The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	352046	363891	5264698	integrase	Enterobacteria_phage(90.0%)	15	346685:346699	379879:379893
346685:346699	attL	TCAAAAGCCAGCTGG	NA	NA	NA	NA
WP_000776997.1|352046_353312_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.5	2.2e-74
WP_000418440.1|353370_354264_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000932801.1|354272_354788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205027.1|354985_355297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001825860.1|355606_356179_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_021038238.1|356252_356753_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_033810335.1|356749_357484_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	5.2e-129
WP_001149160.1|358036_358303_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_080213683.1|358299_358890_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
WP_001244670.1|358882_359170_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_080213682.1|359162_359618_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856725.1|359753_360074_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_136829793.1|360088_362422_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_044815386.1|362768_362963_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001219054.1|363180_363891_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.7	1.8e-41
379879:379893	attR	TCAAAAGCCAGCTGG	NA	NA	NA	NA
>prophage 2
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	456022	527917	5264698	terminase,transposase,head,tail,holin,protease,portal,capsid,tRNA,integrase	Escherichia_phage(32.76%)	82	450659:450673	485210:485224
450659:450673	attL	TGCCTGACTGAACTG	NA	NA	NA	NA
WP_050940454.1|456022_457246_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	4.4e-234
WP_000040218.1|457532_458252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940456.1|458729_459350_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	90.8	4.8e-112
WP_001404194.1|459349_459712_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_001401560.1|459702_460239_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_050940458.1|460366_461191_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.5	1.1e-148
WP_000135680.1|461256_461619_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|462305_462980_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|463070_463271_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_032206597.1|463314_463866_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	98.9	1.3e-100
WP_050940460.1|463862_464699_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.3	8.4e-152
WP_000933942.1|464691_464928_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
WP_021522644.1|464924_465743_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.4	6.2e-123
WP_072095577.1|465739_466234_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	2.1e-86
WP_050940465.1|466233_466887_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	9.6e-127
WP_050940467.1|466883_467210_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	5.9e-53
WP_000767113.1|467206_467596_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061414.1|467615_468413_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_063113543.1|468420_469410_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.5	2.3e-193
WP_050940472.1|469427_469781_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	87.7	1.6e-56
WP_050940475.1|470113_470521_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	63.2	1.1e-43
WP_001318187.1|470556_471288_+	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	74.4	5.2e-97
WP_024186198.1|471838_472054_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
WP_050940478.1|472058_472409_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_050940480.1|472472_473006_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	6.2e-100
WP_001228684.1|473222_473408_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	2.7e-18
WP_001323403.1|473631_474411_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|474410_475433_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_135259168.1|475489_475822_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	99.0	1.7e-55
WP_050939787.1|475969_476452_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	1.1e-84
WP_050939785.1|476451_478209_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478567.1|478220_478403_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466244.1|478402_479644_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	2.2e-241
WP_001193631.1|479621_480272_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_050939783.1|480286_481492_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	98.0	3.6e-220
WP_000601355.1|481542_481731_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_050939781.1|481742_482048_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	92.1	1.6e-39
WP_050939779.1|482056_482395_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	98.2	4.6e-56
WP_050939778.1|482391_482841_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	3.9e-63
WP_050939774.1|482837_483182_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	2.1e-56
WP_050939772.1|483242_483947_+	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	96.6	7.9e-119
WP_000164661.1|483961_484333_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_050939796.1|484356_484635_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	1.6e-43
WP_077793285.1|484681_487957_+	tape measure protein	NA	A0A1B5FPE2	Escherichia_phage	80.2	3.2e-303
485210:485224	attR	CAGTTCAGTCAGGCA	NA	NA	NA	NA
WP_050939768.1|487960_488428_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	52.3	8.3e-40
WP_050939762.1|488424_488907_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	69.2	1.6e-57
WP_050939760.1|488917_489298_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	82.5	9.0e-61
WP_050939757.1|489294_491997_+	MoaD/ThiS family protein	NA	A0A286S259	Klebsiella_phage	58.1	0.0e+00
WP_157904466.1|492039_493950_+|tail	phage tail protein	tail	B1GS50	Salmonella_phage	46.6	5.1e-27
WP_072095528.1|493921_494326_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_050940596.1|495752_496280_+	hypothetical protein	NA	Q9LA59	Enterobacterial_phage	73.2	3.7e-60
WP_050939632.1|496667_496916_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	4.5e-37
WP_000202564.1|497135_498722_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|499114_499720_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|499846_500008_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|500129_501203_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563055.1|501199_501982_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088405.1|502094_502958_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_047087182.1|502929_504480_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|504737_505517_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477811.1|505643_506966_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_000816471.1|507017_508241_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|508320_509040_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566138.1|509314_509464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105865.1|509495_510512_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|510539_511184_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|511289_512258_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_151039448.1|512306_513689_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|513709_514942_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|515248_516916_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|517126_519064_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|519153_519480_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001338221.1|519521_520034_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_050939635.1|520085_520733_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|520729_521599_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|521809_522283_+	protein CreA	NA	NA	NA	NA	NA
WP_001188659.1|522295_522985_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219614.1|522984_524409_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_000920337.1|524466_525819_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|525878_526595_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|526690_526831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223181.1|527230_527917_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	725290	788155	5264698	tRNA,plate,protease,transposase	Escherichia_phage(20.0%)	51	NA	NA
WP_001295561.1|725290_726643_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|726672_729105_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|729226_729712_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|729715_730741_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|730845_731301_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|731304_732093_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000166360.1|732092_733241_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569401.1|733237_733834_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	3.9e-26
WP_001294757.1|733868_737351_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|737363_738323_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|738421_740563_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|740619_741009_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176525.1|741073_742372_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|742420_742681_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|742667_742868_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185294.1|743033_743579_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|743575_743998_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|744011_744722_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001325359.1|744876_745701_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_050938964.1|745753_747472_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094031.1|747582_748290_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|748286_748691_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|748808_749624_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|749663_750317_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|750309_751341_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140186.1|751528_752101_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|757852_758656_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000255944.1|759339_760362_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|760361_761141_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001230983.1|761766_762567_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211686.1|762644_763415_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|763462_764821_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052721.1|764892_765648_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|765681_766404_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|766400_766868_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|766932_767664_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086139.1|768202_768988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|769614_770529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|770572_771055_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|771078_772431_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122985538.1|772441_775876_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240524.1|775984_777397_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_050940106.1|777401_778145_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614400.1|778141_780907_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|780915_781677_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246444.1|781681_783013_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|783015_783540_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|783536_784817_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_050940104.1|784841_785924_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|785887_787738_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|787741_788155_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	822841	837111	5264698	integrase	Enterobacteria_phage(87.5%)	14	820972:820985	833570:833583
