The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	1202916	1264643	5542544	holin,capsid,tRNA,lysis,terminase,integrase,plate,tail,portal,head	Escherichia_phage(27.66%)	67	1231832:1231847	1249028:1249043
WP_002914147.1|1202916_1203684_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1203723_1204071_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071839001.1|1204230_1204449_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	7.8e-33
WP_064165080.1|1204530_1205691_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.5	5.2e-176
WP_064165081.1|1205690_1206170_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	78.3	4.8e-67
WP_086647556.1|1206183_1208625_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	71.8	1.0e-290
WP_015959005.1|1208617_1208755_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
WP_004195711.1|1208769_1209045_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343412.1|1209105_1209621_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_071562446.1|1209634_1210816_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
WP_087761950.1|1210925_1212086_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	50.7	5.1e-46
WP_032413889.1|1212165_1212432_-	hypothetical protein	NA	A0A2H5BN44	Klebsiella_phage	81.8	6.2e-32
WP_142673906.1|1212433_1214518_-	hypothetical protein	NA	A0A2H5BN52	Klebsiella_phage	90.0	2.7e-311
WP_087749844.1|1214495_1215092_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	53.5	4.7e-48
WP_047669802.1|1215084_1215993_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	2.6e-114
WP_004195884.1|1215997_1216345_-	25-like lysozyme family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_087749843.1|1216341_1216977_-|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	83.9	6.9e-98
WP_047669806.1|1217045_1217495_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.2e-49
WP_023323002.1|1217487_1217955_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.8	8.2e-64
WP_064188300.1|1218050_1218482_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	64.7	1.5e-40
WP_064188299.1|1218478_1218976_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	86.7	1.3e-80
WP_019725381.1|1218962_1219253_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
WP_019725382.1|1219257_1219461_-|tail	tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_009309691.1|1219460_1219967_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_087761953.1|1220063_1220807_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.5	2.5e-99
WP_025710540.1|1220810_1221869_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
WP_040227518.1|1221942_1222797_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	1.3e-126
WP_087761952.1|1222962_1224732_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	2.8e-306
WP_004195876.1|1224731_1225775_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	6.8e-167
WP_087761934.1|1226290_1226485_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	5.1e-12
WP_019704249.1|1226483_1226915_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	89.5	3.0e-68
WP_019704250.1|1226987_1227218_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	77.6	2.7e-28
WP_032419998.1|1227221_1227407_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	77.0	6.0e-18
WP_087761933.1|1227528_1229754_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	91.0	0.0e+00
WP_086647545.1|1229746_1230028_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	90.3	1.4e-42
WP_032710449.1|1230024_1230321_-	DUF3850 domain-containing protein	NA	A0A2D1GP44	Escherichia_phage	45.5	3.0e-11
WP_015370189.1|1230321_1230543_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	86.3	5.3e-29
WP_064165129.1|1230542_1230776_-	DUF2732 domain-containing protein	NA	Q6K1F6	Salmonella_virus	76.6	6.0e-23
WP_015370191.1|1230839_1231127_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	1.3e-24
WP_064165139.1|1231207_1231408_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	82.0	1.9e-17
WP_015370192.1|1231415_1231925_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	93.5	9.2e-85
1231832:1231847	attL	CTTTATCCGCCAGCTC	NA	NA	NA	NA
WP_015370193.1|1231956_1232184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064165128.1|1232308_1233166_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	56.0	4.0e-88
WP_071647611.1|1233174_1233513_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	63.4	1.7e-34
WP_087761932.1|1233534_1234035_+	hypothetical protein	NA	A0A1D9C9Q4	Salinivibrio_phage	62.0	4.0e-48
WP_064165127.1|1234118_1235150_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	86.7	1.3e-175
WP_044524405.1|1235381_1235840_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_112201299.1|1235897_1237256_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_023290687.1|1237264_1237747_-	OmpA family protein	NA	NA	NA	NA	NA
WP_023290686.1|1237760_1238984_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_023290685.1|1238976_1239486_-	YfiR family protein	NA	NA	NA	NA	NA
WP_023290684.1|1239828_1240899_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	3.7e-91
WP_112201300.1|1240908_1242030_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_080820183.1|1242092_1242965_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_060589671.1|1242961_1244122_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914111.1|1244376_1244712_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004145664.1|1244983_1245721_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_023290681.1|1245852_1246833_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_023290680.1|1246829_1247561_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004206837.1|1247689_1250263_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
1249028:1249043	attR	GAGCTGGCGGATAAAG	NA	NA	NA	NA
WP_023290679.1|1256331_1257630_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.7	1.4e-44
WP_004201811.1|1257633_1257957_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_023290677.1|1257998_1259354_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_044524371.1|1259474_1262126_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_050533275.1|1262160_1262859_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_002914091.1|1262928_1263354_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_023290674.1|1263557_1264643_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	1436644	1534341	5542544	holin,tRNA,transposase,terminase,integrase,plate,tail,protease,portal	Klebsiella_phage(26.0%)	98	1465922:1465945	1511497:1511520
WP_112201319.1|1436644_1437994_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_023290570.1|1437990_1438680_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_110244209.1|1438679_1440359_+	OmpA family protein	NA	NA	NA	NA	NA
WP_112201320.1|1440361_1440853_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_112201321.1|1442137_1444495_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_110244207.1|1445120_1445591_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_110244205.1|1448521_1449322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110244204.1|1449410_1449995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142293038.1|1450239_1450545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101996151.1|1450546_1450810_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	1.2e-06
WP_112201322.1|1450812_1452021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201323.1|1452013_1455385_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_112201324.1|1455404_1457012_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_023290555.1|1457045_1458815_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_112201325.1|1458778_1459861_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_048336261.1|1459896_1460421_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_112201326.1|1460425_1462897_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_087824995.1|1462897_1463782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142673908.1|1463771_1464332_+	hypothetical protein	NA	NA	NA	NA	NA
