The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035632	Synechococcus sp. RSCCF101 chromosome, complete genome	2984853	381859	497531	2984853	integrase,transposase,terminase,protease	Synechococcus_phage(15.0%)	101	431727:431752	459310:459335
WP_150882111.1|381859_383110_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.2	8.9e-105
WP_150882112.1|383198_383648_-	hypothetical protein	NA	A0A0K0NKY0	Gordonia_phage	40.4	2.2e-13
WP_150882113.1|383989_384886_-|terminase	phage terminase large subunit	terminase	M1PW71	Synechococcus_phage	64.6	9.8e-98
WP_150882114.1|385398_386472_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_150882115.1|386895_387522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882116.1|388818_389841_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_150884783.1|390535_390694_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_150882117.1|391018_392248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882118.1|392380_392881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882119.1|394008_394227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882120.1|394541_395174_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_150882121.1|395304_396384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882122.1|396576_396852_-	monovalent cation/H(+) antiporter subunit G	NA	NA	NA	NA	NA
WP_150882123.1|396848_397097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882124.1|397093_397522_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_150882125.1|397518_397725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882126.1|397718_399002_-	proton-conducting membrane transporter	NA	NA	NA	NA	NA
WP_150882127.1|399002_399389_-	cation:proton antiporter subunit C	NA	NA	NA	NA	NA
WP_150882128.1|399402_400527_-	NrdH-redoxin	NA	NA	NA	NA	NA
WP_150882129.1|400716_400890_-	DUF4278 domain-containing protein	NA	F4YCH8	Synechococcus_phage	50.8	5.4e-05
WP_150882130.1|401121_401322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882131.1|401269_403438_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_150882132.1|403497_404439_-	potassium transporter	NA	NA	NA	NA	NA
WP_150882133.1|404435_405155_-	DUF4079 domain-containing protein	NA	NA	NA	NA	NA
WP_150882134.1|405220_405760_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_150884785.1|405854_408032_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_150882135.1|408069_408858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882136.1|408937_409501_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_150882137.1|409558_410680_-	response regulator	NA	W8CYM9	Bacillus_phage	31.7	6.3e-09
WP_150882138.1|410679_413487_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.9	7.2e-46
WP_150884787.1|413633_414593_+	Red carotenoid-binding protein	NA	NA	NA	NA	NA
WP_150882139.1|414637_415462_+	beta-carotene ketolase	NA	NA	NA	NA	NA
WP_150882140.1|415481_415838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882141.1|415856_416486_-	MarC family protein	NA	NA	NA	NA	NA
WP_150882142.1|416798_418028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882143.1|419624_422189_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_150882144.1|422307_422697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882145.1|423230_423671_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	31.6	2.1e-05
WP_150882146.1|425256_427689_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.1	1.0e-16
WP_150882147.1|428792_429482_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_150882148.1|430666_431777_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
431727:431752	attL	CCTCCAGGGGCGTACGCCCCTGGAGG	NA	NA	NA	NA
WP_150882149.1|432292_432697_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_150882150.1|436298_436736_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_150882151.1|437111_437780_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_150884789.1|438241_438985_-	prohibitin family protein	NA	A0A2I7S9Z3	Vibrio_phage	32.0	2.1e-13
WP_150882152.1|439219_441499_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	31.7	4.2e-52
WP_150882153.1|441875_442094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882154.1|442126_442846_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_150882155.1|443039_443609_+	uridine kinase	NA	NA	NA	NA	NA
WP_150882156.1|443694_443928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882157.1|443980_444616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882158.1|444707_445214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882159.1|445000_446299_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	27.5	2.9e-10
WP_150882160.1|446332_446785_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_150882161.1|447176_449396_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_150882162.1|449446_450304_-	DUF924 domain-containing protein	NA	NA	NA	NA	NA
WP_150882163.1|450772_451018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882164.1|453546_454194_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	51.3	1.5e-52
WP_150882165.1|454272_454779_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882166.1|454565_455780_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	27.5	2.7e-10
WP_150882167.1|456120_457500_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_150882168.1|459283_460395_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
459310:459335	attR	CCTCCAGGGGCGTACGCCCCTGGAGG	NA	NA	NA	NA
WP_150882169.1|460466_460670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882170.1|460836_461928_-	type III polyketide synthase	NA	NA	NA	NA	NA
WP_150882171.1|461918_463127_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_150882172.1|463087_463804_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_150882173.1|464079_464709_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_150884791.1|464802_465129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882174.1|465803_467369_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_150882175.1|467579_468401_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A2I4R668	Erysipelothrix_phage	35.1	8.3e-35
WP_150882176.1|468510_469716_-	beta-lactamase family protein	NA	A0A0Y0A2S9	Mycobacterium_phage	27.6	4.2e-11
WP_150884793.1|470192_470525_-	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_150882177.1|470521_471742_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.0	3.3e-104
WP_150882178.1|471860_473228_-	TolC family protein	NA	NA	NA	NA	NA
