The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	257	34099	5096264	holin,plate,tail,capsid,portal,lysis,integrase,terminase,head	Escherichia_phage(56.1%)	43	11706:11720	33803:33817
WP_064579175.1|257_1421_-	phage late control D family protein	NA	A0A0F7LDR0	Escherichia_phage	99.0	4.5e-204
WP_001540336.1|1420_1900_-|tail	phage tail protein	tail	Q858U6	Yersinia_virus	100.0	2.3e-85
WP_096843456.1|1914_4362_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.8	0.0e+00
WP_000785970.1|4354_4474_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4506_4782_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_064550152.1|4838_5357_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	4.2e-93
WP_069907206.1|5369_6560_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
WP_021529515.1|6846_8073_-	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	100.0	2.7e-183
WP_064579168.1|8363_8891_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	95.4	3.1e-91
WP_064579169.1|8894_10868_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	58.5	1.3e-166
WP_001285325.1|10878_11409_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_064579170.1|11401_12310_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	3.4e-162
11706:11720	attL	GCCACCGGCCTGACG	NA	NA	NA	NA
WP_000127163.1|12314_12662_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093716.1|12658_13294_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	2.0e-113
WP_000255496.1|13377_14163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064579171.1|14234_14687_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	6.9e-76
WP_000917146.1|14679_15147_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	2.5e-81
WP_001300730.1|15109_15283_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_033811832.1|15254_15680_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	95.7	8.0e-66
WP_001712252.1|15667_16093_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
WP_001144101.1|16107_16605_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_064579185.1|16604_16886_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	4.8e-43
WP_000846409.1|16889_17093_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988646.1|17092_17602_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	1.2e-89
WP_064579217.1|17701_18445_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.2	1.6e-122
WP_001248553.1|18448_19522_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	6.7e-202
WP_001085975.1|19580_20435_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.6	3.5e-137
WP_000156872.1|20608_22381_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_096557573.1|22380_23415_+|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.4	6.0e-200
WP_071987867.1|23782_24937_-	DNA cytosine methyltransferase	NA	Q83VT0	Escherichia_phage	99.4	3.2e-210
WP_071526056.1|24957_25227_+	helix-turn-helix transcriptional regulator	NA	Q83VS9	Escherichia_phage	100.0	3.6e-40
WP_000866882.1|25204_26260_+	restriction endonuclease, SacI family	NA	Q83VS8	Escherichia_phage	100.0	2.2e-197
WP_050877419.1|26353_28624_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_000027664.1|28613_28889_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|28885_29110_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277897.1|29109_29412_-	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_000557705.1|29411_29636_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_000217670.1|29699_30200_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001081582.1|30377_30653_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|30774_31074_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|31189_32203_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000716757.1|32467_32785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|33199_34099_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
33803:33817	attR	CGTCAGGCCGGTGGC	NA	NA	NA	NA
>prophage 2
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	57525	132012	5096264	holin,tail,tRNA,capsid,portal,lysis,protease,integrase,terminase,head	Enterobacteria_phage(41.18%)	82	79072:79092	129518:129538
WP_001295427.1|57525_59559_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001215613.1|59699_63494_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356741.1|63503_67136_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636923.1|67196_67514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|68753_69842_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_064579208.1|69852_72132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292774.1|72124_73261_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_064579207.1|73257_75258_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|75382_75844_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|75884_76355_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|76401_77121_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|77117_78803_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
79072:79092	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001217533.1|79317_79566_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	86.6	1.0e-33
WP_064579209.1|79835_80510_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.7	5.6e-114
WP_000438829.1|80521_80734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064579206.1|80743_82456_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.7	5.9e-67
WP_000078853.1|82600_82741_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_151061602.1|82939_86626_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.1	0.0e+00
WP_074403980.1|86618_86828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074403982.1|87547_88180_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	8.7e-101
WP_106901625.1|88125_88869_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	99.2	8.3e-151
WP_001365876.1|88879_89578_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_000343411.1|89577_89919_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_096549210.1|89911_93154_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.2	0.0e+00
WP_122993267.1|93202_93412_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710936.1|93507_93882_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_001275414.1|93896_94613_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000133383.1|94679_95024_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573396.1|95020_95467_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	9.9e-75
WP_001007902.1|95463_95814_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
WP_000126028.1|95824_96151_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	97.2	3.9e-52
WP_001365916.1|96147_98733_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.3	0.0e+00
WP_001063099.1|98678_98900_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|98944_100882_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001398587.1|100945_102607_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
WP_000958387.1|102603_103167_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000829192.1|103455_103821_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|103862_104063_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|104194_104521_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_044696931.1|104456_104708_-	hypothetical protein	NA	H6WZK4	Escherichia_phage	98.6	2.2e-31
WP_042187665.1|104629_104830_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	1.1e-09
WP_000877795.1|104857_105403_-	hypothetical protein	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	7.4e-64
WP_074403983.1|105583_106051_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	88.4	4.2e-68
WP_001280928.1|106053_106185_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	95.3	4.5e-12
WP_000661712.1|106279_106975_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001092873.1|107248_107782_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.1	1.3e-94