1465922:1465945	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_112201327.1|1466139_1467315_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.1	1.9e-202
WP_112201328.1|1467355_1468165_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_080795253.1|1468205_1468388_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	65.5	6.1e-15
WP_112201329.1|1468395_1469061_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	66.7	6.7e-51
WP_048267938.1|1469061_1469316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077254344.1|1469308_1469533_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	53.8	1.3e-14
WP_004104281.1|1469529_1469658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112201330.1|1469847_1470708_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	52.7	2.6e-71
WP_112201331.1|1470789_1471602_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_004104278.1|1471645_1472005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112201332.1|1472429_1472609_+	hypothetical protein	NA	S5FM78	Shigella_phage	66.1	1.7e-14
WP_142673909.1|1472582_1472777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104276.1|1473570_1474281_-	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	67.5	4.0e-86
WP_004104275.1|1474388_1474583_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	79.4	3.6e-21
WP_112201333.1|1474660_1475176_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	63.4	5.2e-59
WP_112201334.1|1475214_1475493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004104272.1|1475654_1475930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201335.1|1475922_1477452_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.7	3.3e-202
WP_112201336.1|1477448_1478420_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	1.2e-109
WP_112201979.1|1478389_1479034_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	57.4	1.5e-39
WP_112201337.1|1479030_1479675_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.2	2.0e-84
WP_087473058.1|1479664_1480069_+	antitermination protein	NA	S5M7R9	Escherichia_phage	53.2	5.5e-32
WP_060591433.1|1480248_1480440_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	87.3	5.8e-24
WP_112201338.1|1480590_1481643_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.4	4.6e-171
WP_087473056.1|1481787_1482135_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	70.1	5.7e-38
WP_004884314.1|1482137_1482677_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	6.7e-102
WP_087473054.1|1482673_1483021_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.9	8.0e-40
WP_112201339.1|1483017_1483293_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	47.2	2.7e-14
WP_112201340.1|1483243_1483435_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	4.9e-23
WP_112201341.1|1483466_1483667_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	68.3	9.3e-17
WP_112201342.1|1483731_1483977_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	1.8e-33
WP_107334310.1|1484202_1484463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023320792.1|1484529_1484715_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	1.9e-11
WP_014228567.1|1485035_1485527_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_070984122.1|1485526_1487635_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
WP_070984123.1|1487631_1487847_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	1.3e-24
WP_020317329.1|1487843_1489343_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_071993325.1|1489287_1491303_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	85.4	0.0e+00
WP_025714421.1|1491383_1491710_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	67.3	4.7e-34
WP_020317349.1|1491702_1491996_+	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_020317346.1|1491985_1492537_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.9	5.3e-54
WP_020804325.1|1492533_1492932_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_023304948.1|1492939_1493422_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804327.1|1493464_1493860_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.4	3.7e-09
WP_032420719.1|1493880_1494198_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_065800056.1|1495662_1496586_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
WP_032420722.1|1497940_1498414_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
WP_112201343.1|1498400_1498883_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	68.4	1.1e-55
WP_029497207.1|1498890_1499277_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
WP_029497208.1|1499273_1502342_+	kinase	NA	A0A286S259	Klebsiella_phage	66.5	0.0e+00
WP_112201344.1|1502419_1504171_+	GDSL family lipase	NA	A0A286S1P0	Klebsiella_phage	53.3	1.4e-23
WP_112201345.1|1504173_1504932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201980.1|1505022_1508157_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.0	1.1e-103
WP_112201346.1|1508269_1508818_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.1	3.2e-91
WP_074160389.1|1509022_1509274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|1509273_1510758_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_112201347.1|1510834_1511074_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	6.8e-22
WP_032422721.1|1511030_1511402_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	9.2e-26
WP_023290545.1|1511608_1512538_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	83.4	1.6e-135
1511497:1511520	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_023290544.1|1512827_1513589_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_085551268.1|1513646_1514975_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_023290542.1|1515342_1515627_+	DUF406 family protein	NA	NA	NA	NA	NA
WP_048336257.1|1515784_1517095_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_112201348.1|1517094_1519239_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_004201794.1|1519448_1519934_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_004201792.1|1519952_1520504_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_023290538.1|1520671_1521604_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_023290537.1|1521646_1522732_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	1.7e-88
WP_023290536.1|1522734_1523559_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_004201787.1|1523558_1524368_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_032453614.1|1524367_1524916_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_023290534.1|1524947_1525229_+	YfcL family protein	NA	NA	NA	NA	NA
WP_112201981.1|1525388_1527377_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913291.1|1527535_1528756_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_064157280.1|1528965_1530141_+	MFS transporter	NA	NA	NA	NA	NA
WP_048336253.1|1530227_1531205_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_142673910.1|1531315_1532452_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	9.4e-21
WP_112201349.1|1532515_1533529_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032453605.1|1533528_1534341_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	1684992	1739112	5542544	holin,capsid,tRNA,lysis,transposase,integrase	Enterobacteria_phage(18.18%)	47	1725548:1725607	1740333:1740406
WP_004201621.1|1684992_1685688_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_023290438.1|1685677_1686082_-|holin	holin-like protein	holin	NA	NA	NA	NA
WP_023290437.1|1686440_1687373_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_112201367.1|1687729_1689094_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_044524210.1|1689249_1690083_+	transcriptional antiterminator BglG	NA	NA	NA	NA	NA