820972:820985	attL	CTGCCGCCATTCTT	NA	NA	NA	NA
WP_075631356.1|822841_824008_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.9	1.5e-143
WP_072648910.1|824019_825264_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_072648911.1|825256_825910_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_151039271.1|826123_826696_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	4.2e-94
WP_000638628.1|826769_827270_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_151039273.1|827266_828001_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	8.8e-129
WP_001149160.1|828553_828820_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_052897488.1|829409_829697_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	95.8	9.5e-47
WP_151039701.1|829689_830145_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
WP_000856725.1|830280_830601_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_136829793.1|830615_832949_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_001111353.1|833557_833968_-	hypothetical protein	NA	NA	NA	NA	NA
833570:833583	attR	CTGCCGCCATTCTT	NA	NA	NA	NA
WP_000121354.1|833946_834903_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_050940121.1|834912_837111_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.9	6.7e-39
>prophage 5
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	1085645	1155035	5264698	terminase,transposase,head,tail,protease,lysis,tRNA,portal,capsid,integrase	Enterobacteria_phage(42.86%)	72	1095807:1095853	1146509:1146555
WP_000912345.1|1085645_1087031_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1087066_1087588_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1087695_1087908_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_050938753.1|1087909_1088776_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.3e-30
WP_000776555.1|1089256_1089799_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_050938752.1|1090018_1090711_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_050938751.1|1090741_1093351_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691054.1|1093363_1094371_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|1094381_1094897_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1094899_1095532_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1095807:1095853	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001624790.1|1095866_1097030_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	5.2e-200
WP_000206812.1|1097256_1097562_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	9.2e-48
WP_000008165.1|1097915_1098452_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_135259079.1|1098579_1099404_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.5	1.9e-148
WP_000135680.1|1099469_1099832_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000559922.1|1100302_1100818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135259078.1|1101137_1101830_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	1.3e-126
WP_001191674.1|1101927_1102188_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515847.1|1102180_1102732_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_001250269.1|1102907_1103087_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104986.1|1103076_1104018_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	1.9e-152
WP_000255944.1|1104284_1105307_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|1105306_1106086_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000210176.1|1106468_1106795_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|1106791_1107181_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061408.1|1107200_1107998_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_089613523.1|1108005_1108995_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001204780.1|1109012_1109396_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_151039280.1|1109585_1110683_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	1.8e-154
WP_000670959.1|1111271_1111487_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|1111486_1111984_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1112200_1112383_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1112473_1112767_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_089613521.1|1113057_1113468_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1113753_1113960_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1114124_1114319_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453587.1|1114707_1115253_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|1115227_1117153_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1117149_1117356_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001316285.1|1117352_1118954_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_016244345.1|1118934_1120266_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	96.3	2.8e-226
WP_001565292.1|1120275_1120608_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	91.8	3.3e-51
WP_000118193.1|1120663_1121689_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_016244346.1|1121730_1122126_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	89.4	3.2e-53
WP_000753019.1|1122137_1122491_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975048.1|1122502_1123081_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_151039283.1|1123077_1123473_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.1e-69
WP_001349920.1|1123480_1124221_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|1124236_1124659_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1124640_1125075_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840258.1|1125067_1127629_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|1127625_1127955_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152667.1|1127954_1128653_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
WP_001361264.1|1128658_1129402_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.1e-150
WP_000090917.1|1129338_1129971_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_151039286.1|1130031_1133430_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	89.3	0.0e+00
WP_089613516.1|1133496_1134096_+	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	98.0	6.3e-109
WP_089613515.1|1134160_1137763_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	97.7	0.0e+00
WP_000488338.1|1138062_1138953_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1138971_1139478_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1139514_1140015_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1140093_1140276_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1140773_1141442_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226371.1|1141986_1143471_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201812.1|1143657_1144611_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|1145109_1145694_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001298108.1|1145718_1146156_-	acetyltransferase	NA	NA	NA	NA	NA
WP_050938750.1|1146598_1147360_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1146509:1146555	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224567.1|1147542_1148433_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001580085.1|1148433_1151406_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|1151392_1153630_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420923.1|1153898_1155035_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	1582647	1697987	5264698	terminase,transposase,head,tail,protease,holin,portal,capsid,integrase	Enterobacteria_phage(41.67%)	136	1597729:1597788	1693250:1693314
WP_000156526.1|1582647_1584408_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1584593_1585046_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1585121_1586162_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1586518_1587028_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1587246_1587876_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_072095558.1|1587838_1590001_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1590010_1590457_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420537.1|1590579_1592634_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1592665_1593124_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1593219_1593882_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1594054_1594468_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1594512_1594830_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1594887_1596078_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1596172_1596451_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1596447_1596777_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1596867_1597527_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1597729:1597788	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_072095559.1|1597934_1598954_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000273158.1|1598922_1599174_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_050940245.1|1599240_1601706_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	7.3e-103
WP_050940247.1|1601783_1601987_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032215066.1|1601983_1602172_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_050940250.1|1602726_1603239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|1603846_1604869_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|1604868_1605648_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001678562.1|1606320_1606476_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_042973537.1|1606641_1607049_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	53.1	9.8e-13