WP_001041949.1|108293_109085_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284490.1|109088_109304_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001290230.1|109381_109627_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|109667_109847_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_064579199.1|109984_111922_-	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	93.8	0.0e+00
WP_000738072.1|112423_112693_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_000649751.1|112704_113664_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_064579085.1|114046_115105_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.3	1.3e-205
WP_000917756.1|115255_115453_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_001204809.1|115668_116049_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202275.1|116067_117057_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.7e-194
WP_001065352.1|117108_117366_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_040077785.1|117362_118763_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	4.9e-245
WP_000988196.1|118759_119638_-	ATPase AAA	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_039259893.1|119648_120641_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	90.1	1.3e-53
WP_021293441.1|120637_120964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618002.1|120960_121185_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_028125921.1|121181_121376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096549041.1|121372_122104_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	72.0	1.8e-81
WP_074403962.1|122036_122213_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	85.7	3.1e-24
WP_064579084.1|122232_122940_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	76.1	3.6e-95
WP_000944728.1|123021_123255_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800142.1|123411_124101_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	6.8e-115
WP_000387834.1|124248_124941_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.0e-38
WP_000147360.1|124946_125147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553978.1|125344_125527_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.1e-08
WP_032253186.1|125532_126105_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	70.7	1.0e-76
WP_000780790.1|126289_126478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052891987.1|126474_127302_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.1	4.5e-129
WP_001447615.1|127342_127714_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.9	1.4e-61
WP_001193437.1|127905_128160_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063636.1|128193_129480_+|integrase	site-specific integrase	integrase	Q6HA01	Enterobacteria_phage	100.0	1.2e-253
WP_042101647.1|129515_130202_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
129518:129538	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|130261_130369_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|130349_131081_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|131085_132012_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 3
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	729285	736425	5096264		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|729285_731847_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|731952_732609_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001369870.1|732659_733427_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	9.7e-70
WP_000847985.1|733622_734531_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590384.1|734527_735790_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|735786_736425_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 4
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	1816873	1827495	5096264	integrase	Enterobacteria_phage(88.89%)	12	1816691:1816713	1827980:1828002
1816691:1816713	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|1816873_1818043_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_064579111.1|1818062_1819922_+	helicase	NA	A0A097BY72	Enterococcus_phage	22.1	8.2e-14
WP_000186475.1|1819918_1820344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446137.1|1820671_1821244_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
WP_000638634.1|1821317_1821818_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|1821814_1822549_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|1823100_1823367_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_064579108.1|1823363_1823963_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.1e-49
WP_001244665.1|1823955_1824243_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459318.1|1824235_1824691_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|1824826_1825147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106901637.1|1825161_1827495_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
1827980:1828002	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 5
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	2075391	2151665	5096264	holin,plate,tRNA,capsid,portal,tail,lysis,protease,integrase,terminase,head	Escherichia_phage(47.83%)	88	2105998:2106044	2135720:2135766
WP_000560983.1|2075391_2075829_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000080791.1|2075825_2076815_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001162704.1|2076878_2077787_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|2078015_2078327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|2078327_2078618_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|2079222_2079441_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001087409.1|2079659_2079902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027706.1|2080231_2081161_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|2081157_2081793_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|2081789_2082692_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|2082704_2085755_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_096549192.1|2085948_2086782_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001317404.1|2086934_2087975_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_033811809.1|2088024_2089773_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_001019466.1|2089772_2090843_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446005.1|2090832_2092284_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729591.1|2092294_2092741_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|2093053_2093368_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179766.1|2093377_2094202_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_096549191.1|2094376_2095636_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144056.1|2095632_2097102_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|2097389_2098226_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001297062.1|2098209_2099148_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063527.1|2099144_2100179_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|2100463_2101084_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|2101343_2102327_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|2102475_2103150_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2103255_2104629_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2104625_2105324_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|2105473_2105974_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2105998:2106044	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023384.1|2106159_2107140_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001192857.1|2107209_2107503_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|2107655_2107928_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|2108097_2108598_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|2108661_2108886_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277961.1|2108885_2109188_+	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_001113264.1|2109187_2109412_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|2109408_2109684_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_042973449.1|2109673_2111971_+	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	99.5	0.0e+00