WP_150884794.1|473636_474368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882179.1|474382_474943_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_150884795.1|475161_475887_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_150882180.1|475917_476772_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_150882181.1|476921_477131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882182.1|477778_478039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882183.1|478509_479820_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_150884796.1|479750_481010_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_150882184.1|481042_483475_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	2.7e-17
WP_150882185.1|483845_484295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882186.1|484337_484721_-	glutathione metabolism protein	NA	NA	NA	NA	NA
WP_150882187.1|484733_485108_-	VOC family protein	NA	NA	NA	NA	NA
WP_150882188.1|485327_485786_+	DUF2721 domain-containing protein	NA	NA	NA	NA	NA
WP_150882189.1|485839_486829_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_150882190.1|487088_487337_+	high light inducible protein	NA	NA	NA	NA	NA
WP_150882191.1|487391_487826_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A0E3HMC4	Synechococcus_phage	47.6	2.1e-05
WP_150884797.1|488358_489252_+	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	34.6	1.0e-30
WP_150882192.1|489537_490368_+	DUF3598 family protein	NA	NA	NA	NA	NA
WP_150882193.1|490675_490948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882194.1|491050_491809_+	esterase	NA	NA	NA	NA	NA
WP_150882195.1|491729_492590_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_150882196.1|492586_493249_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	25.9	1.5e-07
WP_150882197.1|493245_493518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882198.1|493619_494033_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_150882199.1|494362_494719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882200.1|494757_495018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150884798.1|495065_497531_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP035632	Synechococcus sp. RSCCF101 chromosome, complete genome	2984853	1076870	1168060	2984853	transposase,tRNA,protease	Bacillus_phage(50.0%)	85	NA	NA
WP_150882712.1|1076870_1078418_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	33.2	2.2e-68
WP_150882714.1|1078414_1079641_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_150882716.1|1079570_1080263_-	cofactor assembly of complex C subunit B	NA	NA	NA	NA	NA
WP_150882718.1|1080317_1080722_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_150882720.1|1080759_1081455_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_150882722.1|1081482_1082631_+	proton extrusion protein PcxA	NA	NA	NA	NA	NA
WP_150884881.1|1083219_1083687_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_150882725.1|1083803_1084763_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	58.7	7.4e-27
WP_150882727.1|1084900_1085683_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.6	2.6e-09
WP_150882729.1|1085688_1085952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882731.1|1086089_1086689_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_150884882.1|1086775_1089646_-	UPF0182 family protein	NA	NA	NA	NA	NA
WP_150882733.1|1089766_1090714_+	cupin	NA	NA	NA	NA	NA
WP_150882735.1|1090736_1092845_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.5	6.9e-118
WP_150882737.1|1092794_1092974_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_150882739.1|1092934_1093999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882741.1|1093998_1094334_-	DUF565 domain-containing protein	NA	NA	NA	NA	NA
WP_150882743.1|1094330_1095152_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_150882744.1|1095180_1097103_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	26.6	1.9e-53
WP_150882746.1|1097103_1098489_+	chloride channel protein	NA	NA	NA	NA	NA
WP_150882748.1|1098505_1098613_-	photosystem II reaction center protein Ycf12	NA	NA	NA	NA	NA
WP_150884884.1|1098641_1099100_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_150884883.1|1099111_1099456_+	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_150882750.1|1099503_1099812_+	UPF0016 domain-containing protein	NA	NA	NA	NA	NA
WP_150882752.1|1099881_1102197_+	RNB domain-containing ribonuclease	NA	NA	NA	NA	NA
WP_150882754.1|1102224_1102860_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_150882756.1|1102864_1103407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882758.1|1103494_1103923_+	DUF2996 domain-containing protein	NA	NA	NA	NA	NA
WP_150882760.1|1104022_1105108_+	magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase	NA	NA	NA	NA	NA
WP_150884885.1|1105193_1106630_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_150882761.1|1106632_1107994_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_150882763.1|1108014_1109061_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_150882765.1|1109080_1109503_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_150882767.1|1109681_1110041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882769.1|1110105_1110906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882771.1|1110890_1111811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882773.1|1111797_1112541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882775.1|1112591_1113293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882777.1|1113280_1115218_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_150882779.1|1115229_1116486_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_150882781.1|1116360_1117077_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150882783.1|1117069_1118278_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_150882785.1|1118288_1119515_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_150882787.1|1119621_1122582_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.1	8.7e-34
WP_150882789.1|1122578_1123355_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_150882791.1|1123354_1124077_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150882793.1|1124040_1124616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882795.1|1124630_1127264_+	DUF563 domain-containing protein	NA	NA	NA	NA	NA
