The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	930852	1007527	3815016	plate,holin,integrase,portal,head,terminase,transposase,tail,capsid	uncultured_Caudovirales_phage(32.35%)	86	936207:936222	1016240:1016255
WP_151000587.1|930852_932004_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	65.3	1.1e-146
WP_171492999.1|932030_932207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000589.1|932209_932428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000590.1|932424_932919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000592.1|932929_933283_-	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	65.8	3.2e-36
WP_151000593.1|933343_933844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000595.1|933840_934167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000597.1|934166_936905_-	toprim domain-containing protein	NA	A0A2H4JDT6	uncultured_Caudovirales_phage	58.2	0.0e+00
936207:936222	attL	TGCCCAACGTAAACGT	NA	NA	NA	NA
WP_151000598.1|936904_937144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000600.1|937194_937386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000602.1|937485_937812_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_137311810.1|937867_938074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000604.1|938176_938992_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	73.2	2.5e-31
WP_171493000.1|939194_939356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000608.1|939506_940010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000610.1|940020_940455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000612.1|940655_941027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000614.1|941023_941314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004996123.1|941368_941569_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_004670219.1|941561_941813_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_151000616.1|941969_943283_-	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	43.8	1.0e-95
WP_151000618.1|943282_943723_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	54.1	4.6e-40
WP_151000620.1|943731_946188_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	48.4	1.3e-192
WP_110135493.1|946200_946341_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_151000622.1|946346_946685_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	45.7	2.3e-15
WP_151000624.1|946755_947271_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	64.3	7.9e-60
WP_151000626.1|947281_948454_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q9ZXK4	Pseudomonas_virus	71.7	9.3e-157
WP_151000628.1|948562_950773_-|tail	phage tail protein	tail	A0A2H4JEU4	uncultured_Caudovirales_phage	45.9	2.4e-28
WP_151000631.1|950788_951397_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	40.7	1.2e-27
WP_151000633.1|951393_952299_-|plate	baseplate J/gp47 family protein	plate	A0A0F7LCQ9	Escherichia_phage	46.8	1.9e-72
WP_151000635.1|952295_952643_-	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	55.3	3.6e-24
WP_151000839.1|952642_953266_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	42.0	8.0e-22
WP_151000636.1|953343_953793_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	49.0	2.3e-31
WP_151000638.1|953789_954317_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	52.2	2.7e-39
WP_151000640.1|954313_955171_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	42.6	4.1e-53
WP_110135469.1|955167_955461_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_151000642.1|955457_955850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000644.1|955861_956074_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	59.1	2.2e-16
WP_151000646.1|956066_956309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000648.1|956305_956770_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	42.9	8.0e-19
WP_151000650.1|956873_957641_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	32.9	7.8e-27
WP_151000652.1|957651_958641_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	53.4	4.0e-92
WP_151000654.1|958693_959527_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	49.1	4.0e-53
WP_151000656.1|959685_961473_+|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	59.0	1.4e-204
WP_151000659.1|961472_962462_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	53.5	9.8e-99
WP_151000661.1|962470_962821_+	hypothetical protein	NA	A0A1W6DXZ5	Salmonella_phage	61.5	2.7e-27
WP_151000663.1|962831_963338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000665.1|964068_964392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000667.1|964720_965950_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	40.0	3.9e-73
WP_076612069.1|966577_967667_+|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_000153154.1|968263_968479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001016479.1|968481_968691_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_039098651.1|969233_969599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001064707.1|970028_970307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032023440.1|970318_972784_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	27.4	1.9e-50
WP_151000669.1|973115_973319_+	single-stranded DNA-binding protein	NA	A0A2I7R2S3	Vibrio_phage	63.0	1.6e-08
WP_151000671.1|973455_974916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270969.1|974917_976137_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.2	4.8e-79
WP_000560651.1|976552_977227_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000642900.1|977226_977415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000673.1|977559_978135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171493001.1|978250_978667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000675.1|978748_979375_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_151000677.1|979379_979643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000679.1|979648_980083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000681.1|980143_980368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040037.1|980408_981341_-|transposase	IS5-like element ISAha2 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.9e-59