WP_000825552.1|2112046_2112592_-	cytolethal distending toxin type V subunit CdtC	NA	G1BEM5	Escherichia_phage	100.0	4.9e-100
WP_000759934.1|2112606_2113416_-	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	100.0	4.0e-151
WP_001284793.1|2113412_2114189_-	cytolethal distending toxin type V subunit CdtA	NA	G1BEM3	Escherichia_phage	100.0	7.9e-136
WP_050867561.1|2114975_2116010_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.7	9.3e-201
WP_000156872.1|2116009_2117782_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085972.1|2117955_2118810_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_001248553.1|2118868_2119942_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	6.7e-202
WP_064579217.1|2119945_2120689_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.2	1.6e-122
WP_000988646.1|2120788_2121298_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	1.2e-89
WP_000846409.1|2121297_2121501_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_064579185.1|2121504_2121786_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	4.8e-43
WP_001144101.1|2121785_2122283_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_001712252.1|2122297_2122723_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
WP_033811832.1|2122710_2123136_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	95.7	8.0e-66
WP_001300730.1|2123107_2123281_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917190.1|2123243_2123711_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
WP_001001780.1|2123703_2124156_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_050877437.1|2124222_2124858_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	2.9e-112
WP_000127163.1|2124854_2125202_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121496.1|2125206_2126115_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_001285340.1|2126107_2126719_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_047087886.1|2126715_2128446_+|tail	phage tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	64.3	3.1e-84
WP_047087885.1|2128445_2128883_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	42.0	7.3e-22
WP_069907206.1|2129006_2130197_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
WP_064550152.1|2130209_2130728_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	4.2e-93
WP_001031303.1|2130784_2131060_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2131092_2131212_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_064579114.1|2131204_2133652_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.3	0.0e+00
WP_064550148.1|2133666_2134146_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_151061603.1|2134145_2135309_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	3.5e-204
WP_000468308.1|2135389_2135608_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|2135844_2136747_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2135720:2135766	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|2136927_2137890_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|2138209_2139199_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708998.1|2139305_2140061_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|2140115_2140883_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|2140990_2141590_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155272.1|2141690_2142131_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|2142342_2142642_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|2142668_2143097_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|2143101_2143848_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|2143944_2144955_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|2145090_2146599_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|2146621_2147467_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2147892_2148138_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2148222_2148708_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001307494.1|2148800_2149727_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|2149793_2151125_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|2151134_2151665_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 6
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	2906997	3005087	5096264	plate,tail,protease,transposase,integrase,head	Shigella_phage(41.51%)	109	2920553:2920569	2998473:2998489
WP_000077537.1|2906997_2907528_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|2907718_2907967_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_096549161.1|2907968_2910059_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	1.2e-165
WP_000129790.1|2910135_2911068_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257925.1|2911070_2911292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549162.1|2911304_2911724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033805330.1|2911710_2911941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064768961.1|2912015_2912288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095585931.1|2912292_2912586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549163.1|2912597_2913128_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	56.0	9.4e-48
WP_001536807.1|2913212_2913791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549164.1|2913794_2914328_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	2.2e-65
WP_000465562.1|2914327_2914843_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_080029476.1|2914846_2915398_+	AsnC family protein	NA	NA	NA	NA	NA
WP_000621195.1|2915394_2915580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|2915618_2915951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|2915943_2916141_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|2916130_2916427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214359.1|2916423_2916933_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	2.0e-26
WP_000852377.1|2917002_2917428_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|2917499_2918000_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|2918034_2918463_+	endopeptidase	NA	NA	NA	NA	NA
WP_137446104.1|2918446_2918665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|2918674_2918902_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|2918882_2919191_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|2919187_2919478_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|2919480_2920062_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|2920061_2921726_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
2920553:2920569	attL	GCGCGGCCTTCAGGGGG	NA	NA	NA	NA
WP_096549181.1|2921725_2923315_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	5.0e-169
WP_095586074.1|2923298_2924630_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.0	5.5e-153
WP_095586075.1|2924751_2925225_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850812.1|2925401_2926526_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	7.5e-79
WP_096549165.1|2926525_2927473_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	65.9	4.3e-120
WP_096549166.1|2927516_2927912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549167.1|2927908_2928328_+	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	1.6e-34
WP_096549168.1|2928324_2928888_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	2.8e-42
WP_096549169.1|2928891_2929122_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_096549170.1|2929121_2930603_+|tail	phage tail protein	tail	A0A0C4UQS0	Shigella_phage	51.1	8.5e-131
WP_000015475.1|2930611_2930977_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_032307022.1|2930991_2931468_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_001115266.1|2931409_2931592_+	hypothetical protein	NA	C9DGQ0	Escherichia_phage	54.8	7.2e-08
WP_096549171.1|2931595_2933650_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	36.3	2.5e-72
WP_096549172.1|2933636_2934995_+	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	31.6	3.2e-52
WP_096549173.1|2934978_2936106_+|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	47.7	9.8e-95