WP_112201368.1|1690224_1692084_+	PTS beta-glucoside transporter subunit IIABC	NA	NA	NA	NA	NA
WP_112201369.1|1692099_1693494_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_023290432.1|1693527_1694262_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	42.0	2.8e-50
WP_112201370.1|1694390_1695830_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_023290430.1|1695862_1696432_-	DedA family protein	NA	NA	NA	NA	NA
WP_032453512.1|1696585_1697173_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_032428935.1|1697364_1698312_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002912829.1|1698472_1699027_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
WP_112201371.1|1699112_1700858_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_065804934.1|1701052_1703350_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_023290425.1|1703486_1704404_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044524199.1|1704411_1705569_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_112201372.1|1705561_1706509_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	5.8e-24
WP_112201373.1|1706492_1707230_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002912762.1|1707204_1707318_-	protein YohO	NA	NA	NA	NA	NA
WP_004189065.1|1707547_1709236_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.3	2.5e-259
WP_023290421.1|1709229_1709949_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_023290420.1|1709996_1710467_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	73.1	5.0e-61
WP_112201374.1|1710577_1712611_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.7	2.0e-53
WP_023290418.1|1712764_1713874_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032453497.1|1713870_1714332_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004201590.1|1714306_1714624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112201375.1|1714807_1715707_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023290415.1|1715696_1717040_-	NCS2 family permease	NA	NA	NA	NA	NA
WP_065812296.1|1717042_1718854_-	adenine deaminase	NA	NA	NA	NA	NA
WP_048336188.1|1718974_1719889_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023290412.1|1719885_1720308_-	universal stress protein A	NA	NA	NA	NA	NA
WP_087824197.1|1720447_1722424_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	3.1e-160
WP_044524189.1|1722625_1723261_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_023290409.1|1723328_1725305_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.6	2.4e-160
1725548:1725607	attL	ATGACTCGGGGTGCCCTTCTTCGTTGAAGGCTGAGAAATACCCGTACCACCTGATCTGGA	NA	NA	NA	NA
WP_094487818.1|1725707_1727066_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_142673911.1|1727279_1727813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094487816.1|1727824_1728667_+	DUF4393 domain-containing protein	NA	Q4ZBL8	Staphylococcus_phage	31.7	3.6e-17
WP_094487815.1|1728858_1729419_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_112201376.1|1731090_1732137_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	6.0e-06
WP_112201377.1|1732310_1732757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201378.1|1733060_1733894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094487813.1|1733908_1734403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094487812.1|1734506_1734851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201379.1|1734850_1737016_+	chemotaxis protein	NA	A0A0N7CEY0	Salmonella_phage	65.0	3.6e-05
WP_094487810.1|1737732_1738077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201380.1|1738095_1739112_+|capsid	major capsid protein E	capsid	NA	NA	NA	NA
1740333:1740406	attR	ATGACTCGGGGTGCCCTTCTTCGTTGAAGGCTGAGAAATACCCGTACCACCTGATCTGGATAATGCCAGCGTAG	NA	NA	NA	NA
>prophage 4
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	1795210	1805261	5542544		Enterobacteria_phage(28.57%)	9	NA	NA
WP_112201393.1|1795210_1796617_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	8.0e-38
WP_112201394.1|1796840_1797905_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	2.9e-104
WP_112201395.1|1797931_1798801_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	3.7e-110
WP_043520425.1|1798832_1799723_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	1.4e-27
WP_023297948.1|1799737_1800292_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_112201396.1|1800472_1801639_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	7.0e-112
WP_112201397.1|1801962_1802967_+	acyltransferase	NA	NA	NA	NA	NA
WP_000429184.1|1803734_1803857_-	small membrane protein	NA	NA	NA	NA	NA
WP_044524123.1|1804256_1805261_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.8e-31
>prophage 5
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	2812484	2823367	5542544		Escherichia_phage(87.5%)	9	NA	NA
WP_112201579.1|2812484_2815592_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.3	0.0e+00
WP_048334863.1|2815646_2816912_+	MFS transporter	NA	NA	NA	NA	NA
WP_112201580.1|2816941_2818030_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	96.7	5.0e-205
WP_004205993.1|2818114_2818375_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_112201582.1|2818671_2819532_+	OKP family class A broad-spectrum beta-lactamase	NA	A0A077SL40	Escherichia_phage	88.5	3.4e-140
WP_023289604.1|2819551_2820313_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
WP_064154652.1|2820574_2821477_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.3	4.2e-157
WP_112201584.1|2821488_2822754_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	92.4	1.2e-218
WP_064154654.1|2822746_2823367_+	aldolase	NA	A0A077SK32	Escherichia_phage	94.7	5.9e-110
>prophage 6
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	3113532	3118465	5542544		uncultured_Caudovirales_phage(16.67%)	6	NA	NA
WP_064145633.1|3113532_3114204_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	5.3e-80
WP_064145632.1|3114196_3115462_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.1	4.3e-208
WP_064145631.1|3115463_3115883_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_001333465.1|3116432_3116855_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
WP_064145630.1|3116932_3117481_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	89.0	9.0e-86
WP_069484123.1|3117883_3118465_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	1.2e-06
>prophage 7
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	3125757	3155102	5542544	integrase	Salmonella_phage(23.33%)	39	3127858:3127874	3155764:3155780
WP_112201668.1|3125757_3128826_-	kinase	NA	A0A286S259	Klebsiella_phage	96.6	0.0e+00
3127858:3127874	attL	CCCCAGCGTCACCGGCA	NA	NA	NA	NA
WP_048337060.1|3128822_3129203_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	1.2e-68
WP_064145658.1|3129212_3129695_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	92.5	6.5e-80
WP_031280381.1|3131331_3131778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|3131683_3131941_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_064145486.1|3132094_3132877_-	molecular chaperone	NA	F1C595	Cronobacter_phage	78.7	3.2e-113
WP_004190680.1|3132873_3133242_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.8	3.5e-41
WP_064145487.1|3133238_3133535_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.8	2.3e-35
WP_032416515.1|3133537_3133744_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	1.1e-23
WP_087812871.1|3133743_3134343_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	1.3e-90
WP_112201992.1|3134416_3134641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413665.1|3136012_3136312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804596.1|3136407_3136836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804600.1|3136839_3137061_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_020804604.1|3137057_3137312_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_064145489.1|3137304_3137508_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	1.3e-26
