The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038018	Eikenella exigua strain PXX chromosome, complete genome	1953244	78362	87488	1953244	integrase	Enterobacteria_phage(22.22%)	15	74412:74429	92664:92681
74412:74429	attL	AAAGGCTACCTGAAAATA	NA	NA	NA	NA
WP_151085892.1|78362_79580_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	39.7	2.4e-70
WP_067442183.1|79881_80082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082886566.1|80101_80275_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	51.2	9.3e-05
WP_156496454.1|80402_80576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067442185.1|80597_80909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082886568.1|80942_81170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085895.1|81236_81407_-	helix-turn-helix domain-containing protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	56.2	6.3e-06
WP_067442187.1|81514_82216_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	38.7	2.9e-36
WP_151085897.1|83468_83801_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_067442194.1|83876_84167_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	40.7	4.1e-13
WP_067442200.1|84214_84562_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	44.0	4.1e-20
WP_067442196.1|84554_84812_-	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	46.2	1.1e-12
WP_067442198.1|85231_85543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067528328.1|86507_87008_+	TIGR02594 family protein	NA	A0A1L2C8R8	Pseudomonas_phage	56.5	3.5e-52
WP_067443937.1|87047_87488_-	transcriptional regulator	NA	J9Q7G7	Salmonella_phage	42.8	4.3e-22
92664:92681	attR	TATTTTCAGGTAGCCTTT	NA	NA	NA	NA
>prophage 2
NZ_CP038018	Eikenella exigua strain PXX chromosome, complete genome	1953244	161112	245454	1953244	terminase,tRNA,integrase,protease,tail,capsid,plate,transposase	Burkholderia_phage(23.81%)	102	215171:215196	238059:238084
WP_067442825.1|161112_161598_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_067442784.1|161810_165272_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_067442785.1|165337_166105_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_067442787.1|166333_167476_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_067442789.1|167480_168032_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_067444130.1|168281_169010_-	TIGR02117 family protein	NA	NA	NA	NA	NA
WP_067444132.1|169079_170042_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_151085919.1|170178_170520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067444134.1|170662_171439_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_023887998.1|171556_172021_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_067444136.1|172024_173056_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_067442803.1|173129_173633_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_067444138.1|173642_176039_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_067442826.1|176042_177386_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_067442808.1|177659_178844_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_067442809.1|179151_179796_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167508191.1|179964_180990_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_067442812.1|180982_182371_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_151085925.1|182360_182783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067442814.1|182828_183485_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	35.0	2.0e-07
WP_067444142.1|183715_184222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151085928.1|184290_185745_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.1	5.7e-47
WP_151085930.1|185959_186601_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_151085932.1|186841_187777_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_067444150.1|187949_188171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067440321.1|188171_188477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067444152.1|188550_188868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067444154.1|189073_191281_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_067440331.1|191560_192073_+	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	53.4	2.7e-36
WP_151085934.1|192098_192356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082880675.1|192372_192894_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.5	1.3e-09
WP_067440333.1|193044_193242_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_023888029.1|193255_193612_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_067440335.1|194536_194959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067440339.1|195087_195312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067444156.1|195311_196697_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_067440344.1|197113_197656_-	5'-3'-deoxyribonucleotidase	NA	A0A2R8FEB6	Brazilian_cedratvirus	36.7	4.8e-07
WP_067440349.1|197847_198654_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_067440352.1|199059_200181_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_067440353.1|200269_201100_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	29.9	1.5e-15
WP_067440357.1|201103_202078_-	serine hydrolase	NA	A0A0Y0A2S9	Mycobacterium_phage	32.1	2.5e-14