WP_072098124.1|2936095_2936710_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	49.7	8.0e-51
WP_000763304.1|2936702_2937140_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	57.6	1.6e-40
WP_140436573.1|2937139_2938222_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	8.2e-99
WP_096096954.1|2938212_2938770_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	46.4	2.4e-41
WP_096549182.1|2938805_2939756_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	81.7	7.4e-27
WP_096549175.1|2939755_2940478_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	59.5	9.2e-38
WP_096549176.1|2940601_2942644_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	82.0	5.6e-282
WP_032307036.1|2942793_2942976_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114107.1|2943011_2943257_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001310452.1|2943873_2944074_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_096549177.1|2944027_2944765_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	5.8e-104
WP_096549178.1|2944871_2945321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000614334.1|2945317_2948077_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000343293.1|2948085_2948847_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|2948851_2950183_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|2950185_2950710_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113703.1|2950706_2951987_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_096549179.1|2952011_2953094_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|2953057_2954908_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|2954911_2955325_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|2955331_2956807_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|2956857_2957082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|2957116_2957617_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|2958313_2958832_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_044527364.1|2959041_2961183_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_000939262.1|2964893_2965376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122985282.1|2965290_2965476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118038.1|2967963_2968734_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|2968887_2969361_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973081.1|2969403_2971848_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|2972087_2972666_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|2972871_2973639_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|2973609_2974350_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|2974505_2974784_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|2974786_2975047_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543895.1|2975232_2976006_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001030483.1|2976062_2976419_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000598760.1|2976411_2976690_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001296890.1|2976794_2978534_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001296899.1|2978493_2979264_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226182.1|2979334_2980390_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059855.1|2980386_2980839_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001316884.1|2981057_2982224_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.1e-31
WP_000602103.1|2982220_2982835_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293016.1|2982891_2984349_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|2984609_2985068_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189543.1|2985159_2986404_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|2986461_2986863_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749882.1|2986901_2987957_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
WP_001285288.1|2988244_2989348_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|2989359_2990613_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001130500.1|2990967_2992134_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.0	2.4e-144
WP_064579183.1|2992204_2993776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012311686.1|2994393_2994966_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.9	5.3e-97
WP_000984201.1|2994980_2995226_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_001283022.1|2995222_2995957_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	3.3e-128
WP_001149156.1|2996519_2996786_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	6.3e-45
WP_087530358.1|2996782_2997382_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	3.9e-50
WP_001244665.1|2997374_2997662_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459318.1|2997654_2998110_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|2998245_2998566_+	hypothetical protein	NA	NA	NA	NA	NA
2998473:2998489	attR	CCCCCTGAAGGCCGCGC	NA	NA	NA	NA
WP_096695747.1|2998580_3000914_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.3	0.0e+00
WP_001111349.1|3001532_3001943_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121356.1|3001921_3002878_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667065.1|3002888_3005087_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 7
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	3274596	3339094	5096264	tRNA,tail,portal,lysis,capsid,protease,transposase,integrase,terminase,head	Enterobacteria_phage(42.59%)	72	3284758:3284804	3330568:3330614
WP_000912345.1|3274596_3275982_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|3276017_3276539_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3276646_3276859_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|3276860_3277727_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001369891.1|3278207_3278750_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|3278969_3279662_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001369975.1|3279692_3282302_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691049.1|3282314_3283322_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250425.1|3283332_3283848_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|3283850_3284483_-	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3284758:3284804	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001369915.1|3284817_3285981_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_012599996.1|3285836_3286292_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
WP_000206813.1|3286207_3286513_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|3286512_3286875_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008170.1|3286865_3287402_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	9.0e-99
WP_000081287.1|3287529_3288354_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|3288419_3288782_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|3289252_3289768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450738.1|3289995_3290622_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000205494.1|3290719_3290920_+	cell division protein	NA	NA	NA	NA	NA
WP_000515870.1|3290957_3291509_+	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
WP_001250269.1|3291684_3291864_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001369913.1|3291853_3292795_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001573323.1|3292791_3293286_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000210176.1|3293285_3293612_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|3293608_3293998_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061408.1|3294017_3294815_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_001358249.1|3294822_3295812_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001204780.1|3295829_3296213_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|3296402_3297500_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|3298088_3298304_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|3298303_3298801_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|3299017_3299200_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|3299290_3299584_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|3299874_3300285_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|3300570_3300777_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|3300941_3301136_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_032146712.1|3301151_3301409_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	100.0	6.8e-12