WP_064145490.1|3137504_3138290_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	3.6e-64
WP_112201670.1|3138282_3138618_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	7.6e-11
WP_064145491.1|3138610_3139324_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	58.4	9.0e-70
WP_064145492.1|3139320_3140241_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	60.7	4.8e-92
WP_064145493.1|3140592_3141129_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	7.0e-59
WP_023341332.1|3141131_3141362_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	45.3	2.1e-12
WP_043875424.1|3141473_3141887_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_102046876.1|3142074_3142173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|3142279_3142471_+	YebW family protein	NA	NA	NA	NA	NA
WP_023282477.1|3142479_3142635_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_064145494.1|3142772_3145868_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	56.8	4.1e-292
WP_064145495.1|3145880_3146969_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.2	3.7e-107
WP_064145496.1|3147003_3147348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032445494.1|3147340_3147952_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	76.3	4.1e-39
WP_012542038.1|3147948_3148257_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
WP_004892750.1|3148264_3148504_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_004190725.1|3148513_3148828_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_080895642.1|3148724_3149912_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	2.4e-120
WP_004151901.1|3150088_3150979_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004203899.1|3150978_3151971_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004203898.1|3151972_3152782_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	33.7	1.2e-14
WP_101866900.1|3152811_3154311_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	33.6	2.5e-61
WP_017900863.1|3154307_3155102_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.4	6.6e-29
3155764:3155780	attR	CCCCAGCGTCACCGGCA	NA	NA	NA	NA
>prophage 8
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	3279090	3326965	5542544	capsid,tRNA,transposase,terminase,integrase,plate,tail,portal,head	Enterobacteria_phage(57.58%)	55	3310061:3310075	3325773:3325787
WP_050533957.1|3279090_3279591_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_044522266.1|3279708_3280155_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_044522343.1|3280138_3280930_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048297282.1|3281031_3282216_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_032452478.1|3282247_3282940_-	CTP synthase	NA	NA	NA	NA	NA
WP_023289247.1|3283085_3283595_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_023289246.1|3283581_3283938_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_023289245.1|3283927_3284167_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004213128.1|3284433_3284685_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_040227680.1|3284728_3285868_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.0	9.4e-146
WP_040227678.1|3286022_3287195_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	1.0e-158
WP_004216461.1|3287194_3287710_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|3287755_3288073_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|3288072_3288231_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_087827936.1|3288217_3291193_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.7	1.8e-220
WP_040228690.1|3291208_3291700_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	7.3e-55
WP_112201682.1|3292128_3295236_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_112201237.1|3295251_3296283_-|transposase	IS630-like element ISSpu2 family transposase	transposase	NA	NA	NA	NA
WP_040228490.1|3297353_3298451_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	3.2e-10
WP_040228488.1|3298450_3298663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065800056.1|3300760_3301684_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
WP_040228484.1|3302741_3303665_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040228482.1|3303666_3304017_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	60.4	3.6e-24
WP_040228480.1|3304013_3304601_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.0	1.7e-61
WP_040228478.1|3304597_3305233_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	1.0e-56
WP_040228476.1|3305229_3305697_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.2	9.1e-47
WP_052450952.1|3305697_3305973_-	hypothetical protein	NA	B6SD31	Bacteriophage	34.1	6.6e-05
WP_004213112.1|3305878_3306208_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_004213111.1|3306219_3306765_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	1.3e-31
WP_004215823.1|3306761_3307046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|3307036_3307237_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_004213109.1|3307236_3307752_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_040228473.1|3307864_3308722_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	3.7e-70
WP_020324085.1|3308771_3309806_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_038989682.1|3309817_3310657_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	2.1e-94
3310061:3310075	attL	TTTCTGGCCTTTGCC	NA	NA	NA	NA
WP_112201684.1|3310813_3312541_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.1	1.5e-232
WP_052455057.1|3312534_3313596_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	3.1e-143
WP_040228468.1|3314183_3315710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040228466.1|3318352_3319309_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	53.3	3.9e-84
WP_004131528.1|3319305_3319533_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
WP_040228464.1|3319541_3320108_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	32.1	3.6e-13
WP_004213098.1|3320104_3320329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040228462.1|3320397_3320670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040228460.1|3320685_3321063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|3321078_3321297_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|3321317_3321596_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|3321716_3322016_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_040228457.1|3322131_3323115_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	4.9e-151
WP_017898645.1|3323378_3324392_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.1	9.3e-12
WP_048297280.1|3324449_3324551_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_137910537.1|3324550_3324625_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004203733.1|3324743_3324869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004203731.1|3324928_3325192_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004203730.1|3325322_3325961_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
3325773:3325787	attR	GGCAAAGGCCAGAAA	NA	NA	NA	NA
WP_023289231.1|3326050_3326965_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	49.6	1.2e-71
>prophage 9
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	3354091	3406334	5542544	holin,capsid,transposase,terminase,integrase,tail,portal,head	Klebsiella_phage(48.78%)	54	3351010:3351024	3407114:3407128
3351010:3351024	attL	GCGGTCATCCGGCGC	NA	NA	NA	NA
WP_047694554.1|3354091_3355156_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	2.7e-14
WP_112201688.1|3355580_3357017_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	53.7	2.4e-98
WP_112201689.1|3357078_3368295_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	50.0	0.0e+00
WP_023159867.1|3368357_3368951_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.6	2.2e-77