WP_150882797.1|1127270_1128344_+	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_150882799.1|1128348_1129653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882801.1|1129756_1130488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882802.1|1130524_1133101_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_150882804.1|1133082_1133355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882805.1|1134475_1135006_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_150882807.1|1134999_1135617_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_150882809.1|1135977_1137384_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.4	7.1e-10
WP_150882811.1|1137383_1137590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150884886.1|1137633_1137861_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882813.1|1139111_1139594_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_150884887.1|1139307_1140111_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882815.1|1140085_1140268_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_150882817.1|1140668_1142552_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_150882819.1|1142536_1143469_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_150882821.1|1143474_1144173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882823.1|1144196_1145030_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_150882825.1|1147078_1147630_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_150882827.1|1147623_1148241_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_150882829.1|1149691_1150012_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882831.1|1153313_1153811_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_150882833.1|1154841_1155657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882835.1|1157280_1157847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882837.1|1157815_1158727_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_150882839.1|1158856_1159726_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150882148.1|1159773_1160884_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150882841.1|1160933_1161251_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882843.1|1161362_1161515_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882845.1|1162031_1162958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882847.1|1163143_1163395_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	38.6	2.7e-05
WP_150882849.1|1163683_1163923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882850.1|1163965_1164862_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882852.1|1164910_1166022_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150882854.1|1165893_1166448_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882856.1|1166579_1166708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882858.1|1166918_1167449_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_150882860.1|1167442_1168060_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP035632	Synechococcus sp. RSCCF101 chromosome, complete genome	2984853	1851809	1958327	2984853	transposase,tRNA	Enterobacteria_phage(19.05%)	84	NA	NA
WP_150883580.1|1851809_1853105_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_150883581.1|1853165_1854296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150883582.1|1854379_1855303_-	N-acetylmuramoyl-L-alanine amidase	NA	R9TL38	Synechococcus_phage	44.1	8.2e-31
WP_150883583.1|1855366_1855723_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_150883584.1|1855673_1856081_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_150883585.1|1856144_1856774_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_150884963.1|1856878_1857265_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_150883586.1|1857261_1857657_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_150883587.1|1857664_1857967_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_150883588.1|1859695_1860043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883589.1|1860534_1861746_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.3	1.7e-105
WP_150883590.1|1862236_1863347_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150883591.1|1864482_1864692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150882038.1|1866944_1867784_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	45.5	4.3e-55
WP_150883592.1|1867780_1869160_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_150883593.1|1871219_1871993_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_150883594.1|1871989_1873015_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_150883595.1|1873975_1874221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150882165.1|1874635_1875142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882159.1|1874928_1876227_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	27.5	2.9e-10
WP_150883596.1|1876323_1876788_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_150883597.1|1876788_1877241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883598.1|1877289_1878401_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150883599.1|1878620_1879190_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_150883600.1|1879144_1879762_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_150883601.1|1880181_1881999_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_150883602.1|1882193_1882808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883603.1|1883379_1883835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883604.1|1884729_1885626_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	34.6	6.1e-15
WP_150882829.1|1885626_1885947_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882165.1|1886125_1886632_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150883605.1|1886595_1887348_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150883606.1|1887396_1888508_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150883607.1|1888379_1888964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150883608.1|1889142_1889937_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150883609.1|1890272_1891706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150883610.1|1892669_1893780_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150884964.1|1894161_1894386_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150883611.1|1894821_1896024_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_150882165.1|1897480_1897987_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882159.1|1897773_1899072_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	27.5	2.9e-10