WP_000920567.1|1607131_1607362_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_050940044.1|1607345_1607897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940042.1|1607868_1608909_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	92.0	9.6e-97
WP_157902152.1|1608820_1609363_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	8.3e-84
WP_050940040.1|1609397_1610183_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	47.4	7.4e-49
WP_077793295.1|1610239_1610494_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.5	1.2e-21
WP_050940036.1|1610490_1610787_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	5.4e-45
WP_050940034.1|1610979_1611291_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	6.9e-51
WP_050940032.1|1611418_1611601_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	1.3e-25
WP_032215076.1|1611593_1611770_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	3.3e-26
WP_077793294.1|1611766_1612186_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	82.7	3.3e-40
WP_050940030.1|1612294_1612582_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	50.5	8.7e-16
WP_050940027.1|1613431_1613692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063113410.1|1613758_1614037_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	3.3e-12
WP_050940018.1|1614038_1615085_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	5.0e-109
WP_050940016.1|1615097_1615469_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	9.8e-36
WP_050940013.1|1615458_1615830_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_050940011.1|1615983_1616802_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917767.1|1617088_1617286_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_050940008.1|1617396_1618443_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.9	2.2e-189
WP_032215181.1|1619213_1619603_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.8	7.1e-45
WP_047649223.1|1619592_1619871_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	83.7	2.4e-34
WP_050940005.1|1619872_1620418_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.5	2.4e-91
WP_050940003.1|1620485_1620767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940000.1|1621424_1621973_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	85.6	2.1e-58
WP_050939997.1|1621944_1623861_+|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	64.8	1.5e-252
WP_000640654.1|1623864_1624074_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	49.2	1.0e-10
WP_050552957.1|1624118_1625642_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.8	6.8e-184
WP_050939995.1|1625631_1627248_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.4	1.0e-100
WP_050939993.1|1627288_1627624_+|head	head decoration protein	head	A0A0K2FIF9	Escherichia_phage	49.1	6.8e-20
WP_040073334.1|1627693_1628722_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.7	5.8e-110
WP_042973861.1|1628770_1629151_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	61.1	2.8e-09
WP_000753028.1|1629164_1629539_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	59.8	3.1e-29
WP_050939991.1|1629525_1630116_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	69.9	3.1e-68
WP_047649236.1|1630112_1630514_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	82.7	3.3e-61
WP_000211140.1|1630524_1631265_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	85.7	2.4e-110
WP_000478930.1|1631321_1631711_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	66.7	1.2e-39
WP_072095543.1|1631719_1632034_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	73.1	2.6e-37
WP_050939989.1|1632017_1635041_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	76.1	0.0e+00
WP_050939987.1|1635040_1635370_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	81.5	1.1e-46
WP_001152670.1|1635379_1636078_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	85.3	2.5e-117
WP_072095542.1|1636082_1636826_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.9	1.4e-142
WP_063113317.1|1636723_1637371_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	80.9	7.8e-97
WP_063113316.1|1637431_1640845_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.9	0.0e+00
WP_050939977.1|1640914_1641514_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	1.3e-109
WP_072095541.1|1641578_1644650_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001443470.1|1644649_1645231_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	6.8e-100
WP_172636179.1|1646021_1647257_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_001396447.1|1648711_1649731_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.0	4.4e-86
WP_000273158.1|1649699_1649951_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_151039303.1|1650017_1652489_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	3.8e-59
WP_001090193.1|1652569_1652773_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449183.1|1652769_1652958_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000373330.1|1653651_1654098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345627.1|1654176_1654551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047649242.1|1654562_1654715_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.6e-07
WP_059222065.1|1655030_1655507_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1655630_1655927_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693884.1|1655949_1656375_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_047649206.1|1656446_1657517_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	1.0e-64
WP_047649207.1|1657562_1658357_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	50.2	5.9e-54
WP_047649208.1|1658373_1658796_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.4e-64
WP_040072812.1|1658853_1659210_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	3.9e-58
WP_047649210.1|1659260_1659473_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	2.4e-31
WP_042973577.1|1659505_1659724_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	97.2	1.2e-30
WP_001229296.1|1659725_1660091_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000350274.1|1660198_1660432_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000220601.1|1660636_1660936_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_047649213.1|1660941_1661199_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.9e-30
WP_047649247.1|1661334_1661607_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.1e-11
WP_047649215.1|1661608_1662658_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.2e-109
WP_000510632.1|1662670_1663030_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	2.4e-39
WP_047649217.1|1663026_1663692_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	5.4e-61
WP_047649218.1|1663947_1664661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|1664834_1665032_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_151039305.1|1665182_1666229_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	86.0	8.0e-176
WP_047649221.1|1666996_1667386_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	87.7	9.9e-47
WP_047649223.1|1667375_1667654_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	83.7	2.4e-34
WP_047649225.1|1667655_1668201_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.1	2.9e-92
WP_040073338.1|1668576_1668858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417401.1|1668929_1669112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137455798.1|1669268_1669451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000826254.1|1669624_1669849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373032.1|1669889_1670105_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	63.6	2.8e-19
WP_047649229.1|1670167_1670560_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	95.8	4.1e-48
WP_157777103.1|1670719_1670878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421825.1|1671135_1671675_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001396463.1|1671683_1673783_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.7	0.0e+00
WP_001072973.1|1673779_1673992_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_077630415.1|1673919_1675500_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	3.6e-289
WP_087514505.1|1675444_1677472_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097045.1|1677558_1677882_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|1677874_1678150_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677112.1|1678161_1678740_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079419.1|1678736_1679138_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211106.1|1679148_1679892_+	Ig-like domain-containing protein	NA	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
WP_096970531.1|1679951_1680338_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	3.4e-63
WP_001161009.1|1680346_1680676_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_089613568.1|1680647_1683719_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	90.7	0.0e+00
WP_000447259.1|1683718_1684048_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	98.2	5.6e-59
WP_047089946.1|1684057_1684756_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	95.3	1.1e-128
WP_089613593.1|1684761_1685505_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.7	9.2e-142
WP_000090862.1|1685441_1686044_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	6.2e-88
WP_151039306.1|1686104_1689584_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	90.1	0.0e+00
WP_089613414.1|1689642_1692228_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	50.1	5.5e-125
WP_047089940.1|1692231_1692762_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	75.4	2.1e-71
WP_001058323.1|1693768_1694887_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1693250:1693314	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|1694883_1696677_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|1696695_1697403_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1697399_1697987_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	2058250	2110099	5264698	terminase,plate,tail,holin,tRNA	Escherichia_phage(80.7%)	61	NA	NA
WP_000628065.1|2058250_2059483_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|2059737_2060721_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|2061198_2062572_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157377.1|2062700_2063636_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_072017917.1|2063687_2064923_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	100.0	1.5e-242
WP_000079604.1|2064924_2065140_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_151039308.1|2065239_2065428_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	9.4e-27
WP_021500490.1|2065420_2065615_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_021529594.1|2065678_2066767_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	100.0	7.7e-206
WP_042973008.1|2066781_2069856_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	84.5	0.0e+00
WP_001349883.1|2070306_2070477_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
