The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	7183	84955	5264517	transposase,plate,integrase	Enterobacteria_phage(39.13%)	67	50882:50897	79186:79201
WP_000255944.1|7183_8206_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|8205_8985_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001230983.1|9610_10411_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211686.1|10488_11259_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|11306_12665_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052721.1|12736_13492_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|13525_14248_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|14244_14712_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|14776_15508_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086139.1|16046_16832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|17458_18373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|18416_18899_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|18922_20275_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122985538.1|20285_23720_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240524.1|23828_25241_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_050940106.1|25245_25989_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614400.1|25985_28751_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|28759_29521_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246444.1|29525_30857_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|30859_31384_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|31380_32661_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_050940104.1|32685_33768_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|33731_35582_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|35585_35999_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|36005_37481_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|37531_37756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037395.1|37790_38291_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|38988_39507_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103319.1|39716_41858_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_050940102.1|41933_46187_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_000978828.1|46198_46648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118055.1|48086_48857_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|49010_49484_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973093.1|49526_51971_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
50882:50897	attL	GCCAGCCTTGCCCGGC	NA	NA	NA	NA
WP_000284050.1|52210_52789_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|52994_53762_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_151039269.1|53732_54473_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_000093939.1|54773_55523_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	2.6e-19
WP_000006256.1|55698_56196_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001323598.1|56513_58253_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_072095554.1|58197_58983_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|59053_60109_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059855.1|60105_60558_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001346146.1|60803_61457_+	RNA ligase RtcB family protein	NA	A0A0A0RRX9	Bacillus_phage	31.9	1.4e-08
WP_000602112.1|61939_62554_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293016.1|62610_64068_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|64328_64787_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|64878_66123_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|66180_66582_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_050940119.1|66620_67676_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	1.1e-116
WP_001285288.1|67963_69067_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893266.1|69078_70332_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_075631356.1|70686_71853_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.9	1.5e-143
WP_072648910.1|71864_73109_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_072648911.1|73101_73755_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_151039271.1|73968_74541_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	4.2e-94
WP_000638628.1|74614_75115_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_151039273.1|75111_75846_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	8.8e-129
WP_001149160.1|76398_76665_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_024191950.1|76661_77261_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	1.7e-50
WP_001244670.1|77253_77541_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_080213682.1|77533_77989_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856725.1|78124_78445_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_136829793.1|78459_80793_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
79186:79201	attR	GCCAGCCTTGCCCGGC	NA	NA	NA	NA
WP_001111353.1|81401_81812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121354.1|81790_82747_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_050940121.1|82756_84955_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.9	6.7e-39
>prophage 2
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	333495	402885	5264517	protease,lysis,portal,tRNA,head,integrase,transposase,terminase,capsid,tail	Enterobacteria_phage(42.86%)	72	343657:343703	394359:394405
WP_000912345.1|333495_334881_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|334916_335438_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|335545_335758_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_050938753.1|335759_336626_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.3e-30
WP_000776555.1|337106_337649_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_050938752.1|337868_338561_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_050938751.1|338591_341201_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691054.1|341213_342221_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|342231_342747_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|342749_343382_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
343657:343703	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001624790.1|343716_344880_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	5.2e-200
WP_000206812.1|345106_345412_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	9.2e-48
WP_000008165.1|345765_346302_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_135259079.1|346429_347254_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.5	1.9e-148
WP_000135680.1|347319_347682_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000559922.1|348152_348668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135259078.1|348987_349680_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	1.3e-126
WP_001191674.1|349777_350038_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515847.1|350030_350582_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_001250269.1|350757_350937_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104986.1|350926_351868_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	1.9e-152
WP_000255944.1|352134_353157_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|353156_353936_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000210176.1|354318_354645_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|354641_355031_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061408.1|355050_355848_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_089613523.1|355855_356845_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001204780.1|356862_357246_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_151039280.1|357435_358533_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	1.8e-154
WP_000670959.1|359121_359337_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|359336_359834_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|360050_360233_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|360323_360617_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_089613521.1|360907_361318_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|361603_361810_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|361974_362169_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453587.1|362557_363103_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|363077_365003_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|364999_365206_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001316285.1|365202_366804_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_016244345.1|366784_368116_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	96.3	2.8e-226