WP_000593238.1|983631_984087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017725301.1|984197_984386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079267121.1|984322_984949_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000675273.1|985114_985399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016654323.1|986049_987396_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_002058307.1|987473_988859_-	MFS transporter	NA	NA	NA	NA	NA
WP_000050871.1|989031_989976_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_002058305.1|990163_991054_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000061132.1|991068_991344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001115353.1|991664_992372_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_001271336.1|994464_995799_-	amino acid permease	NA	NA	NA	NA	NA
WP_000697115.1|995804_996683_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_000188090.1|996899_997370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714073.1|997461_999102_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001021934.1|999613_1001272_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
WP_002058314.1|1001367_1002840_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001985959.1|1002832_1003468_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000243373.1|1003720_1005343_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.3	3.9e-20
WP_000179784.1|1005460_1007527_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
1016240:1016255	attR	ACGTTTACGTTGGGCA	NA	NA	NA	NA
>prophage 2
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	1121943	1141889	3815016	terminase,transposase,capsid	Acinetobacter_phage(55.0%)	32	NA	NA
WP_038347500.1|1121943_1122228_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	98.9	1.5e-44
WP_000566317.1|1122224_1122554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000043824.1|1122554_1122851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001207472.1|1122879_1124001_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	98.4	2.6e-209
WP_151000692.1|1124012_1124336_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	90.7	6.1e-50
WP_000656408.1|1124328_1124619_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	97.9	4.6e-49
WP_000187985.1|1125288_1126080_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	52.1	1.4e-10
WP_151000694.1|1126082_1126331_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH31	Moraxella_phage	58.6	8.0e-18
WP_001289843.1|1126385_1126886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044696544.1|1126935_1127256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000697.1|1127252_1128806_+	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	41.7	7.1e-136
WP_064713902.1|1128802_1129753_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	63.9	1.5e-99
WP_078177514.1|1129745_1130495_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	97.6	9.9e-136
WP_000017854.1|1130491_1130899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125498772.1|1130895_1131303_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.4	1.0e-25
WP_125498770.1|1131289_1131505_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	44.6	8.0e-06
WP_002066642.1|1131504_1131900_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	8.8e-67
WP_171493002.1|1131896_1132418_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	81.8	1.5e-77
WP_002125181.1|1132554_1132794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002125179.1|1132864_1133083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000048856.1|1133223_1133451_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_002125176.1|1133474_1133714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119891094.1|1133756_1134404_+|transposase	transposase	transposase	A0A0N7IRF1	Acinetobacter_phage	96.3	6.8e-125
WP_151000700.1|1134451_1134934_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	88.4	1.2e-70
WP_063558516.1|1134911_1136438_+|terminase	phage terminase large subunit	terminase	E5AGA3	Erwinia_phage	41.7	5.6e-93
WP_151000702.1|1136446_1137781_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	38.9	1.7e-85
WP_151000704.1|1137725_1138538_+|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.0	2.1e-51
WP_000132372.1|1138530_1138848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823405.1|1138872_1139172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140953665.1|1139225_1140425_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	35.5	7.4e-24
WP_002125288.1|1140438_1140909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039808.1|1140914_1141889_+	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	37.5	2.0e-51
>prophage 3
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	1157742	1165171	3815016	integrase	uncultured_Caudovirales_phage(50.0%)	8	1157060:1157074	1171484:1171498
1157060:1157074	attL	TGCTTTTTTATTGCC	NA	NA	NA	NA
WP_140953673.1|1157742_1158288_+	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	84.5	1.7e-89
WP_140953674.1|1158342_1159044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000715.1|1159065_1160364_-	DUF4113 domain-containing protein	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	59.6	5.3e-153
WP_151000717.1|1160360_1160861_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	58.3	2.0e-44
WP_151000718.1|1160975_1161620_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	48.3	1.0e-56
WP_151000720.1|1161634_1162651_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_151000723.1|1162785_1163496_-	hypothetical protein	NA	A0A2H4JDZ2	uncultured_Caudovirales_phage	25.9	1.8e-06
WP_151000724.1|1163785_1165171_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	41.2	3.3e-76
1171484:1171498	attR	TGCTTTTTTATTGCC	NA	NA	NA	NA
>prophage 4
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	1204056	1257589	3815016	terminase,transposase,capsid	Acinetobacter_phage(61.29%)	55	NA	NA
WP_001043692.1|1204056_1204989_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000732870.1|1205842_1206721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079269062.1|1207415_1208063_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000735014.1|1208194_1208665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002059267.1|1208964_1209636_+	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_002059262.1|1209653_1210022_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_000416092.1|1210838_1211198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074163676.1|1211579_1212938_-	amino acid permease	NA	NA	NA	NA	NA