WP_000560209.1|2070476_2070698_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	8.1e-38
WP_052318200.1|2071118_2071271_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_042973012.1|2071652_2072117_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	70.2	8.2e-56
WP_000171139.1|2072221_2072497_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_045174332.1|2072480_2072903_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.3e-68
WP_010358686.1|2072980_2073769_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	6.7e-42
WP_042972910.1|2073775_2074522_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	7.3e-115
WP_042972909.1|2074542_2075304_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	3.6e-117
WP_042972908.1|2075319_2075742_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	97.1	7.7e-69
WP_151039310.1|2075738_2075993_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	86.9	7.2e-38
WP_042972904.1|2075985_2076297_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	5.3e-51
WP_000018421.1|2077365_2077578_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000687438.1|2077798_2077972_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	70.4	1.4e-16
WP_045174340.1|2078031_2078631_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	7.7e-107
WP_045174342.1|2078630_2078921_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
WP_045174344.1|2078917_2079460_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	2.1e-74
WP_001285363.1|2079913_2080627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151039312.1|2082745_2083138_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	80.0	6.5e-46
WP_000016408.1|2083127_2083403_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	95.6	3.6e-43
WP_000014549.1|2083405_2083783_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	1.3e-64
WP_000087514.1|2083797_2083980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045174350.1|2084384_2085176_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	5.7e-49
WP_045174352.1|2085168_2086101_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.6e-82
WP_170815536.1|2086036_2086288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151039314.1|2086291_2087383_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	90.8	1.3e-144
WP_061354756.1|2087372_2088701_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.6	5.4e-262
WP_001559065.1|2088719_2090156_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	96.2	2.7e-267
WP_045174362.1|2090100_2090934_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.4	5.8e-153
WP_042972883.1|2090914_2092237_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.9	3.2e-190
WP_042972882.1|2092229_2092847_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	97.1	2.7e-115
WP_001272364.1|2092861_2093890_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.1	1.6e-189
WP_000780862.1|2093947_2094418_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	4.2e-84
WP_000175376.1|2094417_2094858_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_023568482.1|2094854_2095295_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	3.7e-82
WP_042972881.1|2095281_2096226_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.0	1.1e-171
WP_042972877.1|2096225_2097563_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	97.3	2.5e-246
WP_042972875.1|2097586_2098018_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	9.6e-75
WP_042972873.1|2098014_2098632_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	75.0	3.0e-82
WP_151039316.1|2098696_2100772_+	lytic transglycosylase domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	43.1	5.6e-128
WP_000056327.1|2100775_2101444_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	97.3	4.0e-120
WP_000209263.1|2101440_2101707_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	98.9	2.8e-45
WP_001271166.1|2101706_2102714_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	91.0	8.0e-181
WP_000063620.1|2102713_2103427_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	94.5	4.1e-123
WP_001261327.1|2103709_2104057_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.2e-61
WP_000426902.1|2104206_2105367_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	30.3	2.2e-33
WP_071790993.1|2105407_2106634_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	98.8	1.3e-225
WP_001199731.1|2106617_2107244_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	100.0	2.0e-121
WP_047613457.1|2107240_2108794_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	77.7	9.0e-224
WP_000902858.1|2108796_2109342_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	74.7	2.7e-74
WP_001434761.1|2109775_2110099_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	78.5	4.7e-42
>prophage 8
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	2300783	2355906	5264698	terminase,transposase,head,tail,holin,portal,capsid,lysis,integrase	Enterobacteria_phage(39.58%)	65	2304583:2304599	2356245:2356261
WP_050939527.1|2300783_2301164_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	40.2	3.0e-16
WP_050939529.1|2301156_2301768_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	43.1	1.7e-37
WP_157904468.1|2301767_2302859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050939533.1|2303585_2307065_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.0	0.0e+00
2304583:2304599	attL	GCCAGATGGGTTTTCCC	NA	NA	NA	NA
WP_050939537.1|2307694_2308438_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.0e-146
WP_001152619.1|2308443_2309142_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_050939578.1|2309141_2309471_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	2.4e-57
WP_050939581.1|2309467_2312017_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.9	0.0e+00
WP_072095516.1|2311997_2312411_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	86.3	4.6e-42
WP_047624210.1|2312437_2312866_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.9	6.2e-42
WP_050939599.1|2312881_2313631_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.2	9.0e-129
WP_001357870.1|2313638_2314034_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	2.9e-70
WP_050939586.1|2314030_2314609_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	91.7	1.7e-79
WP_001204540.1|2314620_2314974_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_050939589.1|2314966_2315341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522651.1|2315392_2316421_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_050939591.1|2316478_2316817_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	51.9	1.5e-22
WP_151039322.1|2316813_2318319_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.8e-99
WP_135259093.1|2318308_2319901_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_000259002.1|2319897_2320104_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_063113294.1|2320087_2322016_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.3	7.4e-260
WP_050940352.1|2321987_2322536_-|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	62.8	1.4e-59
WP_047089466.1|2322924_2323164_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	76.6	6.3e-20
WP_077782553.1|2323375_2323558_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	72.4	4.4e-13
WP_047672888.1|2323774_2324308_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	2.4e-96
WP_072033262.1|2324421_2324682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047672890.1|2324629_2325181_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	66.7	2.0e-37
WP_050940350.1|2325185_2325401_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	93.0	8.5e-32
WP_050940343.1|2326492_2327554_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	91.1	8.4e-189
WP_000917767.1|2327704_2327902_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_050940339.1|2328126_2328693_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	63.9	7.2e-46
WP_050940359.1|2328974_2329358_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	2.9e-59
WP_047654522.1|2329350_2329728_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.8e-37
WP_050940337.1|2329728_2330787_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	3.7e-88
WP_050940336.1|2330788_2331067_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_050940333.1|2331133_2331385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050940330.1|2331601_2331814_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_050940328.1|2332340_2332928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151252.1|2333200_2333602_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	6.0e-63
WP_000054495.1|2333642_2334608_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_000705360.1|2334588_2335110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|2335093_2335321_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|2335401_2335809_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379591.1|2335977_2336130_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_170990527.1|2336129_2336507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|2336475_2336676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2337178_2337367_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|2337363_2337555_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_050940326.1|2337648_2340120_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2340192_2340444_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_050940323.1|2340478_2341759_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	8.6e-156
WP_001360138.1|2341778_2341889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836059.1|2341946_2342966_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_050940321.1|2342977_2344192_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
WP_000598292.1|2344397_2344724_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|2344858_2345200_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2345234_2345795_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2345797_2346508_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|2346615_2346921_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_050940319.1|2347119_2349546_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.0e-213
WP_072095568.1|2349606_2352030_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|2352040_2352658_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|2352659_2353514_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2353556_2354171_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000255944.1|2354883_2355906_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
2356245:2356261	attR	GGGAAAACCCATCTGGC	NA	NA	NA	NA
>prophage 9
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	2595365	2686179	5264698	terminase,transposase,head,tail,protease,holin,capsid,tRNA,portal,lysis,integrase	Escherichia_phage(43.84%)	109	2667205:2667221	2690606:2690622