WP_001565292.1|368125_368458_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	91.8	3.3e-51
WP_000118193.1|368513_369539_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_016244346.1|369580_369976_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	89.4	3.2e-53
WP_000753019.1|369987_370341_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975048.1|370352_370931_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_151039283.1|370927_371323_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.1e-69
WP_001349920.1|371330_372071_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|372086_372509_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|372490_372925_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840258.1|372917_375479_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|375475_375805_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152667.1|375804_376503_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
WP_001361264.1|376508_377252_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.1e-150
WP_000090917.1|377188_377821_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_151039286.1|377881_381280_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	89.3	0.0e+00
WP_089613516.1|381346_381946_+	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	98.0	6.3e-109
WP_089613515.1|382010_385613_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	97.7	0.0e+00
WP_000488338.1|385912_386803_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|386821_387328_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|387364_387865_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|387943_388126_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|388623_389292_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226371.1|389836_391321_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201812.1|391507_392461_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|392959_393544_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001298108.1|393568_394006_-	acetyltransferase	NA	NA	NA	NA	NA
WP_050938750.1|394448_395210_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
394359:394405	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224567.1|395392_396283_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001580085.1|396283_399256_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|399242_401480_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420923.1|401748_402885_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	830479	946035	5264517	protease,portal,head,integrase,transposase,terminase,capsid,tail,holin	Enterobacteria_phage(42.11%)	135	845561:845620	941298:941362
WP_000156526.1|830479_832240_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|832425_832878_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|832953_833994_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|834350_834860_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|835078_835708_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_072095558.1|835670_837833_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|837842_838289_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420537.1|838411_840466_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|840497_840956_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|841051_841714_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|841886_842300_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|842344_842662_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|842719_843910_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|844004_844283_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|844279_844609_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|844699_845359_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
845561:845620	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_072095559.1|845766_846786_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000273158.1|846754_847006_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_050940245.1|847072_849538_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	7.3e-103
WP_050940247.1|849615_849819_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032215066.1|849815_850004_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_050940250.1|850558_851071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|851678_852701_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|852700_853480_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001678562.1|854152_854308_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_042973537.1|854473_854881_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	53.1	9.8e-13
WP_000920567.1|854963_855194_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_050940044.1|855177_855729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940042.1|855700_856741_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	92.0	9.6e-97
WP_157902152.1|856652_857195_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	8.3e-84
WP_050940040.1|857229_858015_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	47.4	7.4e-49
WP_077793295.1|858071_858326_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.5	1.2e-21
WP_050940036.1|858322_858619_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	5.4e-45
WP_050940034.1|858811_859123_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	6.9e-51
WP_050940032.1|859250_859433_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	1.3e-25
WP_032215076.1|859425_859602_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	3.3e-26
WP_077793294.1|859598_860018_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	82.7	3.3e-40
WP_050940030.1|860126_860414_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	50.5	8.7e-16
WP_050940027.1|861263_861524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063113410.1|861590_861869_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	3.3e-12
WP_050940018.1|861870_862917_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	5.0e-109
WP_050940016.1|862929_863301_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	9.8e-36
WP_050940013.1|863290_863662_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_050940011.1|863815_864634_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917767.1|864920_865118_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_050940008.1|865228_866275_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.9	2.2e-189
WP_032215181.1|867045_867435_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.8	7.1e-45
WP_047649223.1|867424_867703_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	83.7	2.4e-34
WP_050940005.1|867704_868250_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.5	2.4e-91
WP_050940003.1|868317_868599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940000.1|869256_869805_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	85.6	2.1e-58
WP_050939997.1|869776_871693_+|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	64.8	1.5e-252
WP_000640654.1|871696_871906_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	49.2	1.0e-10
WP_050552957.1|871950_873474_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.8	6.8e-184
WP_050939995.1|873463_875080_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.4	1.0e-100
WP_050939993.1|875120_875456_+|head	head decoration protein	head	A0A0K2FIF9	Escherichia_phage	49.1	6.8e-20
WP_040073334.1|875525_876554_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.7	5.8e-110
WP_042973861.1|876602_876983_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	61.1	2.8e-09
WP_000753028.1|876996_877371_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	59.8	3.1e-29
WP_050939991.1|877357_877948_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	69.9	3.1e-68
WP_047649236.1|877944_878346_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	82.7	3.3e-61
WP_000211140.1|878356_879097_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	85.7	2.4e-110
WP_000478930.1|879153_879543_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	66.7	1.2e-39
WP_072095543.1|879551_879866_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	73.1	2.6e-37
WP_050939989.1|879849_882873_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	76.1	0.0e+00