WP_067440359.1|202237_203128_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_067444158.1|203234_204752_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_067440366.1|204949_205351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067440367.1|205996_207154_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_067440370.1|207305_207878_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_067440373.1|208011_208779_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_151085936.1|209268_210081_-	DNA adenine methylase	NA	A0A2H4J8Q1	uncultured_Caudovirales_phage	47.2	3.3e-60
WP_151085938.1|210049_210232_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_151085941.1|210398_210884_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	45.9	1.5e-31
WP_151085943.1|210880_211516_-	DUF4376 domain-containing protein	NA	A0A0R6PGN1	Moraxella_phage	58.5	4.9e-35
WP_167508192.1|211529_212246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023887382.1|213037_213616_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	54.9	4.7e-53
WP_151085948.1|213619_214762_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	42.4	1.5e-63
WP_067446614.1|214764_215142_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
215171:215196	attL	GGGTCTTTTAAACGGGTTTAAAAAAC	NA	NA	NA	NA
WP_067446616.1|215270_215882_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	31.2	1.2e-09
WP_082880667.1|215868_217005_-	hypothetical protein	NA	A4JWL3	Burkholderia_virus	44.1	2.9e-70
WP_067446619.1|216997_217246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085950.1|217242_218142_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	41.1	7.2e-24
WP_067446624.1|218122_220666_-|tail	phage tail tape measure protein	tail	A0A1B2LRQ0	Wolbachia_phage	39.9	1.3e-75
WP_064104199.1|221031_221319_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	42.5	2.2e-06
WP_067446626.1|221460_221976_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	51.5	3.1e-40
WP_067446628.1|221990_223388_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.4	2.6e-97
WP_067446630.1|223397_223895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023888047.1|223894_224335_-	DUF1320 domain-containing protein	NA	A0A1B0T6F3	Thiobacimonas_phage	34.9	7.1e-09
WP_067446632.1|224338_224704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067446634.1|224706_225048_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_064087602.1|225099_226035_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	42.8	1.7e-52
WP_151085953.1|226068_227172_-	2-oxoacid:acceptor oxidoreductase	NA	Q6QIB7	Burkholderia_phage	43.4	1.4e-66
WP_023888052.1|227373_227745_-	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	47.6	2.6e-20
WP_067446638.1|227741_228218_-	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	44.4	6.7e-21
WP_067446640.1|228275_228551_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	51.1	5.4e-15
WP_151085957.1|228599_228797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085960.1|228801_229689_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	37.5	3.3e-45
WP_064087596.1|229691_230318_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	48.7	4.8e-51
WP_064087595.1|230289_230706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064087594.1|230715_231222_-	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	45.5	4.2e-29
WP_156502918.1|231218_231368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067446648.1|231646_231922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023888069.1|231927_232071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151085963.1|232072_233212_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	48.2	1.1e-96
WP_064087623.1|233213_234980_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	46.8	1.0e-143
WP_067446652.1|234995_235841_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	40.9	2.9e-43
WP_064104182.1|235875_236163_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064104181.1|236174_236366_-	DNA-binding protein	NA	A0A0S4L0D0	Pseudomonas_phage	56.7	3.0e-12
WP_064104180.1|236474_236855_+	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	43.1	2.9e-19
WP_151085967.1|236873_237428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081253947.1|237448_238039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151085969.1|238139_238670_+	N-acetylmuramoyl-L-alanine amidase	NA	E5EYD9	Acinetobacter_phage	49.7	7.2e-40
238059:238084	attR	GTTTTTTAAACCCGTTTAAAAGACCC	NA	NA	NA	NA
WP_151085971.1|238666_238846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151085973.1|238842_239109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151085976.1|239113_239488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081251814.1|239492_239675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064087581.1|239653_239884_+	hypothetical protein	NA	A0A0M3LS11	Mannheimia_phage	51.6	7.0e-08
WP_064104242.1|239886_240210_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	43.3	1.2e-10
WP_009425424.1|240206_240512_+	hypothetical protein	NA	Q5ZQY7	Pseudomonas_phage	60.4	2.5e-29
WP_151085978.1|240514_241066_+	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	40.9	1.3e-31
WP_151085980.1|241062_242364_+|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	63.2	7.4e-155
WP_151085982.1|242365_243859_+	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	49.3	1.2e-121
WP_151085984.1|243855_244761_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	48.9	2.7e-63
WP_151085987.1|244766_244976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126983221.1|244968_245454_+	phage virion morphogenesis protein	NA	L7P7T2	Pseudomonas_phage	39.9	7.1e-18
>prophage 3
NZ_CP038018	Eikenella exigua strain PXX chromosome, complete genome	1953244	687240	725135	1953244	terminase,integrase,head,tail,capsid,plate,transposase	Haemophilus_phage(18.75%)	56	682591:682610	726572:726591