WP_000453587.1|3301524_3302070_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027283.1|3302044_3303970_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|3303966_3304173_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|3304169_3305771_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123273.1|3305751_3307071_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001369910.1|3307080_3307413_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000063218.1|3307468_3308494_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|3308535_3308931_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|3308942_3309296_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975051.1|3309307_3309886_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|3309882_3310278_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|3310285_3311026_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|3311041_3311464_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|3311445_3311880_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000847379.1|3314430_3314760_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|3314759_3315458_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|3315463_3316207_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_071532093.1|3316143_3316776_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_000515725.1|3316836_3320250_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001233071.1|3320320_3320920_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|3320984_3323945_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|3323944_3324520_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|3324617_3325208_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|3325524_3325758_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3325826_3325940_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|3326305_3326974_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|3327030_3327336_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226378.1|3327519_3329004_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|3329190_3330144_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|3330657_3331419_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3330568:3330614	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|3331601_3332492_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662376.1|3332492_3335465_-	phage receptor	NA	NA	NA	NA	NA
WP_000383954.1|3335451_3337689_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|3337957_3339094_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	3677388	3695080	5096264	capsid,protease,portal,integrase,terminase,head	uncultured_Caudovirales_phage(76.92%)	22	3676714:3676728	3681562:3681576
3676714:3676728	attL	CGGGCTGGCATTTTG	NA	NA	NA	NA
WP_047083650.1|3677388_3678627_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.7	1.8e-126
WP_024213440.1|3679035_3679230_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	7.7e-16
WP_077792655.1|3679323_3680238_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001824715.1|3680230_3680458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|3680463_3680763_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001672401.1|3680759_3682892_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.1	3.1e-174
3681562:3681576	attR	CGGGCTGGCATTTTG	NA	NA	NA	NA
WP_047083326.1|3683264_3683516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064579075.1|3683512_3683923_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_064579076.1|3683933_3684206_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_064579077.1|3684494_3685652_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	65.1	7.3e-138
WP_001475696.1|3685707_3686265_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.1e-62
WP_123004769.1|3686302_3687478_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	6.2e-185
WP_062877204.1|3687474_3687813_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	1.9e-30
WP_000134111.1|3687809_3688106_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145908.1|3688105_3688546_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.8	7.8e-56
WP_024166058.1|3688529_3688712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|3688836_3689193_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127882.1|3689176_3690838_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	5.7e-277
WP_062881264.1|3690851_3691133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072004446.1|3692116_3692317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|3692452_3692773_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|3692803_3695080_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 9
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	3953297	4073527	5096264	holin,plate,tail,portal,capsid,protease,tRNA,integrase,terminase,head	Escherichia_phage(25.83%)	163	3971893:3971914	4037077:4037098
WP_000074972.1|3953297_3954416_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.5e-82
WP_054250470.1|3954384_3954654_-	excisionase	NA	NA	NA	NA	NA
WP_096560541.1|3954715_3957187_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.7e-54
WP_064579146.1|3957282_3957471_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|3957467_3957656_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000390585.1|3957952_3958195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000559918.1|3958184_3958700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380318.1|3958813_3958966_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_032211256.1|3959243_3959531_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_064579147.1|3959531_3959723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064579148.1|3959691_3960153_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	55.4	1.2e-09
WP_000448216.1|3960172_3960544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021577226.1|3960646_3960928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693827.1|3960931_3961357_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_052909572.1|3961425_3962457_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	69.1	8.4e-85
WP_001379651.1|3962488_3962911_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_047082289.1|3962944_3963661_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	8.7e-73
WP_000017341.1|3963657_3963975_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_053294093.1|3963971_3964277_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.1	1.7e-49
WP_022581296.1|3964424_3964607_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	93.3	3.8e-25
WP_001289992.1|3964772_3965288_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.1e-37
WP_001398985.1|3965521_3965734_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_064579150.1|3965900_3966173_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_032284906.1|3966174_3967224_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	7.7e-110
WP_000904388.1|3967236_3967611_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	3.8e-35
WP_000762903.1|3967607_3968429_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	59.7	2.9e-80
WP_000917741.1|3968655_3968853_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_064579151.1|3969003_3970062_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	99.7	2.1e-208
WP_000649753.1|3970444_3971404_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738072.1|3971415_3971685_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
3971893:3971914	attL	CACCGGGAGGCACCCGGCACCA	NA	NA	NA	NA
WP_151061607.1|3972549_3974487_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	94.3	0.0e+00