WP_050939987.1|882872_883202_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	81.5	1.1e-46
WP_001152670.1|883211_883910_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	85.3	2.5e-117
WP_072095542.1|883914_884658_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.9	1.4e-142
WP_063113317.1|884555_885203_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	80.9	7.8e-97
WP_063113316.1|885263_888677_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.9	0.0e+00
WP_050939977.1|888746_889346_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	1.3e-109
WP_072095541.1|889410_892482_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001443470.1|892481_893063_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	6.8e-100
WP_172636179.1|893853_895089_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_001396447.1|896543_897563_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.0	4.4e-86
WP_000273158.1|897531_897783_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_151039303.1|897849_900321_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	3.8e-59
WP_001090193.1|900401_900605_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449183.1|900601_900790_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000373330.1|901483_901930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345627.1|902008_902383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047649242.1|902394_902547_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.6e-07
WP_059222065.1|902862_903339_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|903462_903759_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693884.1|903781_904207_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_047649206.1|904278_905349_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	1.0e-64
WP_047649207.1|905394_906189_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	50.2	5.9e-54
WP_047649208.1|906205_906628_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.4e-64
WP_040072812.1|906685_907042_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	3.9e-58
WP_047649210.1|907092_907305_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	2.4e-31
WP_042973577.1|907337_907556_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	97.2	1.2e-30
WP_001229296.1|907557_907923_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000350274.1|908030_908264_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000220601.1|908468_908768_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_047649213.1|908773_909031_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.9e-30
WP_047649247.1|909166_909439_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.1e-11
WP_047649215.1|909440_910490_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.2e-109
WP_000510632.1|910502_910862_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	2.4e-39
WP_047649218.1|911996_912710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|912883_913081_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_151039305.1|913231_914278_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	86.0	8.0e-176
WP_047649221.1|915045_915435_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	87.7	9.9e-47
WP_047649223.1|915424_915703_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	83.7	2.4e-34
WP_047649225.1|915704_916250_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.1	2.9e-92
WP_040073338.1|916625_916907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417401.1|916978_917161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137455798.1|917317_917500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000826254.1|917673_917898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373032.1|917938_918154_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	63.6	2.8e-19
WP_047649229.1|918216_918609_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	95.8	4.1e-48
WP_157777103.1|918768_918927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421825.1|919183_919723_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001396463.1|919731_921831_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.7	0.0e+00
WP_001072973.1|921827_922040_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_077630415.1|921967_923548_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	3.6e-289
WP_087514505.1|923492_925520_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097045.1|925606_925930_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|925922_926198_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677112.1|926209_926788_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079419.1|926784_927186_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211106.1|927196_927940_+	Ig-like domain-containing protein	NA	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
WP_096970531.1|927999_928386_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	3.4e-63
WP_001161009.1|928394_928724_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_089613568.1|928695_931767_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	90.7	0.0e+00
WP_000447259.1|931766_932096_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	98.2	5.6e-59
WP_047089946.1|932105_932804_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	95.3	1.1e-128
WP_089613593.1|932809_933553_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.7	9.2e-142
WP_000090862.1|933489_934092_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	6.2e-88
WP_151039306.1|934152_937632_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	90.1	0.0e+00
WP_089613414.1|937690_940276_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	50.1	5.5e-125
WP_047089940.1|940279_940810_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	75.4	2.1e-71
WP_001058323.1|941816_942935_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
941298:941362	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|942931_944725_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|944743_945451_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|945447_946035_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	1306298	1358147	5264517	tRNA,terminase,tail,plate,holin	Escherichia_phage(80.7%)	61	NA	NA
WP_000628065.1|1306298_1307531_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|1307785_1308769_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1309246_1310620_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157377.1|1310748_1311684_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_072017917.1|1311735_1312971_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	100.0	1.5e-242
WP_000079604.1|1312972_1313188_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_151039308.1|1313287_1313476_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	9.4e-27
WP_021500490.1|1313468_1313663_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_021529594.1|1313726_1314815_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	100.0	7.7e-206
WP_042973008.1|1314829_1317904_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	84.5	0.0e+00
WP_001349883.1|1318354_1318525_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
WP_000560209.1|1318524_1318746_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	8.1e-38
WP_052318200.1|1319166_1319319_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_042973012.1|1319700_1320165_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	70.2	8.2e-56
WP_000171139.1|1320269_1320545_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_045174332.1|1320528_1320951_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.3e-68
WP_010358686.1|1321028_1321817_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	6.7e-42
WP_042972910.1|1321823_1322570_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	7.3e-115
WP_042972909.1|1322590_1323352_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	3.6e-117
WP_042972908.1|1323367_1323790_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	97.1	7.7e-69
WP_151039310.1|1323786_1324041_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	86.9	7.2e-38
WP_042972904.1|1324033_1324345_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	5.3e-51
WP_000018421.1|1325413_1325626_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000687438.1|1325846_1326020_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	70.4	1.4e-16
WP_045174340.1|1326079_1326679_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	7.7e-107
WP_045174342.1|1326678_1326969_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