WP_002059257.1|1213083_1214529_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000191922.1|1216074_1216782_-	cache protein	NA	NA	NA	NA	NA
WP_001277431.1|1216847_1217567_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002059260.1|1217626_1218397_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_002059266.1|1218425_1219856_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002001056.1|1220174_1220597_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017725625.1|1220732_1221968_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.2e-23
WP_001043692.1|1222408_1223341_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_002059758.1|1223378_1224308_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000599996.1|1224373_1225204_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002059756.1|1225227_1226778_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162897191.1|1227176_1227374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729980.1|1227697_1229017_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_151000728.1|1229128_1230127_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_088360641.1|1230177_1231556_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.8e-74
WP_000735756.1|1232435_1232825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000906487.1|1233525_1233780_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001040037.1|1233992_1234925_+|transposase	IS5-like element ISAha2 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.9e-59
WP_000362184.1|1236564_1236780_-	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
WP_000048750.1|1237041_1237326_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	1.7e-43
WP_000453808.1|1237322_1237532_-	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	98.6	6.3e-32
WP_000654849.1|1237534_1237780_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
WP_001277128.1|1238554_1239031_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000861102.1|1239002_1239257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001039306.1|1239734_1240088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152659.1|1240286_1240523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017725555.1|1241027_1241669_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	100.0	9.4e-127
WP_000212566.1|1241727_1242198_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_017725554.1|1242187_1243615_+|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	99.3	6.5e-269
WP_017725553.1|1243611_1245063_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.2	4.7e-283
WP_017725552.1|1245064_1246168_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	96.5	9.9e-201
WP_002046400.1|1246322_1246637_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	49.5	3.1e-14
WP_017725551.1|1246751_1247519_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	98.8	2.1e-117
WP_000214189.1|1247546_1248503_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
WP_017725550.1|1248569_1249235_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	76.5	6.0e-84
WP_000008494.1|1249239_1249629_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
WP_025468626.1|1249630_1249999_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	93.4	1.0e-61
WP_016654269.1|1250054_1250474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002053117.1|1250473_1250926_+	hypothetical protein	NA	A0A1W6JT96	Pseudomonas_phage	37.4	2.2e-13
WP_103270969.1|1251070_1252290_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.2	4.8e-79
WP_017725544.1|1252398_1253316_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	96.7	4.3e-165
WP_017725543.1|1253385_1253901_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	99.3	2.4e-72
WP_000838146.1|1254226_1254409_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_000966688.1|1254501_1254906_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
WP_000124482.1|1255379_1255640_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000096283.1|1255805_1256705_+	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
WP_001019718.1|1257043_1257589_+	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	99.4	6.4e-100
>prophage 5
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	1287573	1354061	3815016	transposase,tRNA	Acinetobacter_phage(26.09%)	64	NA	NA
WP_001043692.1|1287573_1288506_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000343018.1|1288643_1289852_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_002059733.1|1290795_1291536_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002059722.1|1291657_1294096_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_000781340.1|1294303_1294915_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001037895.1|1294979_1295324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017725516.1|1295497_1297084_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.4e-25
WP_000058246.1|1297324_1297543_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_001133993.1|1297579_1298167_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_000024050.1|1298231_1298447_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_001987180.1|1298639_1299215_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_017725515.1|1299555_1303413_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.1	6.4e-45
WP_000512836.1|1303508_1304615_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002058138.1|1304715_1305978_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_000381280.1|1306022_1307381_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000212307.1|1307848_1309042_-	benzoate/H(+) symporter BenE	NA	NA	NA	NA	NA
WP_125729102.1|1309099_1309885_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	NA	NA	NA	NA
WP_017725513.1|1309906_1310923_-	ring-hydroxylating dioxygenase ferredoxin reductase family protein	NA	NA	NA	NA	NA
WP_000107005.1|1310994_1311495_-	benzoate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
WP_002058142.1|1311491_1312874_-	benzoate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
WP_151000729.1|1313156_1314116_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001985155.1|1314165_1314366_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_000377522.1|1314531_1317003_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.0	1.3e-96
WP_001020650.1|1317078_1317480_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000640646.1|1317507_1317915_+	GFA family protein	NA	NA	NA	NA	NA