682591:682610	attL	ATATTTTTCAGGTAGCCTCT	NA	NA	NA	NA
WP_067439422.1|687240_687858_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	45.6	6.2e-27
WP_151086130.1|687979_688372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086132.1|688564_689392_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	49.6	6.5e-80
WP_082881522.1|689348_689552_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_067527973.1|689709_690186_-	cytoplasmic protein	NA	A0A0R6PFI9	Moraxella_phage	50.0	3.0e-29
WP_151086134.1|690188_690818_-	DUF4376 domain-containing protein	NA	A0A0R6PGN1	Moraxella_phage	56.8	1.2e-33
WP_067529768.1|692257_692821_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	37.8	1.4e-28
WP_151086136.1|692817_693873_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	42.8	5.4e-71
WP_151086138.1|693869_694223_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	54.7	4.1e-23
WP_151086141.1|694269_694899_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	45.8	2.1e-46
WP_067527328.1|694916_696044_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	41.9	3.7e-78
WP_151086143.1|696027_697392_-	hypothetical protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	32.3	9.5e-44
WP_082881531.1|697395_697707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086145.1|699515_699734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086147.1|699739_700132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086149.1|700232_700871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049249282.1|700884_701259_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	51.6	4.2e-26
WP_151086152.1|701270_702695_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	45.9	3.0e-93
WP_064105057.1|702694_702892_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_151086154.1|703013_703565_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	41.8	8.0e-26
WP_064105087.1|703548_703968_-	DUF1320 family protein	NA	G8GWF0	Rhodobacter_phage	39.4	2.0e-13
WP_151086157.1|703967_704447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064089153.1|704500_705415_-|head	head protein	head	A0A0A1IWZ9	Pseudomonas_phage	59.9	3.8e-105
WP_151086159.1|705427_706558_-	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	40.4	1.1e-56
WP_064089155.1|706770_707346_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	35.7	1.8e-15
WP_151086161.1|707448_708786_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	40.9	2.5e-44
WP_151086163.1|708775_710365_-	DUF935 family protein	NA	A0A0M3LRU4	Mannheimia_phage	46.7	2.6e-125
WP_167508166.1|710450_712079_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	64.4	5.2e-198
WP_151086166.1|712091_712592_+	hypothetical protein	NA	J7HXA3	Pseudomonas_phage	30.1	4.3e-10
WP_167508167.1|712604_712796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151086170.1|712792_713293_-	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	56.6	2.2e-46
WP_151086172.1|713309_713543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167508168.1|713539_713821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086177.1|713810_714170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167508169.1|714162_714363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086179.1|714364_714799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167508194.1|714773_715109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086182.1|715215_715746_-	N-acetylmuramoyl-L-alanine amidase	NA	E5EYD9	Acinetobacter_phage	50.6	1.5e-37
WP_067525833.1|715824_716295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086186.1|716284_716701_-	DUF1018 domain-containing protein	NA	A0A0M5MRZ7	Ralstonia_phage	45.5	3.7e-23
WP_151086188.1|716765_717041_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	45.6	6.6e-13
WP_151086190.1|717117_717318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086193.1|717322_718207_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	39.3	2.2e-41
WP_151086195.1|718196_718511_-	hypothetical protein	NA	K7ZPX9	Xanthomonas_citri_phage	41.8	8.4e-12
WP_151086198.1|718523_718757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064105034.1|718758_719298_-	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	47.8	9.0e-30
WP_151086200.1|719291_719681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086203.1|719646_720177_-	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	52.5	6.8e-30
WP_151086205.1|720173_720491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086208.1|720493_720721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086211.1|720880_721174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153716906.1|721173_721326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081258778.1|721344_722205_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	47.2	1.5e-66
WP_167508170.1|722300_724319_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	40.4	6.2e-132
WP_067527395.1|724311_724791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067527397.1|724856_725135_-	DNA-binding protein	NA	A0A0C4UQU0	Shigella_phage	55.6	1.8e-13
726572:726591	attR	AGAGGCTACCTGAAAAATAT	NA	NA	NA	NA
>prophage 4
NZ_CP038018	Eikenella exigua strain PXX chromosome, complete genome	1953244	856979	867555	1953244	protease	uncultured_Mediterranean_phage(28.57%)	9	NA	NA
WP_067439099.1|856979_857951_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	R9S8D5	Prochlorococcus_phage	26.3	1.7e-15