WP_000143458.1|3974624_3974804_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|3974844_3975090_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284490.1|3975167_3975383_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_039264424.1|3975386_3976178_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|3976689_3977223_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_062896309.1|3977379_3977562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|3977930_3978137_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|3978201_3978426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032315111.1|3978386_3978587_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	75.6	9.0e-12
WP_001405844.1|3978918_3979425_+	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_001499025.1|3979396_3981325_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	3.7e-259
WP_000259002.1|3981308_3981515_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_096549216.1|3981511_3983104_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	4.5e-186
WP_001253971.1|3983093_3984599_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.6	4.6e-100
WP_096549215.1|3984635_3984983_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	5.8e-22
WP_064549420.1|3985040_3986069_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	3.9e-114
WP_047081403.1|3986120_3986504_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204531.1|3986496_3986850_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_000974993.1|3986865_3987441_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	2.9e-50
WP_000683075.1|3987437_3987833_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_052903742.1|3987840_3988590_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.2	3.1e-129
WP_001299690.1|3988605_3989037_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_072032653.1|3989063_3989477_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	83.8	1.6e-42
WP_096549214.1|3989457_3992037_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	86.0	0.0e+00
WP_000847280.1|3992033_3992363_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_106901605.1|3992362_3993061_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	1.2e-132
WP_106901606.1|3993071_3993815_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.4	1.6e-146
WP_072121435.1|3993760_3994393_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	4.3e-100
WP_106901607.1|3994632_3998319_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.0	0.0e+00
WP_000078853.1|3998517_3998658_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_050867622.1|3998801_4000460_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	53.4	5.9e-72
WP_000438830.1|4000469_4000682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373129.1|4000693_4001368_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_022581964.1|4001531_4001861_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|4002026_4002890_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|4002873_4004010_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359432.1|4004259_4005489_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|4005634_4006756_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085265.1|4007004_4008234_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	1.5e-133
WP_000953271.1|4008608_4008797_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000103621.1|4009334_4009514_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000184034.1|4009734_4009962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201463.1|4010019_4010199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001398590.1|4010391_4010955_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	40.0	8.0e-13
WP_032279725.1|4010941_4011142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728896.1|4011147_4011447_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833612.1|4011443_4012841_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.2	1.5e-113
WP_024200918.1|4013043_4013295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032317163.1|4013408_4013606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126663.1|4013615_4014026_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233314.1|4014036_4014285_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001142405.1|4014425_4014650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137342.1|4014941_4016099_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_000504057.1|4016138_4016711_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_140436580.1|4016748_4017924_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	6.2e-185
WP_001020671.1|4017920_4018259_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	1.5e-30
WP_000134113.1|4018255_4018552_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|4018551_4018992_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_074404611.1|4018975_4019158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|4019280_4019637_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127881.1|4019620_4021282_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.0e-277
WP_000133415.1|4021295_4021577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|4022426_4023887_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4023886_4024558_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|4024725_4026096_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|4026099_4026741_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|4026776_4027883_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476089.1|4027936_4028398_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_096549218.1|4028390_4029068_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4029239_4030490_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000885267.1|4030896_4033224_-	ATPase AAA	NA	NA	NA	NA	NA
WP_064579187.1|4033542_4034670_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.5	1.6e-121
WP_001527050.1|4034650_4034896_-	phage excisionase	NA	NA	NA	NA	NA
WP_000008212.1|4034950_4035487_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	94.3	3.9e-94
WP_000081287.1|4035615_4036440_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|4036505_4036868_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000141753.1|4037305_4037551_+	hypothetical protein	NA	NA	NA	NA	NA
4037077:4037098	attR	TGGTGCCGGGTGCCTCCCGGTG	NA	NA	NA	NA
WP_001514782.1|4037468_4037744_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001369946.1|4037752_4037956_-	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_001369890.1|4038232_4038925_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	2.3e-126
WP_001191674.1|4039022_4039283_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515847.1|4039275_4039827_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_001250269.1|4040002_4040182_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104988.1|4040171_4041113_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
WP_001369966.1|4041602_4042256_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.5e-127
WP_096549146.1|4042252_4042579_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	99.1	4.5e-53
WP_000767113.1|4042575_4042965_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061425.1|4042984_4043827_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	91.5	6.3e-139
WP_033812102.1|4043834_4044824_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001205449.1|4044841_4045189_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	8.0e-56
WP_001198055.1|4045202_4046294_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	35.4	5.3e-05
WP_106901609.1|4046273_4046405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000143147.1|4046886_4047603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120498.1|4047978_4048305_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	3.4e-56
WP_001148537.1|4048308_4048785_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	98.7	8.3e-88
WP_001369893.1|4048768_4049161_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	89.2	6.5e-54
WP_122985440.1|4049045_4049321_+	peptidase	NA	U5P461	Shigella_phage	82.4	9.8e-33
