3e-09
WP_151134577.1|3638022_3638226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151134579.1|3638400_3638613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151134581.1|3639011_3639275_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_151134583.1|3639745_3640159_+	arsenate reductase ArsC	NA	A0A2H4J437	uncultured_Caudovirales_phage	60.3	2.4e-38
WP_151134585.1|3640166_3640523_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	65.5	1.0e-37
WP_151134587.1|3640563_3641034_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	69.9	1.0e-53
WP_151134589.1|3641050_3642112_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_151134591.1|3642116_3642833_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	82.1	1.6e-111