WP_045174344.1|1326965_1327508_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	2.1e-74
WP_001285363.1|1327961_1328675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151039312.1|1330793_1331186_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	80.0	6.5e-46
WP_000016408.1|1331175_1331451_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	95.6	3.6e-43
WP_000014549.1|1331453_1331831_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	1.3e-64
WP_000087514.1|1331845_1332028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045174350.1|1332432_1333224_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	5.7e-49
WP_045174352.1|1333216_1334149_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.6e-82
WP_170815536.1|1334084_1334336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151039314.1|1334339_1335431_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	90.8	1.3e-144
WP_061354756.1|1335420_1336749_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.6	5.4e-262
WP_001559065.1|1336767_1338204_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	96.2	2.7e-267
WP_045174362.1|1338148_1338982_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.4	5.8e-153
WP_042972883.1|1338962_1340285_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.9	3.2e-190
WP_042972882.1|1340277_1340895_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	97.1	2.7e-115
WP_001272364.1|1340909_1341938_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.1	1.6e-189
WP_000780862.1|1341995_1342466_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	4.2e-84
WP_000175376.1|1342465_1342906_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_023568482.1|1342902_1343343_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	3.7e-82
WP_042972881.1|1343329_1344274_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.0	1.1e-171
WP_042972877.1|1344273_1345611_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	97.3	2.5e-246
WP_042972875.1|1345634_1346066_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	9.6e-75
WP_042972873.1|1346062_1346680_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	75.0	3.0e-82
WP_151039316.1|1346744_1348820_+	lytic transglycosylase domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	43.1	5.6e-128
WP_000056327.1|1348823_1349492_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	97.3	4.0e-120
WP_000209263.1|1349488_1349755_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	98.9	2.8e-45
WP_001271166.1|1349754_1350762_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	91.0	8.0e-181
WP_000063620.1|1350761_1351475_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	94.5	4.1e-123
WP_001261327.1|1351757_1352105_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.2e-61
WP_000426902.1|1352254_1353415_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	30.3	2.2e-33
WP_071790993.1|1353455_1354682_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	98.8	1.3e-225
WP_001199731.1|1354665_1355292_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	100.0	2.0e-121
WP_047613457.1|1355288_1356842_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	77.7	9.0e-224
WP_000902858.1|1356844_1357390_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	74.7	2.7e-74
WP_001434761.1|1357823_1358147_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	78.5	4.7e-42
>prophage 5
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	1548834	1603957	5264517	lysis,portal,head,integrase,transposase,terminase,capsid,tail,holin	Enterobacteria_phage(40.43%)	64	1552634:1552650	1604296:1604312
WP_050939527.1|1548834_1549215_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	40.2	3.0e-16
WP_050939529.1|1549207_1549819_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	43.1	1.7e-37
WP_157904468.1|1549818_1550910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050939533.1|1551636_1555116_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.0	0.0e+00
1552634:1552650	attL	GCCAGATGGGTTTTCCC	NA	NA	NA	NA
WP_050939537.1|1555745_1556489_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.0e-146
WP_001152619.1|1556494_1557193_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_050939578.1|1557192_1557522_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	2.4e-57
WP_050939581.1|1557518_1560068_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.9	0.0e+00
WP_047624210.1|1560489_1560918_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.9	6.2e-42
WP_050939599.1|1560933_1561683_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.2	9.0e-129
WP_001357870.1|1561690_1562086_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	2.9e-70
WP_050939586.1|1562082_1562661_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	91.7	1.7e-79
WP_001204540.1|1562672_1563026_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_050939589.1|1563018_1563393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522651.1|1563444_1564473_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_050939591.1|1564530_1564869_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	51.9	1.5e-22
WP_151039322.1|1564865_1566371_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.8e-99
WP_135259093.1|1566360_1567953_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_000259002.1|1567949_1568156_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_063113294.1|1568139_1570068_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.3	7.4e-260
WP_050940352.1|1570039_1570588_-|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	62.8	1.4e-59
WP_047089466.1|1570976_1571216_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	76.6	6.3e-20
WP_077782553.1|1571427_1571610_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	72.4	4.4e-13
WP_047672888.1|1571826_1572360_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	2.4e-96
WP_072033262.1|1572473_1572734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047672890.1|1572681_1573233_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	66.7	2.0e-37
WP_050940350.1|1573237_1573453_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	93.0	8.5e-32
WP_050940343.1|1574544_1575606_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	91.1	8.4e-189
WP_000917767.1|1575756_1575954_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_050940339.1|1576178_1576745_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	63.9	7.2e-46
WP_050940359.1|1577026_1577410_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	2.9e-59
WP_047654522.1|1577402_1577780_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.8e-37
WP_050940337.1|1577780_1578839_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	3.7e-88
WP_050940336.1|1578840_1579119_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_050940333.1|1579185_1579437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050940330.1|1579653_1579866_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_050940328.1|1580391_1580979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151252.1|1581251_1581653_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	6.0e-63
WP_000054495.1|1581693_1582659_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_000705360.1|1582639_1583161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|1583144_1583372_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|1583452_1583860_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379591.1|1584028_1584181_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_170990527.1|1584180_1584558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|1584526_1584727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1585229_1585418_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1585414_1585606_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_050940326.1|1585699_1588171_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1588243_1588495_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_050940323.1|1588529_1589810_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	8.6e-156
WP_001360138.1|1589829_1589940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836059.1|1589997_1591017_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_050940321.1|1591028_1592243_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
WP_000598292.1|1592448_1592775_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1592909_1593251_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1593285_1593846_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1593848_1594559_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1594666_1594972_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_050940319.1|1595170_1597597_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.0e-213