WP_139828134.1|3369002_3369200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112201690.1|3369391_3370315_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	5.1e-166
WP_087499133.1|3370447_3371158_-	NlpC/P60 family protein	NA	Q6UAW4	Klebsiella_phage	89.8	9.4e-136
WP_087499132.1|3371159_3371915_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	5.1e-124
WP_017898999.1|3371911_3372250_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
WP_112201691.1|3372249_3375585_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.5	0.0e+00
WP_071836352.1|3375584_3375803_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_014228914.1|3375817_3376183_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3376240_3376702_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_017898997.1|3376733_3377135_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_017880258.1|3377131_3377521_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3377501_3377840_-	hypothetical protein	NA	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3377836_3378154_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_063002116.1|3378134_3378395_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_112201692.1|3378453_3379740_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3379817_3380738_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_064141880.1|3380774_3382034_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	1.4e-222
WP_017898992.1|3382033_3382213_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_087499129.1|3382206_3383928_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.6	6.5e-191
WP_012542168.1|3383927_3384362_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_017898991.1|3384611_3385043_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
WP_014228902.1|3385039_3385357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898990.1|3385308_3385671_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
WP_017898989.1|3385824_3386046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898988.1|3386152_3386341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898986.1|3387420_3387771_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_023279523.1|3387767_3388265_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
WP_017880269.1|3388264_3388480_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_023342896.1|3389903_3390506_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	2.4e-76
WP_069197143.1|3390522_3391554_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	2.1e-96
WP_032418038.1|3391553_3391757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418037.1|3391753_3392146_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	1.0e-11
WP_077253879.1|3392186_3392477_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_012542186.1|3392488_3392722_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_040231034.1|3393111_3394209_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.3	1.8e-53
WP_040231036.1|3394201_3396313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096900011.1|3396603_3397044_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_047670011.1|3397057_3397522_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.9	1.2e-62
WP_096900017.1|3397514_3398519_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	35.6	2.1e-32
WP_017898969.1|3398578_3399133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147982.1|3399135_3399357_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
WP_004147981.1|3399627_3399882_+	hypothetical protein	NA	H6WRX4	Salmonella_phage	54.8	1.6e-13
WP_096900013.1|3400155_3400335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201693.1|3400470_3400689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063002092.1|3400698_3400893_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3400935_3401280_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_112201694.1|3401421_3403560_+	exonuclease	NA	S4TNL0	Salmonella_phage	43.1	2.1e-98
WP_012542206.1|3403612_3403858_+	excisionase	NA	NA	NA	NA	NA
WP_110228966.1|3403838_3404966_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_023289166.1|3405083_3406334_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
3407114:3407128	attR	GCGCCGGATGACCGC	NA	NA	NA	NA
>prophage 10
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	3673765	3683226	5542544	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_064158126.1|3673765_3675487_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	33.0	6.4e-13
WP_049014702.1|3675526_3676228_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3676581_3676800_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_032455257.1|3676922_3679202_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	6.2e-165
WP_002896520.1|3679232_3679550_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3679875_3680097_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_044521907.1|3680173_3682114_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.4e-37
WP_004201357.1|3682110_3683226_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 11
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	4167185	4213299	5542544	holin,tRNA,lysis,terminase,integrase	uncultured_Caudovirales_phage(28.3%)	67	4166984:4167030	4210369:4210415
4166984:4167030	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_104466707.1|4167185_4167503_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.1e-22
WP_048336948.1|4167502_4167742_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	3.6e-15
WP_142673918.1|4167859_4168609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112201787.1|4168611_4170414_-	GDSL family lipase	NA	A0A286S1P0	Klebsiella_phage	43.5	2.6e-17
WP_112201788.1|4170665_4171547_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	60.2	7.3e-29
WP_032454856.1|4171546_4172320_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.1	1.1e-76
WP_112201789.1|4172316_4173513_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.6	2.5e-157
WP_112201790.1|4173512_4173866_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	8.7e-50
WP_112201791.1|4173867_4174521_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	50.8	2.4e-61
WP_142673919.1|4174743_4175100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920896.1|4175146_4175497_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	41.6	5.5e-20
WP_112201792.1|4175493_4176522_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.0	1.3e-98
WP_112201793.1|4176524_4176827_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.6e-26
WP_023158909.1|4176827_4177427_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	58.1	5.8e-54
WP_112201794.1|4177426_4179352_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	71.3	7.3e-183
WP_112202000.1|4179341_4179494_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	82.0	2.4e-17
WP_110225340.1|4179535_4179955_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	1.0e-41
WP_021312703.1|4179958_4180402_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	1.2e-61
WP_102962067.1|4180411_4181557_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.4	2.2e-166
WP_004152176.1|4181560_4182001_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_023312779.1|4182095_4182482_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_021312707.1|4182481_4182988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086624362.1|4182984_4183404_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
WP_062920907.1|4183372_4183654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112201795.1|4183693_4184635_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	74.8	5.2e-134
WP_000528476.1|4184646_4185141_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_112201796.1|4185144_4186347_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.6	9.1e-107