WP_000984517.1|2595365_2596247_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|2596438_2598487_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2598506_2599205_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2599301_2599799_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207284.1|2599928_2601212_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_050939622.1|2601180_2603814_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001307251.1|2603893_2605333_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2605450_2605687_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2605791_2605983_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2605983_2606640_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|2607035_2607377_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|2607389_2608262_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2608265_2608640_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2608778_2609009_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2609110_2609767_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_050939619.1|2609790_2610453_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	1.2e-07
WP_000936936.1|2610449_2612510_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2612718_2613378_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2613704_2614061_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2614127_2614418_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|2614551_2615730_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2615785_2616427_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|2616463_2618275_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|2618509_2619985_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|2620322_2621192_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091176.1|2621319_2622762_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2622892_2623864_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2623983_2625306_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_050939628.1|2625321_2626254_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2626332_2627088_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2627084_2627870_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2628016_2629027_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2629035_2629647_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2629785_2629851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|2629921_2630524_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2630525_2631047_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|2631081_2631822_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|2631850_2632303_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2632295_2634068_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2634377_2634944_+	hydrolase	NA	NA	NA	NA	NA
WP_001217534.1|2635261_2635510_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	87.8	8.0e-34
WP_050939615.1|2635779_2636451_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	1.1e-106
WP_050939614.1|2636519_2637788_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	98.2	1.9e-54
WP_000078855.1|2637932_2638073_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_050939610.1|2638271_2641958_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.4	0.0e+00
WP_123130871.1|2642198_2642831_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	7.9e-102
WP_050939605.1|2642776_2643520_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	1.2e-149
WP_001499019.1|2643530_2644229_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_000847279.1|2644228_2644558_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_050939603.1|2644554_2647128_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.3	0.0e+00
WP_000533402.1|2647108_2647522_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|2647548_2647980_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235046.1|2647993_2648746_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.0e-132
WP_000683079.1|2648753_2649149_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_024213759.1|2649145_2649721_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_001204554.1|2649736_2650090_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2650082_2650466_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2650517_2651546_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_024213760.1|2651603_2651951_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	1.5e-22
WP_032285156.1|2651987_2653493_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	2.5e-98
WP_032285154.1|2653482_2655075_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_000259002.1|2655071_2655278_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_032285152.1|2655261_2657190_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.5e-260
WP_000235436.1|2657161_2657671_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|2658065_2658260_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|2658620_2658914_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_077628513.1|2659004_2659187_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_032285289.1|2659403_2659901_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_032285291.1|2659900_2660116_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001290230.1|2660193_2660439_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_032285293.1|2660479_2660659_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	91.5	7.8e-23
WP_050940079.1|2660795_2662760_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	78.6	3.8e-296
WP_000752026.1|2663264_2663534_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_050940076.1|2663543_2664491_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	9.2e-171
WP_001204859.1|2664997_2665432_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144764.1|2665424_2665619_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|2665615_2666221_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_050940073.1|2666220_2666943_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.2	3.3e-128
WP_050940070.1|2667017_2667752_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	99.2	1.8e-121
2667205:2667221	attL	TGAATCAGTTTTAATGC	NA	NA	NA	NA
WP_001254256.1|2668026_2668209_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_050940068.1|2668205_2668733_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	3.6e-100
WP_000736913.1|2668729_2669170_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_050940065.1|2669444_2669735_-	protein ren	NA	O48423	Enterobacteria_phage	99.0	1.6e-46
WP_050940062.1|2669731_2670433_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	6.4e-129
WP_135259131.1|2670429_2671368_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	3.7e-172
WP_000442609.1|2671400_2671697_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2671838_2672054_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096002361.1|2672127_2672823_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	3.3e-133
WP_001062368.1|2672862_2673420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968517.1|2673416_2674169_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|2674445_2674628_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088203.1|2674605_2674878_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_050940058.1|2674936_2675386_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_000776961.1|2675574_2675886_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_001549082.1|2675961_2676132_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	82.1	2.5e-18
WP_001549081.1|2676128_2676293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000604110.1|2676377_2676686_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_000065845.1|2676682_2677585_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.1	3.3e-146
WP_050940056.1|2677568_2678051_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	9.3e-79
WP_000753560.1|2678062_2678377_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	2.7e-50
WP_001323403.1|2678536_2679316_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|2679315_2680338_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001214456.1|2680630_2680795_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_050939314.1|2680791_2681466_+	hypothetical protein	NA	K7P729	Enterobacteria_phage	52.7	1.8e-51
WP_072018156.1|2681462_2681696_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_050939321.1|2681682_2682387_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	61.2	1.1e-32
WP_032285306.1|2682389_2682881_+	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	9.8e-84
WP_151039328.1|2684489_2685398_+|integrase	tyrosine-type recombinase/integrase	integrase	Q859D2	Escherichia_coli_phage	95.5	2.3e-150
WP_172636180.1|2685363_2686179_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.4e-72
2690606:2690622	attR	TGAATCAGTTTTAATGC	NA	NA	NA	NA
>prophage 10
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	2694027	2760649	5264698	terminase,plate,head,tail,holin,capsid,tRNA,portal,integrase	Enterobacteria_phage(74.0%)	80	2724937:2724996	2761592:2761715
WP_001025342.1|2694027_2695761_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001259583.1|2696546_2696939_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|2696938_2699017_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000983609.1|2700358_2701003_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2701013_2701403_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|2701417_2702467_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|2702469_2703330_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483220.1|2703348_2704950_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001297437.1|2704995_2706657_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2706801_2707305_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_072095501.1|2707325_2709290_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2709294_2710221_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|2710217_2711105_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2711231_2711810_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2711812_2712163_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|2712942_2713371_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2713377_2714802_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_021563705.1|2714776_2715577_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2715743_2716730_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_050939309.1|2716744_2718259_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|2718328_2719318_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2720114_2720618_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2720696_2720948_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2721062_2721149_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|2721411_2721735_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|2721905_2722403_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377223.1|2722440_2722680_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|2722871_2724083_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|2724144_2724810_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2724937:2724996	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|2725166_2726168_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865207.1|2726173_2726521_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290349.1|2726550_2727201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2727216_2727621_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|2727710_2727848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2727919_2728123_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739030.1|2728144_2728495_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	1.5e-49