WP_001088962.1|1318509_1318866_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_002058134.1|1319345_1319675_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	64.2	1.8e-33
WP_002058139.1|1320117_1320711_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000825869.1|1320761_1320986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998196.1|1321210_1321405_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_002058135.1|1321397_1322660_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	21.6	7.3e-14
WP_000636785.1|1323164_1323398_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001185369.1|1323548_1324220_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	1.1e-64
WP_017725744.1|1324408_1324606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427184.1|1324773_1325163_+	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.1e-48
WP_002058131.1|1325200_1325746_+	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	72.9	2.7e-74
WP_002058137.1|1325812_1326430_-	LysE family translocator	NA	NA	NA	NA	NA
WP_001043692.1|1326651_1327584_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000072673.1|1327994_1328210_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000350297.1|1328413_1328638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002058540.1|1328917_1329169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002058538.1|1329188_1329734_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_001982898.1|1329890_1330010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002058542.1|1330495_1330954_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	3.0e-26
WP_001004676.1|1332714_1333059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343018.1|1333213_1334422_-|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_151000731.1|1335583_1336798_-	MFS transporter	NA	NA	NA	NA	NA
WP_002057941.1|1336909_1337356_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001210983.1|1337442_1337772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157563.1|1337785_1337932_+	hypothetical protein	NA	A0A0B5KTG2	Acinetobacter_phage	100.0	3.4e-08
WP_000644342.1|1338511_1339105_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_002057927.1|1340804_1342226_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.4	3.6e-54
WP_001133555.1|1342439_1343417_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
WP_000179337.1|1343420_1343960_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|1343997_1344546_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|1344529_1345078_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|1345077_1345824_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_002122556.1|1345905_1346652_+|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
WP_015451474.1|1347219_1348443_+	TolC family protein	NA	NA	NA	NA	NA
WP_002057937.1|1348439_1350581_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	8.0e-29
WP_000003555.1|1350577_1351768_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000885988.1|1351859_1352459_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
WP_002057917.1|1352451_1353063_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
WP_001082436.1|1353218_1354061_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
>prophage 6
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	1592378	1649080	3815016	transposase	Planktothrix_phage(20.0%)	49	NA	NA
WP_001040033.1|1592378_1593311_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.7e-60
WP_000810598.1|1593442_1594750_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_000078703.1|1595215_1596646_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000521160.1|1596886_1597306_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000066032.1|1597302_1597788_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	3.0e-24
WP_000535311.1|1597787_1598633_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002058450.1|1598697_1599330_+	LysE family translocator	NA	NA	NA	NA	NA
WP_001983957.1|1599387_1600557_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000611177.1|1600582_1603246_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_085940543.1|1603273_1604491_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_002058451.1|1604593_1604983_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_001047284.1|1605111_1605453_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_085940569.1|1605454_1606177_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000477056.1|1606296_1606767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736701.1|1606839_1607175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002058441.1|1607347_1608055_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002058444.1|1608147_1608669_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_000506572.1|1608713_1609805_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001153960.1|1609898_1610558_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_086249923.1|1610538_1611615_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-35
WP_002058436.1|1611620_1612454_-	NLPA lipoprotein	NA	NA	NA	NA	NA
WP_000079412.1|1612467_1613298_-	methionine transporter	NA	NA	NA	NA	NA
WP_000753091.1|1613312_1614725_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000205191.1|1614724_1615948_-	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
WP_086238141.1|1615960_1617196_-	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
WP_001265503.1|1617541_1618306_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000830363.1|1618842_1619736_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000110649.1|1619830_1620673_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001132006.1|1621365_1622109_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
WP_162540414.1|1622159_1623455_-	DcaP-like protein	NA	NA	NA	NA	NA
WP_000418050.1|1623821_1624292_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000907230.1|1624323_1625073_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000713973.1|1625234_1625780_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_000037170.1|1625965_1626526_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002058438.1|1626800_1627664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159455821.1|1628119_1629160_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_086249690.1|1629146_1629362_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086249691.1|1629470_1630445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125729157.1|1630480_1633357_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_004988526.1|1633385_1634297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125729159.1|1634314_1635166_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_125729160.1|1635175_1636399_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.3	1.6e-29