WP_064165524.1|4186356_4186551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428680.1|4186596_4187145_-	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_112201797.1|4187200_4188652_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	1.1e-191
WP_112201798.1|4188889_4190290_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.1	1.2e-187
WP_112201799.1|4190240_4191017_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	46.5	3.9e-10
WP_112201800.1|4191225_4191693_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	72.3	4.1e-55
WP_041165462.1|4191689_4192187_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	1.3e-78
WP_032419911.1|4192164_4192434_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.1e-32
WP_112202001.1|4193346_4194036_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.4	8.1e-60
WP_004884232.1|4194035_4194176_-	YlcG family protein	NA	NA	NA	NA	NA
WP_112202002.1|4194816_4195413_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	9.5e-57
WP_032430153.1|4195533_4195803_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	83.0	2.4e-36
WP_112201801.1|4195849_4196245_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	80.8	6.1e-52
WP_112201802.1|4197241_4197469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112201803.1|4197970_4198222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112201804.1|4198218_4198689_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	56.5	2.3e-34
WP_112201805.1|4198685_4198988_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112201806.1|4198987_4200418_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.2e-184
WP_112201807.1|4200407_4201307_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.5	7.8e-87
WP_004141720.1|4201532_4201853_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_040182097.1|4201892_4202114_-	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.1	1.8e-13
WP_112201808.1|4202216_4202912_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	62.4	8.2e-76
WP_142673920.1|4202931_4203366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080922727.1|4203725_4203941_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	47.1	8.2e-11
WP_019704100.1|4204040_4204235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201809.1|4204323_4205295_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.1	1.4e-65
WP_112201810.1|4205302_4205587_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	77.7	1.6e-38
WP_039108801.1|4205603_4206350_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	5.3e-65
WP_064344917.1|4206346_4206970_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	5.3e-58
WP_050885292.1|4206998_4207526_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	60.4	9.3e-56
WP_112201811.1|4207522_4208293_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.6	5.5e-65
WP_112201812.1|4208289_4208508_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	8.4e-11
WP_112201813.1|4208509_4208728_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.6	1.9e-15
WP_042934012.1|4208727_4208967_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	3.9e-09
WP_004223135.1|4208979_4209315_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142673921.1|4209191_4210355_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.8	1.1e-202
WP_072013401.1|4210424_4210649_-	hypothetical protein	NA	NA	NA	NA	NA
4210369:4210415	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143017.1|4210787_4211654_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4211655_4211868_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004204706.1|4211913_4213299_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 12
NZ_CP026368	Klebsiella quasipneumoniae strain A708 chromosome, complete genome	5542544	4935894	4947295	5542544	transposase	Enterobacteria_phage(50.0%)	8	NA	NA
WP_112201915.1|4935894_4939125_+	DUF4145 domain-containing protein	NA	Q6NDX2	Leptospira_phage	25.7	2.9e-14
WP_065800056.1|4939166_4940090_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
WP_112201916.1|4940194_4940389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201917.1|4940475_4942098_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	29.7	8.1e-34
WP_112201918.1|4942094_4943273_+	restriction endonuclease	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.1	2.3e-14
WP_112201919.1|4943269_4945060_+	AAA family ATPase	NA	Q2P9X8	Enterobacteria_phage	29.4	2.6e-09
WP_112201920.1|4945059_4945959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112201921.1|4946041_4947295_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	39.4	7.6e-80
>prophage 1
NZ_CP026369	Klebsiella quasipneumoniae strain A708 plasmid pA708-1, complete sequence	238703	5481	12087	238703		Salmonella_phage(55.56%)	12	NA	NA
WP_014839971.1|5481_5694_-	hypothetical protein	NA	J9Q804	Salmonella_phage	50.0	3.0e-13
WP_017900702.1|6183_6468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900703.1|6464_6872_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	56.1	3.5e-18
WP_017900704.1|6964_7288_-	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
WP_017900705.1|7288_8362_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.8	1.1e-18
WP_014839970.1|8365_8590_-	hypothetical protein	NA	B1GS76	Salmonella_phage	51.2	2.3e-08
WP_087525963.1|8855_9590_-	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	36.3	9.4e-14
WP_062878103.1|9582_9771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839969.1|9917_10163_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	65.8	6.1e-18
WP_025999286.1|10227_10839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087525964.1|10881_11085_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	62.7	1.4e-15
WP_014839967.1|11766_12087_-	hypothetical protein	NA	J9Q750	Salmonella_phage	53.8	8.2e-31
>prophage 2
NZ_CP026369	Klebsiella quasipneumoniae strain A708 plasmid pA708-1, complete sequence	238703	116544	144654	238703	transposase,integrase	Salmonella_phage(37.5%)	30	124812:124828	156145:156161
WP_014839933.1|116544_117678_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017900677.1|117851_118106_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_049593898.1|118192_119254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839932.1|120150_121035_-	hypothetical protein	NA	A0A1B0VDL5	Salmonella_phage	41.1	9.8e-50
WP_017900953.1|121606_122212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839931.1|122799_123141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|123469_124474_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_048336622.1|124552_127522_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
124812:124828	attL	CGGTCGCGGATTTCACC	NA	NA	NA	NA
WP_001162012.1|127524_128082_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001447826.1|128119_128443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|128387_129401_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|129553_130294_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_048336621.1|130383_131733_-	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.3	3.3e-12
WP_015063357.1|132472_132805_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|132931_133486_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_010466370.1|134141_134540_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003089115.1|134614_134965_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003150552.1|134977_135253_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089113.1|135260_135473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003299771.1|135485_138479_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003089107.1|138892_139132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904941.1|139229_139844_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