WP_000159456.1|2728505_2728784_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000357028.1|2728795_2729038_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021659.1|2729034_2729148_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	4.0e-09
WP_000543031.1|2729241_2729652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2729675_2729879_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|2729875_2730142_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104296.1|2730138_2730438_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	2.8e-41
WP_001372767.1|2730449_2731067_+	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_032083492.1|2731063_2731453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151039330.1|2731449_2734290_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.9	0.0e+00
WP_000686536.1|2734366_2735326_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	3.8e-180
WP_000211291.1|2735330_2735642_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	7.7e-50
WP_000759755.1|2735702_2736227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021520797.1|2736223_2736814_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	54.4	2.3e-31
WP_000087812.1|2737304_2738351_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613782.1|2738350_2740102_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_021520799.1|2740256_2741093_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	3.0e-149
WP_001055104.1|2741116_2742169_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_021520800.1|2742214_2743015_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	90.2	2.8e-128
WP_000063103.1|2743116_2743611_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_021520801.1|2743610_2743811_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	5.1e-31
WP_000104350.1|2743813_2744137_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2744133_2744526_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780560.1|2744522_2744930_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000920594.1|2745067_2745535_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356358.1|2745527_2746163_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001705833.1|2746174_2746741_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.9	2.3e-100
WP_170997562.1|2746758_2747088_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	1.9e-54
WP_021520802.1|2747091_2747988_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.0e-155
WP_078331657.1|2747980_2748511_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	7.3e-93
WP_151039332.1|2748513_2750499_+|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.6	3.4e-175
WP_021520804.1|2750501_2751035_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	5.5e-96
WP_021520805.1|2751063_2751591_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	96.0	2.0e-90
WP_019841410.1|2751594_2752431_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	93.2	2.1e-150
WP_000905061.1|2752535_2753135_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|2753163_2753652_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_151039334.1|2753664_2756472_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.0	0.0e+00
WP_000333503.1|2756458_2756614_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2756622_2756997_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_096936375.1|2757052_2757565_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	1.2e-92
WP_151039336.1|2757564_2758749_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	96.4	1.3e-219
WP_021520808.1|2758906_2760016_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	95.9	7.9e-198
WP_000488107.1|2760058_2760319_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2760508_2760649_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
2761592:2761715	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 11
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	2991663	2999972	5264698		Enterobacteria_phage(83.33%)	9	NA	NA
WP_050938814.1|2991663_2993664_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2993788_2994250_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2994290_2994761_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2994807_2995527_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2995523_2997209_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2997430_2998162_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2998221_2998329_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2998309_2999041_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|2999045_2999972_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 12
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	3232336	3318352	5264698	integrase,transposase	Enterobacteria_phage(16.67%)	49	3246237:3246296	3317244:3319198
WP_085947598.1|3232336_3233498_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001195819.1|3234366_3234852_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_050940191.1|3235054_3237199_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|3237198_3238509_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3238688_3238973_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|3239344_3240685_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_135259174.1|3241048_3242107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3242288_3243044_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3243337_3244270_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_001131474.1|3244595_3245786_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	5.8e-130
3246237:3246296	attL	TGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTAA	NA	NA	NA	NA
WP_000255944.1|3246322_3247345_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|3247344_3248124_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_151039344.1|3248224_3249386_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000901352.1|3249743_3250760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940277.1|3250759_3251788_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.0	5.0e-13
WP_001066242.1|3256560_3257061_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050939755.1|3257690_3258158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088748.1|3259271_3260093_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_000116047.1|3260102_3260993_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_000414795.1|3261004_3262909_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_000665944.1|3262921_3264055_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000192889.1|3264063_3265092_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000082085.1|3265103_3266651_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	4.6e-10
WP_050939752.1|3266702_3267632_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_050939749.1|3267663_3268650_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_063113454.1|3268934_3270860_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.0	4.8e-25
WP_050939744.1|3270871_3272377_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_050939742.1|3272667_3273531_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157904463.1|3274356_3274707_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_050939729.1|3276023_3277334_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_050939726.1|3277361_3278642_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_050939722.1|3278634_3280437_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	1.8e-21
WP_050939719.1|3280423_3282136_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	26.8	4.0e-31
WP_050939716.1|3282392_3283352_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_050939713.1|3283542_3289650_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	5.2e-33
WP_050939708.1|3289737_3299229_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_050939705.1|3299225_3300326_+	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_000194282.1|3300322_3301126_+	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_001088826.1|3301129_3302707_+	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_050939701.1|3302837_3304859_+	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_050939697.1|3305717_3307688_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_050939694.1|3307706_3308504_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_050939690.1|3308679_3309333_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_050939687.1|3309944_3310583_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.6	3.6e-54
WP_050939684.1|3310567_3311797_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	1.3e-60
WP_172636182.1|3313567_3313918_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	34.3	3.8e-05
WP_050939675.1|3314940_3315234_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	89.7	6.5e-43
WP_050939672.1|3315680_3315950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|3317329_3318352_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
3317244:3319198	attR	TGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTAATCTGCTCTCCTGATTCAGGAGAGCTTATGGTCACTTTTGAGACAGTTATGGAAATTAAAATCCTGCACAAGCAGGGAATGAGTAGCCGGGCGATTGCCAGAGAACTGGGGATCTCCCGCAATACCGTTAAACGTTATTTGCAGGCAAAATCTGAGCCGCCAAAATATACGCCGCGACCTGCTGTTGCTTCACTCCTGGATGAATACCGGGATTATATTCGTCAACGCATCGCCGATGCTCATCCTTACAAAATCCCGGCAACGGTAATCGCTCGCGAGATCAGAGACCAGGGATATCGTGGCGGAATGACCATTCTCAGGGCATTCATTCGTTCTCTCTCGGTTCCTCAGGAGCAGGAGCCTGCCGTTCGGTTCGAAACTGAACCCGGACGACAGATGCAGGTTGACTGGGGCACTATGCGTAATGGTCGCTCACCGCTTCACGTGTTCGTTGCTGTTCTCGGATACAGCCGAATGCTGTACATCGAATTCACTGACAATATGCGTTATGACACGCTGGAGACCTGCCATCGTAATGCGTTCCGCTTCTTTGGTGGTGTGCCGCGCGAAGTGTTGTATGACAATATGAAAACTGTGGTTCTGCAACGTGACGCATATCAGACCGGTCAGCACCGGTTCCATCCTTCGCTGTGGCAGTTCGGCAAGGAGATGGGCTTCTCTCCCCGACTGTGTCGCCCCTTCAGGGCACAGACTAAAGGTAAGGTGGAACGGATGGTGCAGTACACCCGTAACAGTTTTTACATCCCACTAATGACTCGCCTGCGCCCGATGGGGATCACTGTCGATGTTGAAACAGCCAACCGCCACGGTCTGCGCTGGCTGCACGATGTCGCTAACCAACGAAAGCATGAAACAATCCAGGCACGTCCCTGCGATCGCTGGCTCGAAGAGCAGCAGTCCATGCTGGCACTGCCTCCGGAGAAAAAAGAGTATGACGTGCATCTTGATGAAAATCTGGTGAACTTCGACAAACACCCCCTGCATCATCCACTCTCCATCTACGACTCATTCTGCAGAGGAGTGGCGTGATGATGGAACTGCAACATCAACGACTGATGGTGCTCGCCGGGCAGTTGCAACTGGAAAGCCTTATAAGCGCAGCGCCTGCGCTGTCACAACAGGCAGTAGACCAGGAATGGAGTTATATGGACTTCCTGGAGCATCTGCTTCATGAAGAAAAACTGGCACGTCATCAACGTAAACAGGCGATGTATACCCGAATGGCAGCCTTCCCGGCGGTGAAAACGTTCGAAGAGTATGACTTCACATTCGCCACCGGAGCACCGCAGAAGCAACTCCAGTCGTTACGCTCACTCAGCTTCATAGAACGTAATGAAAATATCGTATTACTGGGGCCATCAGGTGTGGGGAAAACCCATCTGGCAATAGCGATGGGCTATGAAGCAGTCCGTGCAGGTATCAAAGTTCGCTTCACAACAGCAGCAGATCTGTTACTTCAGTTATCTACGGCACAACGTCAGGGCCGTTATAAAACGACGCTTCAGCGTGGAGTAATGGCCCCCCGCCTGCTCATCATTGATGAAATAGGCTATCTGCCGTTCAGTCAGGAAGAAGCAAAGCTGTTCTTCCAGGTCATCGCTAAACGTTACGAAAAGAGCGCAATGATCCTGACATCCAATCTGCCGTTCGGGCAGTGGGATCAAACGTTCGCCGGTGATGCAGCACTGACCTCAGCGATGCTGGACCGTATCTTACACCACTCACATGTCGTTCAAATCAAAGGAGAAAGCTATCGACTCAGACAGAAACGAAAGGCCGGGGTTATAGCAGAAGCTAATCCTGAGTAAAACGGTGGATCAATATTGGGCCGTTGGTGGAGATATAAGTGGATCACTTTTCATCCGTCGTTGACAT	NA	NA	NA	NA