WP_125729163.1|1636398_1637967_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	57.0	8.1e-164
WP_000122230.1|1638396_1638702_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
WP_106631126.1|1638740_1639244_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_103270969.1|1639778_1640998_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.2	4.8e-79
WP_125729179.1|1641211_1642210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270969.1|1645396_1646616_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.2	4.8e-79
WP_000343018.1|1647871_1649080_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
>prophage 7
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	2213879	2232694	3815016	integrase	Acinetobacter_phage(33.33%)	28	2226590:2226604	2236041:2236055
WP_057073334.1|2213879_2214644_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	49.2	1.6e-64
WP_057073335.1|2214640_2215678_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	55.2	3.3e-28
WP_057073336.1|2215751_2216828_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.3	1.1e-108
WP_057073337.1|2216824_2218504_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	45.7	3.8e-151
WP_057073338.1|2218500_2219061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057073339.1|2219060_2219702_-	hypothetical protein	NA	R9VWB9	Serratia_phage	40.1	2.5e-31
WP_151000782.1|2219698_2220151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057073341.1|2220147_2220330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057073342.1|2220560_2220935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057073343.1|2220967_2221201_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057073344.1|2221327_2222017_+	LexA family transcriptional regulator	NA	A0A0R6PCY1	Moraxella_phage	38.1	2.2e-25
WP_057073345.1|2222027_2222303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057073417.1|2222517_2222850_+	hypothetical protein	NA	G3EN79	Psychrobacter_phage	38.6	4.9e-10
WP_057073418.1|2222889_2223693_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	31.7	3.1e-26
WP_057073419.1|2223778_2224039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057073420.1|2224097_2224427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108584117.1|2224423_2224795_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	38.4	7.1e-10
WP_068541731.1|2224965_2225646_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_057073423.1|2225658_2226699_+	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	2.7e-14
2226590:2226604	attL	ATATTTCTGAAGCTG	NA	NA	NA	NA
WP_000978815.1|2226837_2227131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057073424.1|2227127_2227481_+	hypothetical protein	NA	J7HXR6	Acinetobacter_phage	49.2	2.8e-24
WP_057073425.1|2227477_2228014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057073426.1|2228010_2228517_+	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	75.3	6.0e-28
WP_032036509.1|2228513_2228708_+	hypothetical protein	NA	A0A0D4DCB1	Acinetobacter_phage	68.3	1.4e-17
WP_032036701.1|2228829_2230152_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	37.2	1.1e-73
WP_000349158.1|2230412_2231075_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_000040963.1|2231058_2231499_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_000344169.1|2231644_2232694_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.4	5.7e-113
2236041:2236055	attR	CAGCTTCAGAAATAT	NA	NA	NA	NA
>prophage 8
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	2255864	2325437	3815016	transposase	uncultured_Caudovirales_phage(27.78%)	59	NA	NA
WP_103270969.1|2255864_2257083_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.2	4.8e-79
WP_151000788.1|2257085_2257283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000790.1|2257593_2258055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701850.1|2258236_2258533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001194768.1|2258666_2260061_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000604790.1|2260175_2261183_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	31.9	9.5e-49
WP_000105719.1|2261248_2261617_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.0	8.9e-13
WP_000859778.1|2261661_2262012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194628.1|2262029_2262314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005138847.1|2262333_2262645_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	1.6e-18
WP_086222397.1|2262649_2263501_-	DMT family transporter	NA	NA	NA	NA	NA
WP_162540314.1|2263635_2265039_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000870671.1|2265035_2265518_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005138845.1|2265726_2266962_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000799985.1|2266961_2267885_-	bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB	NA	NA	NA	NA	NA
WP_005138843.1|2267908_2268394_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_001187658.1|2268397_2268652_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_086238124.1|2268652_2269693_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001040037.1|2272002_2272935_-|transposase	IS5-like element ISAha2 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.9e-59
WP_005138831.1|2273392_2274022_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_005138829.1|2274018_2276799_-	nitrate reductase	NA	NA	NA	NA	NA
WP_001028494.1|2276817_2278440_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_169518015.1|2278452_2280987_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_000114557.1|2281010_2281352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125254.1|2281736_2282327_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_005138814.1|2282327_2283338_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_057052257.1|2283669_2284998_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	44.3	2.4e-100