WP_150883598.1|1899499_1900610_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150883608.1|1900731_1901526_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150883607.1|1901704_1902289_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150882038.1|1903479_1904319_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	45.5	4.3e-55
WP_150883612.1|1904315_1905842_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_150883613.1|1906498_1908208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150883614.1|1908188_1908821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883615.1|1908814_1910461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150883616.1|1910559_1914330_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_150883617.1|1914506_1915484_+	sulfotransferase	NA	NA	NA	NA	NA
WP_150883618.1|1915503_1916634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150883619.1|1916872_1917640_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_150883620.1|1917573_1919895_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_150883621.1|1919951_1921481_+	hypothetical protein	NA	E3T530	Cafeteria_roenbergensis_virus	33.8	6.1e-23
WP_150883622.1|1921491_1922280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883623.1|1922221_1923091_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150883624.1|1923213_1925241_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_150883625.1|1925234_1926854_+	glycosyltransferase family 61 protein	NA	NA	NA	NA	NA
WP_150883626.1|1926888_1928121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883627.1|1928280_1928886_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_150883628.1|1929106_1929754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883629.1|1929753_1932765_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.9	1.0e-34
WP_150883630.1|1932761_1933889_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_150883631.1|1933945_1934791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883632.1|1934757_1935888_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.4	4.3e-90
WP_150883633.1|1935931_1936825_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_150883634.1|1936821_1937451_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.9	1.6e-41
WP_150883635.1|1937440_1938388_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	57.1	1.6e-90
WP_150883636.1|1938568_1939261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883637.1|1939262_1940339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150883638.1|1940377_1941199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150883639.1|1941195_1943019_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	1.3e-08
WP_150883640.1|1942981_1944091_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	3.5e-60
WP_150883641.1|1944087_1946406_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_150883642.1|1946410_1947922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150884965.1|1947908_1949153_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A2H4YF77	Aeromonas_phage	31.8	7.4e-11
WP_150883643.1|1949206_1950193_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	35.3	3.8e-42
WP_150883644.1|1950189_1950783_+	phosphatase	NA	A0A140XBD6	Dickeya_phage	40.0	1.5e-14
WP_150884966.1|1950812_1951640_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_150883645.1|1951636_1952380_-	hypothetical protein	NA	A0A1B1ITS7	uncultured_Mediterranean_phage	40.2	2.8e-34
WP_150883646.1|1952403_1954827_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	35.1	7.0e-98
WP_150883647.1|1954873_1955857_-	GDP-L-fucose synthase	NA	R9S8B8	Prochlorococcus_phage	51.9	5.7e-91
WP_150883648.1|1957385_1958327_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	48.2	9.4e-83
>prophage 4
NZ_CP035632	Synechococcus sp. RSCCF101 chromosome, complete genome	2984853	2004341	2010850	2984853		Prochlorococcus_phage(28.57%)	8	NA	NA
WP_150883727.1|2004341_2005103_+	ribonuclease III	NA	E3T4V2	Cafeteria_roenbergensis_virus	24.9	4.9e-05
WP_150883729.1|2005054_2005900_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	42.1	4.9e-06
WP_150883731.1|2005907_2006093_-	DUF3252 domain-containing protein	NA	M4QFU1	Prochlorococcus_phage	50.0	4.7e-07
WP_150883733.1|2006107_2006674_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_150883735.1|2006733_2008224_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	1.2e-55
WP_150883737.1|2008210_2010136_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1GZ67	Paramecium_bursaria_Chlorella_virus	38.3	1.0e-96
WP_011934551.1|2010228_2010474_-	photosystem I iron-sulfur center protein PsaC	NA	C7EDU4	uncultured_marine_virus	92.6	2.0e-24
WP_150883739.1|2010607_2010850_+	acyl carrier protein	NA	E3SMK8	Prochlorococcus_phage	44.7	3.7e-07
>prophage 5
NZ_CP035632	Synechococcus sp. RSCCF101 chromosome, complete genome	2984853	2223793	2232628	2984853		Catovirus(16.67%)	8	NA	NA
WP_150883960.1|2223793_2224999_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	59.9	1.9e-136
WP_150883961.1|2225229_2225637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150884988.1|2225718_2226528_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_150884989.1|2226608_2227916_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	41.9	6.5e-42
WP_150883963.1|2227924_2228650_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	33.5	9.3e-22
WP_150883965.1|2228646_2230296_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.9	4.9e-18
WP_150883967.1|2230295_2230952_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A0A0RTJ1	Escherichia_phage	35.2	1.6e-12
WP_150883969.1|2230948_2232628_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.0	1.8e-148
>prophage 6
NZ_CP035632	Synechococcus sp. RSCCF101 chromosome, complete genome	2984853	2551702	2561390	2984853		uncultured_virus(16.67%)	9	NA	NA
WP_150884312.1|2551702_2554138_+	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.7	1.7e-64
WP_150885023.1|2554137_2554836_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	46.9	3.4e-29
WP_150885024.1|2554816_2555854_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_150884313.1|2555795_2556569_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	3.7e-37
WP_150885025.1|2556849_2557416_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	4.4e-19
WP_150884314.1|2557534_2557798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006041823.1|2557966_2559022_+	photosystem II D2 protein (photosystem q(a) protein)	NA	A0A1D8KQ83	Synechococcus_phage	95.4	2.8e-200
WP_150884315.1|2559189_2560176_+	pectate lyase	NA	NA	NA	NA	NA
WP_150884316.1|2560355_2561390_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	43.3	5.9e-62
