The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031699	Neisseria animalis strain ATCC 49930 chromosome, complete genome	2236930	554123	628825	2236930	tail,plate,capsid,integrase,terminase,transposase,tRNA	Burkholderia_virus(28.21%)	89	560567:560587	604427:604447
WP_123794680.1|554123_555029_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_123794682.1|555267_557121_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	25.5	6.6e-40
WP_123794684.1|557182_558418_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.5	9.0e-09
WP_162842948.1|558466_560494_+	glycosyltransferase	NA	NA	NA	NA	NA
560567:560587	attL	AGCAAAAAGCCGTCTGTAAAT	NA	NA	NA	NA
WP_123794687.1|560639_561653_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	7.6e-14
WP_162842949.1|561728_561887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123794689.1|561930_562173_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_123794691.1|562169_562556_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_123794693.1|562625_564686_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_126325853.1|564970_565462_-	phage virion morphogenesis protein	NA	A0A0A1IUZ3	Pseudomonas_phage	39.3	3.6e-17
WP_123796440.1|565471_566377_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	48.9	3.3e-61
WP_126325854.1|566373_567879_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	47.7	2.4e-117
WP_066079429.1|568051_569353_-|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	65.1	4.2e-158
WP_066079426.1|569349_569895_-	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	42.5	3.4e-29
WP_066079422.1|569896_570214_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	64.9	1.1e-27
WP_066079419.1|570206_570533_-	hypothetical protein	NA	A4JWP6	Burkholderia_virus	44.9	6.0e-13
WP_066079416.1|570532_570742_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	47.7	4.4e-09
WP_162842978.1|570738_570912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066079412.1|570931_571330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115225457.1|571313_571568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066081431.1|571568_571796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066081436.1|571810_572323_-	TIGR02594 family protein	NA	A0A0A1IUP1	Pseudomonas_phage	63.3	3.9e-59
WP_066081496.1|572406_572625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115225497.1|572919_573570_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	45.2	6.5e-51
WP_162842979.1|573576_574032_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082790477.1|574218_574440_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_115225461.1|574454_574706_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_115225462.1|574715_575003_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066081292.1|575047_575905_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	40.8	1.9e-45
WP_123795579.1|575906_577691_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	48.4	1.0e-146
WP_066077530.1|577687_578830_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	50.5	1.4e-101
WP_066077528.1|578829_579039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123795580.1|579007_579229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066077523.1|579230_579413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123795581.1|579416_579917_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	47.7	8.6e-27
WP_123795582.1|579906_580377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123795583.1|580824_581430_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	56.4	5.1e-58
WP_123795584.1|581432_581618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123795585.1|581663_581939_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	55.1	6.4e-16
WP_123795586.1|582095_582554_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.9	6.5e-21
WP_123795587.1|582550_582904_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_123795588.1|583260_584250_+	2-oxoacid:acceptor oxidoreductase	NA	Q6QIB7	Burkholderia_phage	36.5	1.4e-49
WP_123795589.1|584292_585234_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	36.1	1.5e-40
WP_123795590.1|585284_585617_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_123795591.1|585622_585907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123795592.1|585910_586363_+	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	31.2	3.3e-09
WP_123795593.1|586362_586863_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	31.4	3.6e-17
WP_123795594.1|586874_588266_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	44.4	2.3e-101
WP_123795595.1|588280_588796_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	51.2	9.4e-45
WP_123795596.1|588962_589247_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_123795597.1|589236_589395_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_123795598.1|589369_589660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123795599.1|589706_591197_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_123795600.1|591193_592615_+	hypothetical protein	NA	A4PE52	Ralstonia_virus	29.3	2.1e-25
WP_123795601.1|592712_593609_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_123795692.1|593605_593827_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	33.8	3.3e-07
WP_123795602.1|593854_594979_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	44.0	5.6e-66
WP_123795693.1|594953_595541_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_123795603.1|595885_596263_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_123795604.1|596253_597405_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	44.0	6.7e-67
WP_123795605.1|597408_597987_+|tail	phage tail protein	tail	A4JWL7	Burkholderia_virus	50.8	3.3e-46
WP_162842980.1|598003_600361_+|tail	tail fiber protein	tail	A0A193GYM0	Enterobacter_phage	47.1	8.5e-32
WP_123795606.1|600379_601126_+	DUF4376 domain-containing protein	NA	A0A0R6PGN1	Moraxella_phage	53.8	1.4e-33
WP_123795607.1|601183_601654_+	hypothetical protein	NA	A0A0R6PFI9	Moraxella_phage	48.6	9.6e-28
WP_123795608.1|601844_602027_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_123795695.1|602919_603657_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	56.5	8.4e-79
WP_123795609.1|603733_604084_-	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	43.5	1.4e-20
WP_151090925.1|604694_605542_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