WP_000099414.1|2285233_2285689_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_000354611.1|2285706_2286126_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000939648.1|2286142_2287513_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_001238663.1|2287564_2288068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002016111.1|2288215_2289379_-	MFS transporter	NA	NA	NA	NA	NA
WP_151000792.1|2289768_2290140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032061828.1|2290633_2291269_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	55.2	2.4e-66
WP_085942227.1|2291315_2292481_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
WP_151000794.1|2292641_2293967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099476255.1|2294176_2294674_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.7	3.8e-43
WP_151000796.1|2294670_2295969_+	DUF4113 domain-containing protein	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	61.6	7.4e-155
WP_001072150.1|2296122_2296821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235281.1|2297009_2297852_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_151000798.1|2297848_2298490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766533.1|2298615_2299386_-	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	98.4	1.7e-151
WP_001279704.1|2299382_2299670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000894311.1|2299791_2300010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151000800.1|2300002_2300701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030337.1|2300700_2301495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594623.1|2301582_2301831_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000067916.1|2302032_2302932_+	hypothetical protein	NA	G9L6D8	Escherichia_phage	48.9	1.1e-40
WP_085940844.1|2303589_2304755_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_000067934.1|2305296_2306376_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	31.9	2.6e-36
WP_000951724.1|2306372_2307002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209671.1|2307152_2308604_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	42.8	5.0e-83
WP_151000802.1|2308603_2310556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863709.1|2310629_2311283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000098518.1|2311282_2312818_-	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	9.4e-32
WP_000786040.1|2312977_2313172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940844.1|2313876_2315041_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_151000804.1|2314992_2315502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085942227.1|2324271_2325437_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
>prophage 9
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	2671739	2686537	3815016		Acinetobacter_phage(100.0%)	10	NA	NA
WP_171062244.1|2671739_2672315_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	99.0	3.6e-109
WP_017725262.1|2672410_2675176_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	98.7	0.0e+00
WP_017725263.1|2675189_2677922_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	98.5	0.0e+00
WP_001982145.1|2678278_2679328_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608310.1|2679337_2680144_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.3	3.9e-146
WP_000066126.1|2680153_2680849_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_017725264.1|2680859_2681843_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	91.4	9.2e-174
WP_017725265.1|2681849_2684225_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	97.6	0.0e+00
WP_017725266.1|2684226_2685726_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.0	1.2e-278
WP_001187844.1|2685988_2686537_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 10
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	2726181	2773579	3815016	integrase,transposase,tRNA,protease	Enterobacteria_phage(22.22%)	42	2729720:2729735	2744383:2744398
WP_076611894.1|2726181_2727003_+|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_151000811.1|2727021_2728410_-	molybdenum cofactor biosysnthesis protein MoeA	NA	NA	NA	NA	NA
WP_151000813.1|2728646_2729579_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.3	4.2e-59
2729720:2729735	attL	TTGGTAGGCATATCCA	NA	NA	NA	NA
WP_004746505.1|2730042_2730198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004746504.1|2730254_2730632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000814.1|2730750_2731173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940844.1|2731123_2732289_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_004746502.1|2733127_2733568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004746501.1|2733554_2734253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000816.1|2734427_2736086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017725774.1|2736668_2737268_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.2	4.4e-09
WP_140983022.1|2737257_2737953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171493003.1|2738474_2739272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002033903.1|2739309_2740242_-|transposase	IS5-like element ISAba40 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.8	2.5e-56
WP_017725762.1|2740603_2741008_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025468641.1|2741084_2741294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140982761.1|2741310_2742237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017724954.1|2742573_2742954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017724955.1|2742991_2744206_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	35.0	1.0e-57
WP_001009533.1|2744628_2744931_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
2744383:2744398	attR	TTGGTAGGCATATCCA	NA	NA	NA	NA
WP_002040134.1|2744933_2746946_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_000035083.1|2747196_2747766_-	elongation factor P	NA	NA	NA	NA	NA
WP_000611579.1|2747839_2748856_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000981543.1|2748871_2750617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100244458.1|2750613_2752722_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001200845.1|2752784_2753009_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001984712.1|2753202_2754174_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_001242511.1|2754307_2754709_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_017724958.1|2754711_2756901_-	MFS transporter	NA	NA	NA	NA	NA