WP_072095568.1|1597657_1600081_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|1600091_1600709_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1600710_1601565_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1601607_1602222_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000255944.1|1602934_1603957_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
1604296:1604312	attR	GGGAAAACCCATCTGGC	NA	NA	NA	NA
>prophage 6
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	1843416	1934230	5264517	protease,lysis,portal,tRNA,head,integrase,transposase,terminase,capsid,tail,holin	Escherichia_phage(43.84%)	109	1915256:1915272	1938657:1938673
WP_000984517.1|1843416_1844298_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|1844489_1846538_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|1846557_1847256_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|1847352_1847850_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207284.1|1847979_1849263_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_050939622.1|1849231_1851865_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001307251.1|1851944_1853384_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1853501_1853738_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1853842_1854034_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|1854034_1854691_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|1855086_1855428_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|1855440_1856313_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1856316_1856691_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1856829_1857060_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|1857161_1857818_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_050939619.1|1857841_1858504_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	1.2e-07
WP_000936936.1|1858500_1860561_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|1860769_1861429_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|1861755_1862112_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|1862178_1862469_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|1862602_1863781_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|1863836_1864478_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|1864514_1866326_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|1866560_1868036_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|1868373_1869243_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091176.1|1869370_1870813_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|1870943_1871915_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|1872034_1873357_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_050939628.1|1873372_1874305_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1874383_1875139_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|1875135_1875921_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1876067_1877078_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1877086_1877698_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1877836_1877902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|1877972_1878575_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1878576_1879098_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|1879132_1879873_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|1879901_1880354_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|1880346_1882119_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|1882428_1882995_+	hydrolase	NA	NA	NA	NA	NA
WP_001217534.1|1883312_1883561_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	87.8	8.0e-34
WP_050939615.1|1883830_1884502_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	1.1e-106
WP_050939614.1|1884570_1885839_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	98.2	1.9e-54
WP_000078855.1|1885983_1886124_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_050939610.1|1886322_1890009_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.4	0.0e+00
WP_123130871.1|1890249_1890882_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	7.9e-102
WP_050939605.1|1890827_1891571_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	1.2e-149
WP_001499019.1|1891581_1892280_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_000847279.1|1892279_1892609_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_050939603.1|1892605_1895179_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.3	0.0e+00
WP_000533402.1|1895159_1895573_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|1895599_1896031_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235046.1|1896044_1896797_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.0e-132
WP_000683079.1|1896804_1897200_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_024213759.1|1897196_1897772_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_001204554.1|1897787_1898141_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|1898133_1898517_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|1898568_1899597_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_024213760.1|1899654_1900002_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	1.5e-22
WP_032285156.1|1900038_1901544_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	2.5e-98
WP_032285154.1|1901533_1903126_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_000259002.1|1903122_1903329_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_032285152.1|1903312_1905241_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.5e-260
WP_000235436.1|1905212_1905722_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|1906116_1906311_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|1906671_1906965_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_077628513.1|1907055_1907238_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_032285289.1|1907454_1907952_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_032285291.1|1907951_1908167_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001290230.1|1908244_1908490_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_032285293.1|1908530_1908710_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	91.5	7.8e-23
WP_050940079.1|1908846_1910811_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	78.6	3.8e-296
WP_000752026.1|1911315_1911585_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_050940076.1|1911594_1912542_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	9.2e-171
WP_001204859.1|1913048_1913483_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144764.1|1913475_1913670_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|1913666_1914272_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_050940073.1|1914271_1914994_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.2	3.3e-128
WP_050940070.1|1915068_1915803_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	99.2	1.8e-121
1915256:1915272	attL	TGAATCAGTTTTAATGC	NA	NA	NA	NA
WP_001254256.1|1916077_1916260_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_050940068.1|1916256_1916784_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	3.6e-100
WP_000736913.1|1916780_1917221_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_050940065.1|1917495_1917786_-	protein ren	NA	O48423	Enterobacteria_phage	99.0	1.6e-46
WP_050940062.1|1917782_1918484_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	6.4e-129
WP_135259131.1|1918480_1919419_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	3.7e-172
WP_000442609.1|1919451_1919748_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|1919889_1920105_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096002361.1|1920178_1920874_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	3.3e-133
WP_001062368.1|1920913_1921471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968517.1|1921467_1922220_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|1922496_1922679_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088203.1|1922656_1922929_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_050940058.1|1922987_1923437_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_000776961.1|1923625_1923937_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_001549082.1|1924012_1924183_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	82.1	2.5e-18