>prophage 13
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	3600872	3612321	5264698	integrase	Enterobacteria_phage(72.73%)	13	3596629:3596642	3603977:3603990
3596629:3596642	attL	CATGATAATTTCTT	NA	NA	NA	NA
WP_000162574.1|3600872_3601355_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000124726.1|3602116_3603325_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	6.6e-105
WP_001183325.1|3603328_3605287_+	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	36.3	3.9e-67
3603977:3603990	attR	CATGATAATTTCTT	NA	NA	NA	NA
WP_000446132.1|3605504_3606077_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638635.1|3606150_3606651_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283014.1|3606647_3607382_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	6.1e-130
WP_001149160.1|3607934_3608201_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_123001748.1|3608200_3608623_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	89.8	4.9e-23
WP_001365039.1|3608591_3608789_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	100.0	4.0e-28
WP_052897488.1|3608781_3609069_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	95.8	9.5e-47
WP_000459301.1|3609061_3609517_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|3609652_3609973_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_097462978.1|3609987_3612321_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 14
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	3692392	3705575	5264698		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|3692392_3694954_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|3695059_3695716_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|3695766_3696534_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3696729_3697638_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590397.1|3697634_3698897_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3698893_3699532_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|3699536_3700313_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104429.1|3700401_3701766_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3701859_3702852_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3702914_3704054_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3704193_3704820_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3704813_3705575_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 15
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	4033869	4138786	5264698	transposase,plate,head,tail,protease,integrase	Vibrio_phage(39.22%)	102	4033642:4033658	4086984:4087000
4033642:4033658	attL	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
WP_000534924.1|4033869_4034928_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_040089466.1|4034969_4036625_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_061317333.1|4036617_4038135_-	UvrD-helicase domain-containing protein	NA	A0A126DN25	Acinetobacter_phage	30.8	1.3e-44
WP_040089481.1|4038741_4039386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039364.1|4039406_4039721_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040089482.1|4039755_4040394_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.0	1.0e-56
WP_040089483.1|4040378_4041611_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.5	1.9e-59
WP_170989474.1|4041751_4042396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122992006.1|4044088_4045834_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_072278218.1|4046011_4046560_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.9	8.9e-17
WP_040089554.1|4048600_4048858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039366.1|4048854_4057833_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	39.2	8.4e-56
WP_001243916.1|4057848_4058376_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_061341861.1|4058385_4060038_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.2	1.7e-39
WP_032152656.1|4060714_4060939_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021580257.1|4060947_4061181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050940555.1|4061267_4061891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157839846.1|4062502_4062646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040089161.1|4062765_4063278_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	39.7	4.1e-08
WP_151039456.1|4066094_4067705_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|4067785_4068808_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|4068807_4069587_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_077820601.1|4071193_4071427_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_050940575.1|4071512_4072085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940578.1|4073574_4074594_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_050940580.1|4074703_4075576_+	GTPase family protein	NA	NA	NA	NA	NA
WP_151039368.1|4075948_4078798_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_050940602.1|4078918_4081435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581504.1|4081510_4081966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|4082044_4082278_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|4082377_4083196_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_050938918.1|4083250_4083736_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.3	3.1e-13
WP_001186727.1|4083751_4084228_+	RadC family protein	NA	NA	NA	NA	NA
WP_050938919.1|4084290_4084512_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	3.2e-10
WP_001339471.1|4084674_4085043_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_050938921.1|4085132_4085510_+	toxin	NA	NA	NA	NA	NA
WP_000761721.1|4085506_4085995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839281.1|4086006_4086204_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001290246.1|4086300_4086873_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000942795.1|4087153_4087690_-	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
4086984:4087000	attR	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
WP_000094974.1|4087691_4088870_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000633238.1|4088866_4089844_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_064760790.1|4089846_4090446_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000820125.1|4090442_4090814_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001115139.1|4090810_4091374_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001087296.1|4091377_4091833_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173448.1|4091849_4093073_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_040100330.1|4093582_4094086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100331.1|4094204_4094909_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	97.0	2.0e-130
WP_001372435.1|4094859_4095045_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	72.6	7.5e-21
WP_040100333.1|4095164_4095731_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	83.5	3.9e-84
WP_052924219.1|4098322_4098853_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	70.5	1.6e-68
WP_077793277.1|4098867_4099386_-	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	64.0	5.2e-35
WP_040100337.1|4099866_4100451_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	2.5e-49
WP_040100339.1|4100435_4101512_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.8	7.9e-94
WP_040100341.1|4101501_4101954_-	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	41.4	3.7e-21
WP_000523890.1|4101950_4102487_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	40.2	4.1e-27
WP_052924218.1|4102477_4103548_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	47.2	2.0e-89
WP_052924217.1|4103547_4104822_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	36.7	3.0e-68
WP_052924216.1|4104821_4106615_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	51.5	1.5e-121
WP_001127483.1|4106601_4106739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924215.1|4106701_4107097_-|tail	phage tail assembly protein	tail	M4MB64	Vibrio_phage	48.3	2.1e-20
WP_001062748.1|4107098_4107455_-|tail	phage tail tube protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	35.5	2.9e-13
WP_040100351.1|4107464_4108940_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	55.9	2.5e-154
WP_052924214.1|4108939_4109125_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_052924213.1|4109105_4109717_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	43.8	7.3e-36
WP_000513058.1|4109713_4110256_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	1.6e-58
WP_000540583.1|4110255_4110693_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.7	3.7e-34
WP_001290368.1|4110692_4111004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924212.1|4111082_4111985_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	57.2	1.1e-99
WP_052924211.1|4111984_4112947_-	peptidase	NA	M1Q578	Vibrio_phage	46.6	1.6e-77
WP_052924210.1|4113160_4113925_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	59.7	4.0e-92
WP_052924209.1|4113917_4115489_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.9	6.6e-158
WP_112793722.1|4115485_4117012_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	68.3	2.1e-196
WP_052924208.1|4117017_4117599_-	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	56.0	1.7e-50
WP_001080359.1|4117588_4117747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100367.1|4117736_4118036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024168521.1|4118038_4118326_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	1.6e-25
WP_001557437.1|4118331_4118637_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	40.4	9.6e-13
WP_052924207.1|4118621_4118849_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_000371427.1|4118845_4119454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924206.1|4119441_4119852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924205.1|4119835_4120063_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	68.5	1.4e-24
WP_040100373.1|4120064_4120661_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	43.9	2.7e-35
WP_040100375.1|4120746_4121196_-	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	62.7	4.2e-41
WP_040100376.1|4121192_4121744_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	81.9	7.6e-85
WP_040100378.1|4121721_4122111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100379.1|4122103_4122286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039372.1|4122278_4122821_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	85.9	1.5e-85
WP_001107927.1|4122920_4123445_-	host-nuclease inhibitor Gam family protein	NA	A0A0C4UQY5	Shigella_phage	96.6	1.4e-88