WP_000192286.1|2757067_2759686_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000886770.1|2759743_2760673_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000550750.1|2760774_2761605_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	7.6e-12
WP_001023216.1|2761719_2762487_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	2.0e-54
WP_151000819.1|2762589_2762961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151000821.1|2763155_2763530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197255.1|2763655_2764804_+	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	36.8	1.0e-62
WP_001107199.1|2764903_2765449_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017724960.1|2765568_2766057_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_151000822.1|2766049_2767942_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000570321.1|2769466_2770108_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_017724962.1|2770157_2772341_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_017724963.1|2772616_2773579_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.8	5.9e-24
>prophage 11
NZ_CP044356	Acinetobacter baumannii strain CAM180-1 chromosome, complete genome	3815016	3254838	3314522	3815016	integrase,transposase,tRNA,protease	Enterobacteria_phage(23.08%)	49	3253505:3253522	3301020:3301037
3253505:3253522	attL	TTCAAATTTTAGAGATGT	NA	NA	NA	NA
WP_071209757.1|3254838_3256137_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	32.6	1.2e-51
WP_001177143.1|3256591_3257629_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_125728918.1|3257782_3258811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043692.1|3259527_3260460_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_002157357.1|3260756_3261890_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.2	1.3e-94
WP_000051669.1|3261988_3262318_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_001984787.1|3264278_3265244_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_088360641.1|3265334_3266712_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.8e-74
WP_000006958.1|3266774_3268028_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
WP_000637023.1|3270235_3271147_+	bestrophin	NA	NA	NA	NA	NA
WP_005134701.1|3271154_3272006_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_000645707.1|3272050_3272665_+	septation protein IspZ	NA	NA	NA	NA	NA
WP_001115787.1|3272699_3273002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001175200.1|3273006_3273486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005134699.1|3273509_3275381_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_005134698.1|3275432_3275747_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001138893.1|3275838_3276327_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_000083571.1|3276362_3276857_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_001287657.1|3276896_3277319_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000587652.1|3277320_3277758_-	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	39.0	1.3e-10
WP_000543478.1|3277758_3278655_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	28.8	6.7e-22
WP_001293924.1|3278847_3279183_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_001043692.1|3280121_3281054_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_125729152.1|3281862_3283236_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_001985194.1|3289329_3289833_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000451187.1|3289961_3291062_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.4	1.8e-13
WP_001097560.1|3291076_3291556_+	OmpA family protein	NA	NA	NA	NA	NA
WP_125729133.1|3291603_3292614_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000079188.1|3292720_3294346_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_000195147.1|3294346_3295156_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_000456884.1|3295359_3296694_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000357902.1|3296736_3297108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480818.1|3297118_3297793_+	LrgB family protein	NA	NA	NA	NA	NA
WP_000514366.1|3297877_3298321_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_002059798.1|3298361_3299201_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_000284347.1|3299201_3300014_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_086238059.1|3300037_3301021_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_000854895.1|3301193_3301622_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
3301020:3301037	attR	ACATCTCTAAAATTTGAA	NA	NA	NA	NA
WP_000224786.1|3301634_3302021_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000110148.1|3302191_3302845_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000003709.1|3302851_3303280_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.0	2.9e-31
WP_002059810.1|3303297_3303954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002059800.1|3306016_3306853_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000673016.1|3306863_3308021_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002059795.1|3308063_3309677_-	acetyl-CoA carboxylase carboxyltransferase subunit	NA	NA	NA	NA	NA
WP_000344602.1|3309687_3310614_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	22.3	3.1e-06
WP_002059814.1|3310619_3312425_-	DUF1446 domain-containing protein	NA	NA	NA	NA	NA
WP_000562189.1|3312611_3313211_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004738162.1|3313298_3314522_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.3	3.2e-43
>prophage 1
NZ_CP044357	Acinetobacter baumannii strain CAM180-1 plasmid pCAM180A, complete sequence	92034	1734	76830	92034	protease,integrase,transposase	Acinetobacter_phage(31.25%)	65	24963:25022	65579:66854
WP_016653379.1|1734_2667_-|transposase	IS5-like element ISAba13 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.5	4.5e-61
WP_171493006.1|2869_2977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016653378.1|3210_3699_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_005130184.1|3685_4639_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000221973.1|4658_5810_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	3.7e-25