WP_001549081.1|1924179_1924344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000604110.1|1924428_1924737_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_000065845.1|1924733_1925636_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.1	3.3e-146
WP_050940056.1|1925619_1926102_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	9.3e-79
WP_000753560.1|1926113_1926428_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	2.7e-50
WP_001323403.1|1926587_1927367_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|1927366_1928389_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001214456.1|1928681_1928846_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_050939314.1|1928842_1929517_+	hypothetical protein	NA	K7P729	Enterobacteria_phage	52.7	1.8e-51
WP_072018156.1|1929513_1929747_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_050939321.1|1929733_1930438_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	61.2	1.1e-32
WP_032285306.1|1930440_1930932_+	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	9.8e-84
WP_151039328.1|1932540_1933449_+|integrase	tyrosine-type recombinase/integrase	integrase	Q859D2	Escherichia_coli_phage	95.5	2.3e-150
WP_172636180.1|1933414_1934230_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.4e-72
1938657:1938673	attR	TGAATCAGTTTTAATGC	NA	NA	NA	NA
>prophage 7
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	1942078	2008701	5264517	portal,tRNA,head,integrase,terminase,capsid,tail,plate,holin	Enterobacteria_phage(74.0%)	82	1972988:1973047	2009644:2009767
WP_001025342.1|1942078_1943812_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001297434.1|1943988_1944477_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|1944596_1944989_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|1944988_1947067_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|1947059_1948208_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1948409_1949054_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1949064_1949454_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1949468_1950518_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1950520_1951381_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483220.1|1951399_1953001_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001297437.1|1953046_1954708_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1954852_1955356_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_072095501.1|1955376_1957341_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|1957345_1958272_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|1958268_1959156_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1959282_1959861_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1959863_1960214_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|1960993_1961422_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1961428_1962853_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_021563705.1|1962827_1963628_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|1963794_1964781_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_050939309.1|1964795_1966310_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|1966379_1967369_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1968165_1968669_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1968747_1968999_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1969113_1969200_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|1969462_1969786_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|1969956_1970454_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377223.1|1970491_1970731_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|1970922_1972134_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|1972195_1972861_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1972988:1973047	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|1973217_1974219_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865207.1|1974224_1974572_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290349.1|1974601_1975252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|1975267_1975672_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1975761_1975899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1975970_1976174_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739030.1|1976195_1976546_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	1.5e-49
WP_000159456.1|1976556_1976835_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000357028.1|1976846_1977089_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021659.1|1977085_1977199_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	4.0e-09
WP_000543031.1|1977292_1977703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|1977726_1977930_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|1977926_1978193_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104296.1|1978189_1978489_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	2.8e-41
WP_122999365.1|1978522_1979119_+	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.0e-06
WP_032083492.1|1979115_1979505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151039330.1|1979501_1982342_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.9	0.0e+00
WP_000686536.1|1982418_1983378_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	3.8e-180
WP_000211291.1|1983382_1983694_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	7.7e-50
WP_000759755.1|1983754_1984279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021520797.1|1984275_1984866_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	54.4	2.3e-31
WP_000087812.1|1985356_1986403_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613782.1|1986402_1988154_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_021520799.1|1988308_1989145_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	3.0e-149
WP_001055104.1|1989168_1990221_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_021520800.1|1990266_1991067_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	90.2	2.8e-128
WP_000063103.1|1991168_1991663_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_021520801.1|1991662_1991863_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	5.1e-31
WP_000104350.1|1991865_1992189_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1992185_1992578_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780560.1|1992574_1992982_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000920594.1|1993119_1993587_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356358.1|1993579_1994215_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001705833.1|1994226_1994793_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.9	2.3e-100
WP_170997562.1|1994810_1995140_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	1.9e-54
WP_021520802.1|1995143_1996040_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.0e-155
WP_078331657.1|1996032_1996563_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	7.3e-93
WP_151039332.1|1996565_1998551_+|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.6	3.4e-175
WP_021520804.1|1998553_1999087_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	5.5e-96
WP_021520805.1|1999115_1999643_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	96.0	2.0e-90
WP_019841410.1|1999646_2000483_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	93.2	2.1e-150
WP_000905061.1|2000587_2001187_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|2001215_2001704_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_151039334.1|2001716_2004524_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.0	0.0e+00
WP_000333503.1|2004510_2004666_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2004674_2005049_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_096936375.1|2005104_2005617_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	1.2e-92
WP_151039336.1|2005616_2006801_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	96.4	1.3e-219
WP_021520808.1|2006958_2008068_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	95.9	7.9e-198
WP_000488107.1|2008110_2008371_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2008560_2008701_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
2009644:2009767	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 8