604427:604447	attR	AGCAAAAAGCCGTCTGTAAAT	NA	NA	NA	NA
WP_123794963.1|605658_606198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123794964.1|606505_608398_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_123794965.1|608807_609125_-	porin	NA	NA	NA	NA	NA
WP_126325856.1|609327_610131_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	27.3	9.0e-10
WP_123794966.1|610203_610977_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_123794967.1|611079_611322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123794968.1|611460_611895_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_123794969.1|611898_612558_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_123795147.1|612625_613573_-	TonB family protein	NA	NA	NA	NA	NA
WP_123794970.1|613972_614422_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_123794971.1|614801_615179_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_123794972.1|615396_616554_+	NnrS family protein	NA	NA	NA	NA	NA
WP_123794973.1|616860_617742_-	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_123794974.1|618441_619950_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.7	4.2e-101
WP_123794975.1|620260_620806_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	28.3	1.2e-10
WP_123794976.1|620865_621633_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162842961.1|621629_621779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123795148.1|621780_622650_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_123794977.1|623397_624192_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_123794978.1|624812_627500_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_123794979.1|627811_628825_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP031699	Neisseria animalis strain ATCC 49930 chromosome, complete genome	2236930	1937747	1999275	2236930	tail,plate,capsid,tRNA	Pseudomonas_phage(29.41%)	54	NA	NA
WP_123794766.1|1937747_1938527_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_123794764.1|1938758_1939223_+	universal stress protein	NA	NA	NA	NA	NA
WP_123794762.1|1939482_1939650_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_123794761.1|1940101_1941778_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	27.1	9.3e-33
WP_123794757.1|1944788_1945349_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_123794755.1|1945999_1948231_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_123794753.1|1948465_1948945_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_123794751.1|1949043_1949721_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_162842952.1|1949825_1950530_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_123794747.1|1950599_1952765_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_123794745.1|1952761_1953982_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_123794743.1|1954069_1955131_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_123794741.1|1955235_1955769_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_123794739.1|1956377_1957163_+	hypothetical protein	NA	A0A0U1T6E4	Pseudomonas_phage	43.6	1.8e-31
WP_164715652.1|1957198_1962877_+	hypothetical protein	NA	A0A0U1T6E4	Pseudomonas_phage	45.0	4.5e-39
WP_123796389.1|1963032_1963671_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_123796388.1|1963705_1964332_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_123796387.1|1964353_1964857_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_123796386.1|1965073_1965676_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_123796385.1|1966005_1967139_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_123796390.1|1967341_1967959_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_123796384.1|1968161_1970015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123796383.1|1970303_1970885_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_123796382.1|1970895_1971744_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_162843015.1|1972144_1973173_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.7	8.5e-45
WP_123796380.1|1973253_1973826_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_123796379.1|1974117_1974600_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_123796378.1|1974751_1975888_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_123796377.1|1976575_1978051_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_123796376.1|1978080_1978494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796375.1|1978626_1979451_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_123796374.1|1979520_1980168_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_123796373.1|1980203_1981445_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.2	5.4e-78
WP_123796372.1|1981850_1982303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123796371.1|1982355_1982946_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_123796370.1|1982955_1983153_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_123796442.1|1983366_1983693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162843018.1|1983717_1984485_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	57.0	5.7e-78
WP_123796416.1|1984535_1984643_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_123796417.1|1984778_1985990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796418.1|1985990_1986452_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	49.1	8.8e-34
WP_123796419.1|1986452_1987064_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_123796420.1|1987081_1989589_-	right-handed parallel beta-helix repeat-containing protein	NA	W8JPQ4	Salmonella_phage	56.7	4.2e-13
WP_126325836.1|1989589_1990168_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	48.7	3.3e-46
WP_123796425.1|1990160_1991327_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	42.0	1.5e-61
WP_123796424.1|1991317_1991695_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_123796423.1|1991773_1992352_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	40.7	2.1e-24
WP_123796422.1|1992335_1993436_-	hypothetical protein	NA	A4JWL3	Burkholderia_virus	44.6	5.4e-74
WP_123796421.1|1993446_1993665_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	38.2	6.0e-09
WP_126325837.1|1993661_1994558_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_126325843.1|1994557_1996225_-|tail	phage tail tape measure protein	tail	A7YGZ1	Campylobacter_phage	35.4	2.0e-35