WP_016653402.1|6793_7495_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_032006326.1|7421_9128_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_151000846.1|9131_9572_-	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	2.6e-11
WP_002126462.1|9561_10707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004834871.1|10786_11398_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_002126446.1|11487_12375_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_002126455.1|12477_13167_-	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016653399.1|13170_16020_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	1.8e-129
WP_000350434.1|16113_16683_-	Hsp20/alpha crystallin family protein	NA	A0A1D7SX46	Cyanophage	27.9	3.6e-05
WP_165381674.1|17048_17228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016653379.1|17224_18157_+|transposase	IS5-like element ISAba13 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.5	4.5e-61
WP_151000848.1|18705_20187_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	32.7	4.6e-36
WP_151000850.1|20183_21215_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	40.2	7.7e-30
WP_085940844.1|21278_22443_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_151000852.1|23029_24904_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
24963:25022	attL	TTGATATACGCTGAATTATCAGGAGACTTTCCCTTGGGAGATTCTAGGCAGCCAATTTAT	NA	NA	NA	NA
WP_085940844.1|25005_26171_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_151000855.1|26352_29793_+	DEAD/DEAH box helicase family protein	NA	H9C0H6	Bdellovibrio_phage	24.8	4.4e-05
WP_171493008.1|29826_31020_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_016653398.1|31012_32680_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000059636.1|33130_34330_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	29.1	9.6e-40
WP_000684951.1|34629_35061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016653397.1|35282_36215_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.3	3.1e-62
WP_000593330.1|36519_37158_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_151000859.1|37174_38194_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_000804053.1|38337_38946_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001087973.1|39050_39281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655271.1|39364_40492_-	alkene reductase	NA	NA	NA	NA	NA
WP_000699624.1|40692_41370_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_006582026.1|41454_42612_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002009095.1|42807_42930_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000920559.1|43206_43509_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_006582027.1|43832_44672_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842147.1|44900_46013_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	1.2e-31
WP_001133624.1|46034_46310_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_100217358.1|48326_48920_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_025466852.1|48852_49557_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	82.8	4.2e-112
WP_006582112.1|51201_52365_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.6	2.9e-09
WP_002055446.1|53597_56264_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.8	9.6e-157
WP_006582666.1|56306_57515_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.1e-46
WP_006582667.1|57806_58088_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	44.4	2.0e-12
WP_000286963.1|58088_58391_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	50.0	3.3e-21
WP_016653395.1|58590_59253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085942227.1|59541_60707_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
WP_000269903.1|61906_62263_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001140619.1|62255_62558_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000069471.1|62550_62760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016653394.1|62884_63097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085940844.1|64429_65594_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_016653393.1|65648_65969_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016653392.1|66245_66434_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	67.9	5.9e-13
WP_001258992.1|66420_66708_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	48.4	7.4e-15
WP_016653391.1|66991_67216_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	47.9	4.4e-07
65579:66854	attR	ATAAATTGGCTGCCTAGAATCTCCCAAGGGAAAGTCTCCTGATAATTCAGCGTATATCAAGGTCTTAGATATGAGTCGATTAACTTTTATAAACGGTGCGATTGTTTCTGCGTCTGATGTTCGCAAATCTTGGAGCAAAATTGTTCAATGTGTCAAAGAAAGTCATAAACCTGTTTTTGTTTATACGAAGAATACGCCCGAAGCTGTTGTTCTGAGTTTTGAAGAATTTCAAAACATGCAGGAAATTGTTGAAGCCGTCCGGCGTGAACAGCTAGGACAACAAATGGTTTATGATCTTTTGGATATTAATCAGCTCACTGGTCAACCGACCAAACACATGCTTTTGAACCACAAAGGTGTATTTGAAGAAGTAAATGGACAAGAAAAATAGCTTTTGAGGATATTAGCGGATTCGAGATTAGAGACAAGCTGATTTAAAAGTCATCTTATATTTATATTCGTTGCACAATGAGCTTTGATTTTCGTGAAATAATAGGAAGTGAAAACATTTTCGTAAGTTAAGTAGCCCTGATGACATAGAGTTGACTAAGTTTATTGAAAATTACAAAGAACGCTTGGATGTCTATAGAACTATATTAAATAATGCACTGGGTAAAGTAATAGACTCACCCCCGGCGCAAACTTAGGAGAATCTCACACATTACCAATGAGTAAAGGACTATTTGAGTTGCGCTTAAAATCTCAAGAATGTATTGCTCGTGTTATGTATTGCACACTAGTCGGTAAACGCATTGTAATGCTCCATAGTTTTGTTAAGAAAACCCAAAAAACACCTAAGCAAGATCTAAACCTAGCACTTGACCGCATGAAAGAGGTGAAAAATGCGAACACATGAAGAAATGAAAGCACTTGCATTATCTCGTTCAGCAGTGCGTACCGAATACGAACGAATTGAACGTGAAGAAATGCCCTTGCTCGATATGGTACTTACTGCACTTCGAGAGGCAGGTCTATCCCAAGCGCAAATCGCGGAACGCATGGGAACAAATGTACCTGCCGTTTCACGGCTAGAAAAAGCATTGATCACAGGCAAACCATCACCATCTATTGCCACATTGCAAAAATATGCTGCGGCAATTGGTAAACATGTTGAAGTGCGTTTTGTCTAAATAAAAAAGCACCCTAGGGTGCTTTTTACCAATTCACTAATCAATCAACTTTACACATTTAGCAACAACATCCTGTGCCTATAGACCCTTATCTTTGAAATTACTGTTATACGCACGATCAATATCTCTTAAGCCTTCTTGAATTT	NA	NA	NA	NA
WP_021511398.1|68928_70137_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	2.0e-45
WP_021511117.1|71060_71702_-	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	83.6	8.8e-109
WP_005071563.1|71670_72138_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	71.6	3.3e-57
WP_001136764.1|72198_72654_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	96.0	5.5e-81
WP_085940844.1|73492_74658_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_025469473.1|75183_76116_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.6	9.0e-62
WP_016653388.1|76083_76311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005071567.1|76377_76830_-	hypothetical protein	NA	A0A2H4JDI9	uncultured_Caudovirales_phage	67.1	9.7e-54