WP_001140095.1|4049613_4049964_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	6.8e-63
WP_000929173.1|4050090_4050585_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_072011717.1|4050818_4052315_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605606.1|4052326_4052509_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466253.1|4052508_4053750_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.6e-242
WP_001398562.1|4053727_4054378_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_000257511.1|4054392_4055598_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	1.2e-223
WP_000601360.1|4055647_4055848_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927719.1|4055850_4056174_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|4056170_4056581_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213502.1|4056555_4057062_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000779292.1|4057058_4057619_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497751.1|4057627_4057798_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155716.1|4057781_4059278_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.2	1.2e-273
WP_000090998.1|4059277_4059634_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000811154.1|4059633_4059903_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	7.8e-43
WP_001303047.1|4059869_4060058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807196.1|4060044_4061880_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.3	1.5e-307
WP_000219910.1|4061940_4063269_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999507.1|4063265_4064345_+	hypothetical protein	NA	U5P0H6	Shigella_phage	99.4	4.5e-206
WP_001259081.1|4064344_4064893_+|plate	phage baseplate assembly protein V	plate	Q8SBG6	Shigella_phage	99.5	1.5e-96
WP_000424732.1|4064892_4065318_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785311.1|4065304_4066363_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	8.1e-200
WP_000383545.1|4066353_4066938_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_000554690.1|4066941_4067724_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	97.6	5.4e-92
WP_001057699.1|4067723_4068326_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	88.4	8.9e-95
WP_096549148.1|4068297_4068729_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	73.7	4.8e-42
WP_032193144.1|4068731_4069127_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	37.8	6.0e-15
WP_000905000.1|4069156_4069711_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.9	4.4e-88
WP_000557907.1|4069817_4070651_+	5-methylcytosine-specific restriction enzyme A	NA	NA	NA	NA	NA
WP_000943926.1|4070884_4071049_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-24
WP_001307134.1|4071151_4071475_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|4072007_4072118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|4072170_4072575_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332302.1|4072795_4073527_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 10
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	4171423	4240619	5096264	holin,capsid,portal,tail,lysis,protease,integrase,terminase,head	Escherichia_phage(27.78%)	82	4171245:4171272	4226814:4226841
4171245:4171272	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113693.1|4171423_4172554_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.0e-104
WP_000113183.1|4172531_4172780_-	excisionase	NA	NA	NA	NA	NA
WP_151061608.1|4172844_4175316_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.7e-54
WP_000092839.1|4175411_4175600_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|4175596_4175785_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_038812338.1|4176333_4176636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001365839.1|4176559_4176928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|4176939_4177092_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|4177281_4177689_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|4177766_4177994_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|4177977_4178499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549153.1|4178479_4179445_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.8	1.3e-55
WP_096549154.1|4179451_4180192_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	82.7	1.4e-113
WP_000450858.1|4180221_4180983_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
WP_000215513.1|4181042_4181237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|4181578_4182130_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|4182344_4182557_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|4182659_4182977_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|4183565_4183793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|4183846_4184116_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_050877448.1|4184117_4185167_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904164.1|4185179_4185542_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|4185534_4186200_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342737.1|4186453_4187167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|4187340_4187538_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_064579144.1|4187688_4188747_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	4.4e-206
WP_000271631.1|4189227_4189656_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382067.1|4190352_4191078_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024166055.1|4191167_4191446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071532096.1|4192059_4192284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062878147.1|4192942_4194907_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.3	8.0e-294
WP_000142780.1|4195041_4195221_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290230.1|4195261_4195507_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|4195584_4195800_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_024200907.1|4195803_4196472_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	76.7	6.0e-60
WP_001063216.1|4196451_4196772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992036.1|4196897_4197431_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	97.2	7.4e-101
WP_072024677.1|4197587_4197770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024173692.1|4197918_4198386_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.9e-67
WP_106901626.1|4198497_4199121_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	67.6	3.5e-62
WP_042187665.1|4199148_4199349_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	1.1e-09
WP_044696931.1|4199270_4199522_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	98.6	2.2e-31
WP_000828070.1|4199457_4199784_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|4199915_4200116_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|4200157_4200523_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958387.1|4200811_4201375_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001398587.1|4201371_4203033_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
WP_000172990.1|4203096_4205034_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|4205078_4205300_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001365916.1|4205245_4207831_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.3	0.0e+00
WP_000126028.1|4207827_4208154_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	97.2	3.9e-52
WP_001007902.1|4208164_4208515_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
WP_000573396.1|4208511_4208958_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	9.9e-75
WP_000133383.1|4208954_4209299_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275414.1|4209365_4210082_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000710936.1|4210096_4210471_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_122993267.1|4210566_4210776_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_096549210.1|4210824_4214067_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.2	0.0e+00
WP_000343412.1|4214059_4214401_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