WP_126325839.1|1996454_1997927_+	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	45.0	4.5e-108
WP_123796437.1|1997926_1998832_+|capsid	minor capsid protein	capsid	H6V8N8	Pseudomonas_phage	46.5	6.9e-59
WP_123796436.1|1998834_1999275_+	phage virion morphogenesis protein	NA	X4YTG5	Pseudomonas_phage	45.1	1.0e-23
>prophage 3
NZ_CP031699	Neisseria animalis strain ATCC 49930 chromosome, complete genome	2236930	2084555	2157581	2236930	holin,tail,plate,capsid	Pseudomonas_phage(20.0%)	68	NA	NA
WP_123796014.1|2084555_2084975_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_123796013.1|2084952_2085201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123796012.1|2085430_2086549_+	porin	NA	NA	NA	NA	NA
WP_123796011.1|2086685_2088062_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_123796010.1|2088373_2088664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796009.1|2089157_2089637_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_123796008.1|2089876_2094235_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_123796007.1|2094349_2096347_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_123796006.1|2096557_2099038_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	49.4	1.9e-18
WP_123796005.1|2099976_2100453_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_123796004.1|2100722_2101409_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_123796003.1|2101666_2103043_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_123796002.1|2103166_2103538_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_123796001.1|2103753_2105061_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_123796000.1|2105053_2105491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123795999.1|2105898_2107083_-	sugar transporter	NA	NA	NA	NA	NA
WP_123795998.1|2107518_2107743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162842998.1|2107753_2107927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123795997.1|2107928_2108645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123795996.1|2108653_2109100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162842995.1|2109156_2109318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162842994.1|2109319_2109481_-	hypothetical protein	NA	A0A0M3LQ94	Mannheimia_phage	59.0	9.2e-07
WP_162842997.1|2109558_2109708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123795995.1|2109959_2110235_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_123795994.1|2110212_2110497_+	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	56.8	7.3e-07
WP_123795993.1|2110783_2111572_+	KilA-N domain-containing protein	NA	A0A2H4IZE1	uncultured_Caudovirales_phage	44.6	3.5e-22
WP_126325841.1|2111622_2120289_-	hypothetical protein	NA	A0A0U1T6E4	Pseudomonas_phage	45.0	6.9e-39
WP_123796326.1|2120359_2121241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796325.1|2121267_2121915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796324.1|2121914_2122139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162843012.1|2122356_2122506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796323.1|2122594_2123176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162843011.1|2123192_2123366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796322.1|2123448_2124432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796321.1|2124443_2125430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126325840.1|2125581_2125857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162843010.1|2126069_2126246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796319.1|2126344_2126572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123796318.1|2126564_2127014_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_123796317.1|2127099_2127285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796316.1|2127298_2127736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796314.1|2128506_2130060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123796313.1|2130104_2132138_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_123796312.1|2132353_2133703_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.4	2.3e-50
WP_123796311.1|2134128_2135070_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_123796310.1|2135209_2136058_+	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_123796309.1|2136134_2137457_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_123796308.1|2137557_2138277_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_123796307.1|2138368_2139556_+	acetylornithine/succinyldiaminopimelate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.2	6.4e-28
WP_123796306.1|2139646_2140483_+	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_123796305.1|2140601_2141984_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.3	1.0e-48
WP_123796304.1|2142070_2143375_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_123796436.1|2143759_2144200_-	phage virion morphogenesis protein	NA	X4YTG5	Pseudomonas_phage	45.1	1.0e-23
WP_123796437.1|2144202_2145108_-|capsid	minor capsid protein	capsid	H6V8N8	Pseudomonas_phage	46.5	6.9e-59
WP_126325839.1|2145107_2146580_-	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	45.0	4.5e-108
WP_126325843.1|2146809_2148477_+|tail	phage tail tape measure protein	tail	A7YGZ1	Campylobacter_phage	35.4	2.0e-35
WP_126325837.1|2148476_2149373_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_123796421.1|2149369_2149588_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	38.2	6.0e-09
WP_123796422.1|2149598_2150699_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	44.6	5.4e-74
WP_123796423.1|2150682_2151261_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	40.7	2.1e-24
WP_123796424.1|2151339_2151717_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_123796425.1|2151707_2152874_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	42.0	1.5e-61
WP_126325844.1|2152866_2153445_+|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	48.7	5.6e-46
WP_123796430.1|2153445_2155458_+	hypothetical protein	NA	R9TNJ7	Vibrio_phage	58.1	1.2e-07
WP_123796431.1|2155466_2156063_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_123796432.1|2156062_2156521_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	48.1	9.6e-33
WP_123796416.1|2156655_2156763_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_162843018.1|2156813_2157581_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	57.0	5.7e-78