WP_067439096.1|858071_858767_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_067439093.1|858905_859982_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	36.2	4.8e-06
WP_151086240.1|860074_860554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067439090.1|860555_862499_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	1.9e-61
WP_067444764.1|862586_864047_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.2	5.4e-21
WP_003822547.1|864296_864500_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	80.9	3.6e-24
WP_067439084.1|864948_865254_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	1.3e-12
WP_151086242.1|865257_867555_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	40.4	3.7e-157
>prophage 5
NZ_CP038018	Eikenella exigua strain PXX chromosome, complete genome	1953244	1217907	1223705	1953244	capsid	Acinetobacter_phage(33.33%)	9	NA	NA
WP_067438309.1|1217907_1218408_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	51.6	7.2e-50
WP_067438306.1|1218530_1218977_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	35.1	5.9e-11
WP_067438300.1|1219456_1220086_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_067444980.1|1220236_1220722_-	phage virion morphogenesis protein	NA	L7P7T2	Pseudomonas_phage	37.0	3.3e-15
WP_067439639.1|1220724_1221630_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	47.7	4.8e-60
WP_067438294.1|1221743_1221923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086305.1|1221919_1222243_-	N-acetylmuramoyl-L-alanine amidase	NA	E5EYD9	Acinetobacter_phage	44.9	2.3e-20
WP_082886393.1|1222741_1222924_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_151086308.1|1222892_1223705_+	DNA adenine methylase	NA	A0A2H4J8Q1	uncultured_Caudovirales_phage	47.6	1.1e-60
>prophage 6
NZ_CP038018	Eikenella exigua strain PXX chromosome, complete genome	1953244	1250079	1255921	1953244	integrase	Escherichia_phage(16.67%)	7	1239846:1239860	1251326:1251340
1239846:1239860	attL	ACAACATCCGCGAAG	NA	NA	NA	NA
WP_067438235.1|1250079_1251147_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	46.3	3.8e-88
WP_067439632.1|1251538_1252597_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	28.3	1.3e-19
1251326:1251340	attR	CTTCGCGGATGTTGT	NA	NA	NA	NA
WP_067438231.1|1252616_1253255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067445003.1|1253445_1253880_-	single-stranded DNA-binding protein	NA	A0A1J0MFD7	Staphylococcus_phage	38.4	1.1e-09
WP_067445005.1|1253876_1254503_-	hypothetical protein	NA	S0A2A9	Cellulophaga_phage	45.9	3.5e-41
WP_067438223.1|1254499_1255015_-	hypothetical protein	NA	A0A0F7L6F4	uncultured_marine_virus	35.5	6.0e-15
WP_082886389.1|1255075_1255921_-	KilA-N domain-containing protein	NA	A0A0R6PDL1	Moraxella_phage	52.5	1.3e-27
>prophage 7
NZ_CP038018	Eikenella exigua strain PXX chromosome, complete genome	1953244	1260870	1270445	1953244		Pseudomonas_phage(37.5%)	19	NA	NA
WP_067438197.1|1260870_1261494_-	helix-turn-helix domain-containing protein	NA	A0A0R6PJ00	Moraxella_phage	35.4	8.5e-24
WP_067438194.1|1261601_1261790_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_067438191.1|1261786_1261981_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_067438187.1|1262013_1262328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067438184.1|1262348_1262555_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_067438181.1|1262712_1262919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067438178.1|1262982_1263696_+	hypothetical protein	NA	A0A0U4J8Z7	Pseudomonas_phage	45.9	2.7e-42
WP_151086321.1|1263783_1264734_+	helix-turn-helix domain-containing protein	NA	A0A1B0YZZ0	Pseudomonas_phage	35.2	1.3e-07
WP_067438172.1|1264730_1265396_+	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	36.7	1.3e-17
WP_067438169.1|1265397_1265598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067438166.1|1265584_1265818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067438163.1|1265804_1266359_+	hypothetical protein	NA	Q7Y5V6	Haemophilus_phage	51.8	7.8e-29
WP_067438161.1|1266355_1266778_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.9	1.7e-28
WP_156496273.1|1266778_1266934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151086323.1|1266935_1267433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067438156.1|1267552_1268581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067438152.1|1268632_1269223_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	30.9	1.6e-08
WP_151086325.1|1269359_1269566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082886385.1|1269587_1270445_+	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	40.6	6.8e-32
>prophage 8
NZ_CP038018	Eikenella exigua strain PXX chromosome, complete genome	1953244	1472969	1482074	1953244	tRNA	Tupanvirus(14.29%)	10	NA	NA
WP_067441026.1|1472969_1473566_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.9	4.5e-22
WP_067444071.1|1473704_1475399_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	61.5	4.0e-201
WP_067441032.1|1475547_1475967_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_067441035.1|1476101_1477316_+	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	37.3	3.9e-33
WP_067441038.1|1477724_1478108_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.8e-53
WP_067441041.1|1478110_1478377_+	DksA/TraR family C4-type zinc finger protein	NA	K4F9U1	Cronobacter_phage	50.0	8.9e-15
WP_067444073.1|1478628_1478871_+	recombinase RecA	NA	NA	NA	NA	NA
WP_049257904.1|1478927_1479248_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	7.0e-22
WP_067444077.1|1479350_1479971_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_067444078.1|1480037_1482074_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	43.1	4.5e-114