WP_000738904.1|4214599_4215763_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_001499019.1|4215973_4216672_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_106901611.1|4216682_4217426_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	93.9	4.6e-141
WP_122993618.1|4217371_4218004_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.9e-100
WP_106901612.1|4218914_4222610_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.2	0.0e+00
WP_001270059.1|4222678_4223302_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_064579137.1|4223451_4224639_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	1.5e-53
WP_001049908.1|4224707_4225379_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.0	2.8e-105
WP_001079499.1|4226991_4227498_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
4226814:4226841	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|4227543_4228044_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|4228129_4228309_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|4228689_4229496_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209516.1|4229495_4230689_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_024177467.1|4230700_4232059_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763511.1|4232062_4233658_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194592.1|4233657_4235220_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|4235311_4235356_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|4235493_4236375_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4236371_4236992_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|4237092_4237965_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|4238004_4238595_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|4238591_4239350_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|4239569_4240619_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 11
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	4308759	4331036	5096264	integrase	Salmonella_phage(19.05%)	38	4302593:4302607	4330151:4330165
4302593:4302607	attL	AAATTGATATTCAGC	NA	NA	NA	NA
WP_000945005.1|4308759_4309275_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
WP_096549061.1|4309493_4310729_+|integrase	tyrosine-type recombinase/integrase	integrase	I6R9B6	Salmonella_phage	45.1	6.1e-98
WP_047631195.1|4310686_4310905_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	44.3	9.2e-10
WP_096549062.1|4310897_4311560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518993.1|4311751_4312183_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	53.5	3.5e-37
WP_096549063.1|4312169_4312385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096549064.1|4312381_4312594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096549065.1|4312590_4313148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096549066.1|4313227_4314649_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	57.4	1.9e-140
WP_096549067.1|4314667_4315786_-	hypothetical protein	NA	M9QWT5	Shigella_phage	67.1	1.5e-151
WP_096549068.1|4315818_4316622_-	hypothetical protein	NA	A0A248SL11	Klebsiella_phage	35.5	3.1e-34
WP_096549069.1|4317964_4318210_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096549070.1|4318517_4319165_+	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	51.4	5.7e-55
WP_096549071.1|4319640_4319931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549072.1|4320077_4320722_+	ERF family protein	NA	I6RSN3	Salmonella_phage	54.5	5.6e-55
WP_096549073.1|4320705_4321314_+	hypothetical protein	NA	A0A173GAX4	Staphylococcus_phage	45.6	2.1e-11
WP_096549074.1|4321313_4321763_+	single-stranded DNA-binding protein	NA	H9C0R6	Aeromonas_phage	49.5	7.5e-22
WP_096549130.1|4321821_4322265_+	hypothetical protein	NA	A0A2H4YHG9	Raoultella_phage	47.5	2.2e-26
WP_096549075.1|4322248_4322530_+	hypothetical protein	NA	G9L665	Escherichia_phage	35.8	5.5e-07
WP_096549076.1|4322542_4322788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089580304.1|4323025_4323298_+	toxin-antitoxin system toxin subunit	NA	NA	NA	NA	NA
WP_096549077.1|4323288_4323480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549078.1|4323469_4323802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549079.1|4323813_4324434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057697143.1|4324533_4324716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057697142.1|4324727_4324946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549080.1|4325134_4325329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549081.1|4325318_4325522_+	hypothetical protein	NA	H6WCL9	Enterobacteria_phage	80.6	1.1e-28
WP_096549082.1|4325522_4325744_+	cell division protein FtsK	NA	NA	NA	NA	NA
WP_057697174.1|4325763_4325997_+	hypothetical protein	NA	H6WCM1	Enterobacteria_phage	90.9	5.8e-34
WP_096549083.1|4326006_4326546_+	phage N-6-adenine-methyltransferase	NA	H6WCM2	Enterobacteria_phage	91.1	4.8e-100
WP_096549084.1|4327019_4327517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549085.1|4327523_4328051_+	hypothetical protein	NA	A0A0K0VLD3	Klebsiella_phage	45.1	1.3e-28
WP_096549131.1|4328031_4328766_+	DNA cytosine methyltransferase	NA	A0A192Y8I6	Enterobacteria_phage	64.4	2.2e-87
WP_096549086.1|4329120_4329726_+	protein NinG	NA	G0ZNC4	Cronobacter_phage	53.1	2.6e-41
WP_096549087.1|4329722_4330142_+	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	54.8	4.2e-35
WP_096549088.1|4330125_4330308_+	hypothetical protein	NA	NA	NA	NA	NA
4330151:4330165	attR	AAATTGATATTCAGC	NA	NA	NA	NA
WP_096549089.1|4330307_4331036_+	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	34.6	1.1e-35
>prophage 12
NZ_CP044314	Escherichia coli strain RM9245 chromosome, complete genome	5096264	4335184	4353685	5096264	head,tail,lysis	Salmonella_phage(58.82%)	25	NA	NA
WP_057697172.1|4335184_4335397_+	hypothetical protein	NA	A0A1V0E5H9	Salmonella_phage	60.0	3.8e-08
WP_072147474.1|4335393_4335885_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	62.8	7.3e-55
WP_096549100.1|4335872_4336343_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_096549101.1|4336352_4336655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549102.1|4336930_4337473_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	44.1	1.7e-20
WP_096549103.1|4338283_4338766_+	DNA-binding protein	NA	Q716H4	Shigella_phage	41.1	2.8e-22
WP_096549104.1|4338768_4340247_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	68.5	1.8e-197
WP_096549105.1|4340325_4341699_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	58.9	6.7e-146
WP_096549132.1|4341688_4342585_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	49.5	1.6e-71
WP_096549106.1|4342575_4343910_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	52.3	3.4e-110
WP_096549107.1|4343926_4344298_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	42.8	2.6e-20
WP_096549108.1|4344315_4345365_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	64.4	2.7e-131
WP_096549109.1|4345431_4345818_+	hypothetical protein	NA	Q5G8X8	Enterobacteria_phage	60.9	3.8e-38
WP_096549110.1|4345820_4346006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549111.1|4345998_4346385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096549112.1|4346396_4346831_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	57.9	5.3e-41
WP_096549113.1|4346827_4347214_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	62.5	2.8e-41
WP_096549114.1|4347227_4347734_+	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	64.9	7.6e-55
WP_096549133.1|4347778_4348459_+	hypothetical protein	NA	H6WRU2	Salmonella_phage	41.3	1.4e-40
WP_096549115.1|4348473_4349085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096549116.1|4349212_4352089_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	38.7	1.6e-69
WP_096549117.1|4352123_4352303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096549118.1|4352302_4352482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089580209.1|4352719_4352974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096549119.1|4353331_4353685_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	75.7	6.5e-45