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	2238582	2248024	5264517		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2238582_2239719_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_050938814.1|2239715_2241716_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2241840_2242302_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2242342_2242813_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2242859_2243579_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2243575_2245261_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2245482_2246214_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2246273_2246381_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2246361_2247093_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|2247097_2248024_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 9
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	2480368	2566384	5264517	transposase,integrase	Enterobacteria_phage(16.67%)	49	2494269:2494328	2565276:2567229
WP_085947598.1|2480368_2481530_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001195819.1|2482398_2482884_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_050940191.1|2483086_2485231_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2485230_2486541_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2486720_2487005_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2487376_2488717_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_135259174.1|2489080_2490139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2490320_2491076_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2491369_2492302_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_001131474.1|2492627_2493818_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	5.8e-130
2494269:2494328	attL	TGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTAA	NA	NA	NA	NA
WP_000255944.1|2494354_2495377_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|2495376_2496156_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_151039344.1|2496256_2497418_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000901352.1|2497775_2498792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940277.1|2498791_2499820_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.0	5.0e-13
WP_001066242.1|2504592_2505093_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050939755.1|2505722_2506190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088748.1|2507303_2508125_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_000116047.1|2508134_2509025_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_000414795.1|2509036_2510941_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_000665944.1|2510953_2512087_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000192889.1|2512095_2513124_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000082085.1|2513135_2514683_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	4.6e-10
WP_050939752.1|2514734_2515664_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_050939749.1|2515695_2516682_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_063113454.1|2516966_2518892_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.0	4.8e-25
WP_050939744.1|2518903_2520409_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_050939742.1|2520699_2521563_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157904463.1|2522388_2522739_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_050939729.1|2524055_2525366_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_050939726.1|2525393_2526674_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_050939722.1|2526666_2528469_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	1.8e-21
WP_050939719.1|2528455_2530168_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	26.8	4.0e-31
WP_050939716.1|2530424_2531384_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_050939713.1|2531574_2537682_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	5.2e-33
WP_050939708.1|2537769_2547261_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_050939705.1|2547257_2548358_+	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_000194282.1|2548354_2549158_+	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_001088826.1|2549161_2550739_+	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_050939701.1|2550869_2552891_+	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_050939697.1|2553749_2555720_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_050939694.1|2555738_2556536_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_050939690.1|2556711_2557365_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_050939687.1|2557976_2558615_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.6	3.6e-54
WP_050939684.1|2558599_2559829_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	1.3e-60
WP_172636182.1|2561599_2561950_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	34.3	3.8e-05
WP_050939675.1|2562972_2563266_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	89.7	6.5e-43
WP_050939672.1|2563712_2563982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|2565361_2566384_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
2565276:2567229	attR	TGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTAATCTGCTCTCCTGATTCAGGAGAGCTTATGGTCACTTTTGAGACAGTTATGGAAATTAAAATCCTGCACAAGCAGGGAATGAGTAGCCGGGCGATTGCCAGAGAACTGGGGATCTCCCGCAATACCGTTAAACGTTATTTGCAGGCAAAATCTGAGCCGCCAAAATATACGCCGCGACCTGCTGTTGCTTCACTCCTGGATGAATACCGGGATTATATTCGTCAACGCATCGCCGATGCTCATCCTTACAAAATCCCGGCAACGGTAATCGCTCGCGAGATCAGAGACCAGGGATATCGTGGCGGAATGACCATTCTCAGGGCATTCATTCGTTCTCTCTCGGTTCCTCAGGAGCAGGAGCCTGCCGTTCGGTTCGAAACTGAACCCGGACGACAGATGCAGGTTGACTGGGGCACTATGCGTAATGGTCGCTCACCGCTTCACGTGTTCGTTGCTGTTCTCGGATACAGCCGAATGCTGTACATCGAATTCACTGACAATATGCGTTATGACACGCTGGAGACCTGCCATCGTAATGCGTTCCGCTTCTTTGGTGGTGTGCCGCGCGAAGTGTTGTATGACAATATGAAAACTGTGGTTCTGCAACGTGACGCATATCAGACCGGTCAGCACCGGTTCCATCCTTCGCTGTGGCAGTTCGGCAAGGAGATGGGCTTCTCTCCCCGACTGTGTCGCCCCTTCAGGGCACAGACTAAAGGTAAGGTGGAACGGATGGTGCAGTACACCCGTAACAGTTTTTACATCCCACTAATGACTCGCCTGCGCCCGATGGGGATCACTGTCGATGTTGAAACAGCCAACCGCCACGGTCTGCGCTGGCTGCACGATGTCGCTAACCAACGAAAGCATGAAACAATCCAGGCACGTCCCTGCGATCGCTGGCTCGAAGAGCAGCAGTCCATGCTGGCACTGCCTCCGGAGAAAAAAGAGTATGACGTGCATCTTGATGAAAATCTGGTGAACTTCGACAAACACCCCCTGCATCATCCACTCTCCATCTACGACTCATTCTGCAGAGGAGTGGCGTGATGATGGAACTGCAACATCAACGACTGATGGTGCTCGCCGGGCAGTTGCAACTGGAAAGCCTTATAAGCGCAGCGCCTGCGCTGTCACAACAGGCAGTAGACCAGGAATGGAGTTATATGGACTTCCTGGAGCATCTGCTTCATGAAGAAAAACTGGCACGTCATCAACGTAAACAGGCGATGTATACCCGAATGGCAGCCTTCCCGGCGGTGAAAACGTTCGAAGAGTATGACTTCACATTCGCCACCGGAGCACCGCAGAAGCAACTCCAGTCGTTACGCTCACTCAGCTTCATAGAACGTAATGAAAATATCGTATTACTGGGGCCATCAGGTGTGGGGAAAACCCATCTGGCAATAGCGATGGGCTATGAAGCAGTCCGTGCAGGTATCAAAGTTCGCTTCACAACAGCAGCAGATCTGTTACTTCAGTTATCTACGGCACAACGTCAGGGCCGTTATAAAACGACGCTTCAGCGTGGAGTAATGGCCCCCCGCCTGCTCATCATTGATGAAATAGGCTATCTGCCGTTCAGTCAGGAAGAAGCAAAGCTGTTCTTCCAGGTCATCGCTAAACGTTACGAAAAGAGCGCAATGATCCTGACATCCAATCTGCCGTTCGGGCAGTGGGATCAAACGTTCGCCGGTGATGCAGCACTGACCTCAGCGATGCTGGACCGTATCTTACACCACTCACATGTCGTTCAAATCAAAGGAGAAAGCTATCGACTCAGACAGAAACGAAAGGCCGGGGTTATAGCAGAAGCTAATCCTGAGTAAAACGGTGGATCAATATTGGGCCGTTGGTGGAGATATAAGTGGATCACTTTTCATCCGTCGTTGACA	NA	NA	NA	NA
>prophage 10
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	2702627	2715810	5264517		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|2702627_2703389_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|2703382_2704009_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2704148_2705288_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2705350_2706343_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|2706436_2707801_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|2707889_2708666_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|2708670_2709309_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590397.1|2709305_2710568_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|2710564_2711473_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2711668_2712436_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|2712486_2713143_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|2713248_2715810_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 11
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	2795881	2807330	5264517	integrase	Enterobacteria_phage(72.73%)	13	2794873:2794886	2807456:2807469
2794873:2794886	attL	AATATCATTTATCC	NA	NA	NA	NA
WP_097462978.1|2795881_2798215_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_000856729.1|2798229_2798550_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459301.1|2798685_2799141_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_052897488.1|2799133_2799421_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	95.8	9.5e-47
WP_001365039.1|2799413_2799611_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	100.0	4.0e-28
WP_123001748.1|2799579_2800002_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	89.8	4.9e-23