WP_040100384.1|4123465_4123753_-	hypothetical protein	NA	A0A0C4UQR4	Shigella_phage	92.6	1.9e-42
WP_001151278.1|4123772_4124042_-	hypothetical protein	NA	C9DGL5	Escherichia_phage	60.7	1.5e-22
WP_000987801.1|4124074_4124302_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	85.3	8.9e-32
WP_001026713.1|4124315_4125254_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	88.1	1.3e-153
WP_040100386.1|4125292_4127281_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0C4UR24	Shigella_phage	98.2	0.0e+00
WP_001473846.1|4127288_4127510_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	100.0	4.9e-35
WP_040100388.1|4127697_4128222_+	hypothetical protein	NA	A0A0C4UQZ2	Shigella_phage	99.4	3.3e-93
WP_000498836.1|4129723_4131784_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_050938923.1|4131813_4132773_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001324279.1|4132790_4133201_-	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_001297673.1|4133266_4134076_-	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001034492.1|4134223_4138786_-|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
>prophage 16
NZ_CP044312	Escherichia coli strain RM13745 chromosome, complete genome	5264698	5092959	5194954	5264698	terminase,transposase,plate,head,tail,holin,protease,portal,tRNA,capsid,lysis,integrase	Escherichia_phage(39.13%)	104	5122110:5122169	5193865:5195149
WP_000560983.1|5092959_5093397_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|5093441_5094383_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|5094446_5095355_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|5095583_5095895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|5095895_5096186_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|5096790_5097009_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|5097227_5097470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|5097698_5098679_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000027708.1|5099125_5100055_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|5100051_5100687_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|5100683_5101586_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|5101598_5104649_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|5104842_5105676_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001298963.1|5105828_5106869_+	YiiG family protein	NA	NA	NA	NA	NA
WP_050938947.1|5106918_5108667_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_050938948.1|5108666_5109737_-	aminopeptidase	NA	NA	NA	NA	NA
WP_050938949.1|5109726_5111178_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729597.1|5111188_5111635_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|5111935_5112250_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|5112259_5113084_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211502.1|5113325_5114585_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144072.1|5114581_5116051_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217139.1|5116338_5117175_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|5117158_5118097_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063489.1|5118093_5119128_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|5119412_5120033_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166066.1|5120292_5121276_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270266.1|5121424_5122099_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
5122110:5122169	attL	GTAGATACTGTTATGGCCTGCAAGTTTTTTCCTGGTCCGGTTTCCCGGATTGCAGGCATG	NA	NA	NA	NA
WP_000399648.1|5122218_5123199_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000580417.1|5123530_5124904_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|5124900_5125599_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|5125748_5126249_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_021578869.1|5126435_5127416_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.7	1.0e-185
WP_000777029.1|5127485_5127779_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|5127915_5128188_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|5128357_5128858_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557701.1|5128921_5129146_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_042964138.1|5129145_5129448_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	97.0	1.9e-45
WP_001113264.1|5129447_5129672_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_024243679.1|5129668_5129944_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	1.1e-44
WP_042964139.1|5129933_5132219_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_042964140.1|5132330_5134169_+	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	85.9	4.4e-310
WP_042964141.1|5134518_5135553_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	5.5e-201
WP_021538485.1|5135552_5137325_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085953.1|5137498_5138353_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_001248558.1|5138411_5139485_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_044860736.1|5139488_5140232_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_000988633.1|5140331_5140841_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|5140840_5141044_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|5141047_5141329_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144090.1|5141328_5141826_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_044860737.1|5141840_5142266_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	6.1e-58
WP_044860738.1|5142253_5142679_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.3e-65
WP_072146842.1|5142650_5142824_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_042964144.1|5142786_5143254_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_001001786.1|5143246_5143699_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001697715.1|5143765_5144401_+|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	100.0	3.1e-114
WP_000127172.1|5144397_5144745_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_042964146.1|5144749_5145658_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	2.0e-162
WP_042964147.1|5145650_5146181_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.3	5.6e-101
WP_151039388.1|5146191_5148447_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	60.9	3.4e-232
WP_042964149.1|5148448_5148976_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.0	5.4e-88
WP_170990657.1|5149245_5149791_+	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	97.2	2.1e-95
WP_042964151.1|5150120_5151311_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|5151323_5151842_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_016235448.1|5151898_5152174_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.8e-40
WP_000785970.1|5152206_5152326_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_042964152.1|5152318_5154766_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	91.7	0.0e+00
WP_042964153.1|5154780_5155260_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.7	5.6e-84
WP_042964155.1|5155259_5156423_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	8.3e-206
WP_000468308.1|5156504_5156723_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|5156959_5157862_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|5158042_5159005_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_050939263.1|5159324_5160314_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708998.1|5160420_5161176_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|5161230_5161998_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|5162105_5162705_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|5162805_5163246_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|5163457_5163757_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|5163783_5164212_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|5164216_5164963_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|5165059_5166070_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|5166204_5167713_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|5167735_5168581_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|5169006_5169252_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|5169336_5169822_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|5169914_5170841_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|5170907_5172239_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|5172248_5172779_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068837.1|5172871_5173831_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|5173922_5174948_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001341957.1|5175103_5177302_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|5177504_5177717_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_151039390.1|5177876_5182061_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_001323627.1|5182062_5182386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797341.1|5183292_5183901_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|5184084_5184402_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_050940270.1|5184678_5185839_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110772.1|5185841_5188274_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000007523.1|5188622_5189513_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001297636.1|5189841_5192022_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_050940273.1|5192115_5193021_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647874.1|5193047_5193665_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|5193973_5194954_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
5193865:5195149	attR	GTAGATACTGTTATGGCCTGCAAGTTTTTTCCTGGTCCGGTTTCCCGGATTGCAGGCATGCCAGACACAGCGCCGTCAGGCGCTGTTTTTTTCATCCCTTCCGCGATTTTTACGCCGCTACCGGATTATGCCGTGACGCATCGAACGGCACGCCTGACTTCAGCACTCCATACGCCACCTGTGCCAGCTTGCGCATCATCGCGCCGAGAATCACCTTTCCTTTCTTGCCATTAGCCGCCAGACGGTCGCGGAACGCCCGTCCCCACTCAGTCTTACTGGTGGCTACCATTGCGGGCATATACAACGCCCTGCGAAGCGACACATGTCCGGCCTTACTCATCCGGCTCGCCCCTCTCACACTGCTACCTGATTCATAACGCCGTGGTGTCAGACCCGCAAAAGCGGCGAACTGTCTGGCATGGGCGAAGCGGTCCTTCAGACCGATATAAGCCAGCAATACCGCAGATGTTTTCTCTCCGATACCCGGGATGCTTTCCAGCAGTTTCCTGCGGTGTTTCATATCCGGATCATCGTCTGTCAGGTCTTTTATCTGCTTCTCAAGACGCTTCAGCTCTGCTTCAAGCCACAGAAGGTGAGCATCAATGCTCGGTCTCTGGACTTCCCGCGCCGTTTCAGTGCGATTCAGTTCCTGCGTGTGCATATCTGTCAGCGCCTGGTGGCGGACTACCAGGGCACGCAACGCGCGTTCAAGCGGGTGAGGCGCTTCCCAGGCTGCAGGGCGCTTCTGACGACAGAACTCTGCCAGCATGCGCGCATCCACGGTATCAGTCTTGTTACGCAGTCCTTCACTCTGAGCGAAAGCTTTACCCAGCGCAGGATTAATGACTGACACTATGTAGCCAGCATCGTAAAGGCACTCAGCGACAGGTTCCATATAGGTGCCGGTCGCTTCGATGCAGATATGCGCATGGTCAATCTTGTGACCTTTCAGCCAGCTCACCAGCTCATCGTGCCCTTTAGTGGTGTTAGCGAATTTTTTGGTGCGATGACGACCATCAGGACGCAACACATCGACATCCAGTTTCTCTTTAGCGGTGTCGATACCGATATAATGAAGTTCATGTTCCATAGTGAAACCAACCTTGCAAATACGGATTACCGGGAAAACCGGTCCATGATACTGTCCGGTTTATCACTTTGGGAGAAAGGCAGTCCGCTGCATAAATCTACGCAACAGGTTAGAACCCAAGGCCCGATACGGCATGCGGACTGCAGGCAGAGAAAACTGGCCGATTTTCTCTGCACTGGAGGGATAATACAAGGC	NA	NA	NA	NA