WP_001087809.1|139896_140133_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_010466447.1|140129_140495_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|140511_142158_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_000654684.1|142154_142400_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|142402_142678_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|142693_143044_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|143115_143550_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427619.1|143649_144654_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
156145:156161	attR	CGGTCGCGGATTTCACC	NA	NA	NA	NA
>prophage 3
NZ_CP026369	Klebsiella quasipneumoniae strain A708 plasmid pA708-1, complete sequence	238703	155936	188086	238703	integrase,transposase	Escherichia_phage(27.27%)	28	180766:180825	186922:188119
WP_151114725.1|155936_158750_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.3	8.2e-183
WP_001067855.1|158817_159522_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|159754_160615_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|160627_161170_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|161651_161843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|161848_162094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|162144_163281_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|163395_164766_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|165586_166447_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001161490.1|169663_170224_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_010635893.1|170304_170592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|170560_171574_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|171865_172420_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|172550_173381_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|173518_174151_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|174235_174688_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|174910_175258_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|175251_176091_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|176495_178037_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_014839891.1|178388_179630_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.5	8.2e-10
WP_014839892.1|179657_180308_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
180766:180825	attL	AGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTC	NA	NA	NA	NA
WP_014839893.1|180913_181930_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_001752311.1|182144_183176_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_017901373.1|183700_183886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252868.1|183901_184051_-	DinI-like family protein	NA	NA	NA	NA	NA
WP_017901372.1|184214_185318_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	62.1	1.0e-120
WP_071600436.1|185376_186090_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014839893.1|187069_188086_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
186922:188119	attR	AGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGCCTTGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTAGTGAGATCTCTCCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAACTGTCGCTTGATGATGCGAAATGGGTGCTCCACCTTGGCCCGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTGCCGGGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCCCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACTAGGCTGTGGGTCAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATGATGGTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCATGATGGTGGTGCGGTCAGGCAAGGCGCTATCCAGGGATAACCGGGCAAACCGACGCATGGAGGCGATTTCGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTGGGGTAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATACGGGACAAGAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATGACTCATGATGAACCCTGTTCCATGGCTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCT	NA	NA	NA	NA
>prophage 1
NZ_CP026370	Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence	118719	14707	53845	118719	transposase	Stx2-converting_phage(30.0%)	41	NA	NA
WP_004181747.1|14707_16246_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
WP_004114612.1|16295_16643_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_004118218.1|16639_17017_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
WP_023280906.1|17386_18694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021312494.1|18690_20847_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	41.7	5.2e-36
WP_021312679.1|22931_23327_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_077259381.1|23375_24722_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_087796141.1|24983_25691_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_151114741.1|25847_27194_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004187044.1|27404_27887_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|27874_28141_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_023329017.1|29252_30062_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_057072740.1|30054_31263_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_001118616.1|31852_32776_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_004150739.1|32928_33132_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_032414151.1|33192_33687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032414152.1|33717_34284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151114746.1|34280_34532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118349.1|34845_35025_+	antitoxin	NA	NA	NA	NA	NA
WP_009654306.1|34990_35110_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_048293723.1|35488_35923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152084.1|36139_37540_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|37536_38217_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|38271_39201_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|39205_39586_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_130943622.1|39625_40516_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_048298742.1|40521_42339_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_065800056.1|42788_43712_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
WP_042922367.1|44270_45695_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_015065528.1|45694_46435_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_004144423.1|46421_46988_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_004144424.1|47007_47313_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_004194426.1|47326_47695_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_004208838.1|47748_48120_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_072271345.1|48203_48899_-	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
WP_032441878.1|49105_49498_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001568108.1|49932_50418_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001568110.1|50450_50765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023316395.1|50812_51634_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	8.8e-45
WP_032409235.1|52350_52587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151114751.1|52555_53845_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
>prophage 2
NZ_CP026370	Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence	118719	60503	105556	118719	transposase,integrase	Macacine_betaherpesvirus(25.0%)	50	56618:56633	111467:111482
56618:56633	attL	AGAAAAATACGTTCAC	NA	NA	NA	NA
WP_032432471.1|60503_61577_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_103214924.1|61652_63027_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	70.5	4.7e-75
WP_103214923.1|63169_63586_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_103214922.1|63757_64894_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_023303133.1|64906_65176_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_103214921.1|65280_66579_-	MFS transporter	NA	NA	NA	NA	NA