>prophage 9
NZ_CP038018	Eikenella exigua strain PXX chromosome, complete genome	1953244	1881087	1930904	1953244	portal,terminase,tRNA,integrase,head,protease,capsid,tail	Pseudomonas_phage(18.52%)	56	1876947:1876965	1936859:1936877
1876947:1876965	attL	AAACAGGCTACCTGAAAAC	NA	NA	NA	NA
WP_067440278.1|1881087_1881783_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_067439778.1|1882027_1882468_-	MliC family protein	NA	NA	NA	NA	NA
WP_067444319.1|1882722_1883361_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_151086468.1|1883490_1884072_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	38.6	2.2e-26
WP_151086470.1|1884219_1885860_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_067444316.1|1885912_1886476_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A223VZK2	Agrobacterium_phage	30.2	7.7e-08
WP_067439765.1|1886531_1887026_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_067439763.1|1887226_1889332_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_156496427.1|1889543_1889714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086473.1|1889827_1892023_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_151086475.1|1892323_1893364_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_067439757.1|1893455_1894604_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	48.4	3.0e-99
WP_151086478.1|1894688_1894880_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_151086480.1|1894966_1895383_+	HicB family protein	NA	A0A0D4DCG1	Acinetobacter_phage	35.9	5.7e-16
WP_151086483.1|1895436_1896237_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	52.7	3.7e-80
WP_151086485.1|1896337_1896835_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_167508202.1|1896841_1896964_-	photosystem I reaction center subunit PsaK	NA	NA	NA	NA	NA
WP_167508187.1|1897085_1897250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086487.1|1897251_1897800_-	TIGR02594 family protein	NA	A0A060RFI8	Pseudomonas_phage	50.8	1.4e-49
WP_151086330.1|1898119_1898383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086489.1|1898370_1898760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067445017.1|1898756_1898999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086491.1|1898995_1899700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086494.1|1900567_1901602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086496.1|1901650_1903588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167508188.1|1903571_1903904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082887875.1|1903940_1907186_-	DUF1983 domain-containing protein	NA	Q9FZU3	Neisseria_meningitidis_phage	57.5	8.6e-285
WP_151086500.1|1907195_1907927_-|tail	tail assembly protein	tail	Q9FZU4	Neisseria_meningitidis_phage	56.2	3.4e-64
WP_067523948.1|1907923_1908661_-	C40 family peptidase	NA	Q9FZU5	Neisseria_meningitidis_phage	48.5	5.7e-59
WP_151086502.1|1908672_1909398_-|tail	phage minor tail protein L	tail	Q9FZU6	Neisseria_meningitidis_phage	63.2	4.7e-66
WP_067442220.1|1909394_1909730_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	43.5	1.3e-18
WP_151086505.1|1909731_1913019_-|tail	phage tail protein	tail	A0A2R9YJM8	Escherichia_phage	24.1	6.7e-43
WP_067442223.1|1913011_1913284_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	44.6	1.2e-11
WP_067442225.1|1913331_1913646_-	hypothetical protein	NA	A0A192Y8C0	Enterobacteria_phage	33.0	2.5e-08
WP_067442227.1|1913659_1914307_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	43.2	9.7e-47
WP_067448243.1|1914395_1914737_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_067442229.1|1914717_1915194_-	hypothetical protein	NA	A0A0R6PGZ1	Moraxella_phage	35.2	8.8e-05
WP_151086507.1|1915194_1915515_-|head	phage head closure protein	head	Q6JIM4	Burkholderia_virus	37.4	1.6e-10
WP_067448249.1|1915575_1915854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086509.1|1916218_1917130_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	48.8	5.0e-33
WP_064084338.1|1917175_1917448_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_151086513.1|1917434_1917827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067442237.1|1917881_1919126_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	53.8	5.5e-115
WP_151086516.1|1919188_1919962_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	62.0	2.8e-61
WP_151086518.1|1919927_1921181_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	48.4	1.7e-100
WP_151086520.1|1921177_1922851_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	52.7	1.6e-157
WP_151086522.1|1922838_1923567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151086525.1|1923702_1924065_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	66.2	9.6e-28
WP_067442247.1|1924206_1924602_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_151086527.1|1925008_1927891_-	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	31.3	1.1e-76
WP_067442249.1|1928039_1928585_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	52.6	3.7e-23
WP_082880709.1|1928597_1928825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067442253.1|1928936_1929629_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	36.0	2.0e-29
WP_067442255.1|1929810_1930044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151086529.1|1930040_1930529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151086588.1|1930547_1930904_+	hypothetical protein	NA	C5IHK2	Burkholderia_virus	39.3	1.6e-06
1936859:1936877	attR	AAACAGGCTACCTGAAAAC	NA	NA	NA	NA