WP_103214920.1|66812_67571_-	Tat pathway signal sequence	NA	NA	NA	NA	NA
WP_103214919.1|67624_68545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214918.1|68608_68980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214917.1|69120_69810_-	transmembrane anchor protein	NA	NA	NA	NA	NA
WP_103214916.1|69823_70561_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_103214915.1|70604_70970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214936.1|71278_71575_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103214914.1|71579_72905_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_001568060.1|73270_73645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568059.1|73700_74027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|74023_74752_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_020804497.1|74748_75180_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_009310025.1|75224_77282_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
WP_009310026.1|77351_77600_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020804498.1|77648_78191_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_071531256.1|78428_78689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568049.1|78882_79203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074442803.1|79238_79493_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	49.3	5.7e-11
WP_022644899.1|79686_79878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644900.1|79920_80427_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_151114760.1|80471_80900_-	antirestriction protein	NA	NA	NA	NA	NA
WP_136046365.1|81578_82346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|82399_82819_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|82828_83050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023280865.1|83049_83751_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	2.7e-26
WP_009309993.1|84187_84418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049193275.1|84478_85150_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568038.1|85152_86124_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152765.1|86372_87857_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_072201151.1|87856_88108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309980.1|88262_88688_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004206782.1|88687_89959_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_004206783.1|90037_90289_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_009309981.1|90342_90648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240375.1|90673_90931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309982.1|92100_93072_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_000523812.1|93071_94238_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200070.1|94988_95999_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|96696_97437_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_000227969.1|98392_99469_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004187025.1|100963_101212_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_151114766.1|102300_102975_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032425576.1|103011_103935_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.5	2.7e-167
WP_065800056.1|104632_105556_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
111467:111482	attR	AGAAAAATACGTTCAC	NA	NA	NA	NA
>prophage 1
NZ_CP026371	Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence	133085	1687	41338	133085	protease,integrase,transposase	Escherichia_phage(58.33%)	40	NA	NA
WP_001067855.1|1687_2392_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549941.1|2610_3573_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001549942.1|3569_4991_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_055316428.1|5000_6551_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_072193879.1|6646_7090_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_100160450.1|7722_9033_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.2	4.4e-30
WP_001549947.1|9148_10252_-	ring-opening amidohydrolase	NA	NA	NA	NA	NA
WP_001549948.1|10304_11540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055316696.1|11987_12911_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	1.0e-174
WP_001124949.1|15415_15637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151114784.1|16211_17012_-	DsbA family protein	NA	NA	NA	NA	NA
WP_151114789.1|17363_18344_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.6e-184
WP_000780222.1|18621_18903_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|18883_19213_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_001572362.1|20258_21281_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016236507.1|21502_21838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105318624.1|22327_23332_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_060617172.1|23575_24352_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_009653916.1|24487_24742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098928.1|24817_25075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|25123_25327_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_101740016.1|25360_25729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049106297.1|25772_26267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151114795.1|26297_26864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023778.1|26860_27124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071571078.1|27473_27668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568025.1|27719_27938_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001568026.1|27939_28245_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_025380813.1|28449_28809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644730.1|28835_29159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020315256.1|29155_30172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|30369_31164_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|31603_31783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|31902_32529_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004197644.1|33169_34045_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.8	1.1e-82
WP_101857424.1|34456_35728_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	8.9e-153
WP_048322265.1|35727_36159_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_009483812.1|36316_36568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|37942_38647_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_150073787.1|40321_41338_-|protease	CAAX protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP026371	Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence	133085	48817	57115	133085		Faecalibacterium_phage(16.67%)	13	NA	NA
WP_032744253.1|48817_49519_+	methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.3	2.6e-21
WP_020804418.1|49518_49740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804419.1|49785_50196_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_020804421.1|50242_51007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064181679.1|51438_51867_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.8e-10
WP_020803879.1|51911_52418_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_020803881.1|52458_52650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039698518.1|52850_53114_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	3.4e-14
WP_150073638.1|53138_53459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135708424.1|53622_53805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343514.1|54211_54748_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	73.2	5.9e-50
WP_064343515.1|54797_55046_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_048757533.1|55114_57115_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	3.0e-22