WP_001149160.1|2800001_2800268_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283014.1|2800820_2801555_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	6.1e-130
WP_000638635.1|2801551_2802052_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|2802125_2802698_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_001183325.1|2802915_2804874_-	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	36.3	3.9e-67
WP_000124726.1|2804877_2806086_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	6.6e-105
WP_000162574.1|2806847_2807330_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2807456:2807469	attR	GGATAAATGATATT	NA	NA	NA	NA
>prophage 12
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	3281900	3386817	5264517	protease,head,integrase,transposase,tail,plate	Vibrio_phage(39.22%)	104	3281673:3281689	3335014:3335030
3281673:3281689	attL	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
WP_000534924.1|3281900_3282959_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_040089466.1|3283000_3284656_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_061317333.1|3284648_3286166_-	UvrD-helicase domain-containing protein	NA	A0A126DN25	Acinetobacter_phage	30.8	1.3e-44
WP_040089481.1|3286772_3287417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039364.1|3287437_3287752_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040089482.1|3287786_3288425_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.0	1.0e-56
WP_040089483.1|3288409_3289642_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.5	1.9e-59
WP_170989474.1|3289782_3290427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122992006.1|3292119_3293865_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_072278218.1|3294042_3294591_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.9	8.9e-17
WP_040089554.1|3296631_3296889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039366.1|3296885_3305864_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	39.2	8.4e-56
WP_001243916.1|3305879_3306407_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_061341861.1|3306416_3308069_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.2	1.7e-39
WP_032152656.1|3308745_3308970_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021580257.1|3308978_3309212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050940555.1|3309298_3309922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157839846.1|3310533_3310677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040089161.1|3310796_3311309_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	39.7	4.1e-08
WP_021580263.1|3313308_3313920_+	YfdX family protein	NA	NA	NA	NA	NA
WP_151039456.1|3314125_3315736_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|3315816_3316839_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|3316838_3317618_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_040089475.1|3318079_3318871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077820601.1|3319223_3319457_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_050940575.1|3319542_3320115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940578.1|3321604_3322624_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_050940580.1|3322733_3323606_+	GTPase family protein	NA	NA	NA	NA	NA
WP_151039368.1|3323978_3326828_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_050940602.1|3326948_3329465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581504.1|3329540_3329996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|3330074_3330308_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|3330407_3331226_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_050938918.1|3331280_3331766_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.3	3.1e-13
WP_001186727.1|3331781_3332258_+	RadC family protein	NA	NA	NA	NA	NA
WP_050938919.1|3332320_3332542_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	3.2e-10
WP_001339471.1|3332704_3333073_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_050938921.1|3333162_3333540_+	toxin	NA	NA	NA	NA	NA
WP_000761721.1|3333536_3334025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839281.1|3334036_3334234_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001290246.1|3334330_3334903_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000942795.1|3335183_3335720_-	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
3335014:3335030	attR	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
WP_000094974.1|3335721_3336900_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000633238.1|3336896_3337874_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_064760790.1|3337876_3338476_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000820125.1|3338472_3338844_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001115139.1|3338840_3339404_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001087296.1|3339407_3339863_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173448.1|3339879_3341103_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_040100330.1|3341612_3342116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100331.1|3342234_3342939_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	97.0	2.0e-130
WP_001372435.1|3342889_3343075_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	72.6	7.5e-21
WP_040100333.1|3343194_3343761_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	83.5	3.9e-84
WP_052924219.1|3346352_3346883_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	70.5	1.6e-68
WP_077793277.1|3346897_3347416_-	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	64.0	5.2e-35
WP_040100337.1|3347896_3348481_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	2.5e-49
WP_040100339.1|3348465_3349542_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.8	7.9e-94
WP_040100341.1|3349531_3349984_-	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	41.4	3.7e-21
WP_000523890.1|3349980_3350517_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	40.2	4.1e-27
WP_052924218.1|3350507_3351578_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	47.2	2.0e-89
WP_052924217.1|3351577_3352852_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	36.7	3.0e-68
WP_052924216.1|3352851_3354645_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	51.5	1.5e-121
WP_001127483.1|3354631_3354769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924215.1|3354731_3355127_-|tail	phage tail assembly protein	tail	M4MB64	Vibrio_phage	48.3	2.1e-20
WP_001062748.1|3355128_3355485_-|tail	phage tail tube protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	35.5	2.9e-13
WP_040100351.1|3355494_3356970_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	55.9	2.5e-154
WP_052924214.1|3356969_3357155_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_052924213.1|3357135_3357747_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	43.8	7.3e-36
WP_000513058.1|3357743_3358286_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	1.6e-58
WP_000540583.1|3358285_3358723_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.7	3.7e-34
WP_001290368.1|3358722_3359034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924212.1|3359112_3360015_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	57.2	1.1e-99
WP_052924211.1|3360014_3360977_-	peptidase	NA	M1Q578	Vibrio_phage	46.6	1.6e-77
WP_052924210.1|3361190_3361955_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	59.7	4.0e-92
WP_052924209.1|3361947_3363519_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.9	6.6e-158
WP_112793722.1|3363515_3365042_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	68.3	2.1e-196
WP_052924208.1|3365047_3365629_-	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	56.0	1.7e-50
WP_001080359.1|3365618_3365777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100367.1|3365766_3366066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024168521.1|3366068_3366356_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	1.6e-25
WP_001557437.1|3366361_3366667_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	40.4	9.6e-13
WP_052924207.1|3366651_3366879_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_000371427.1|3366875_3367484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924206.1|3367471_3367882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039370.1|3367869_3368094_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	71.0	1.8e-24
WP_040100373.1|3368095_3368692_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	43.9	2.7e-35
WP_040100375.1|3368777_3369227_-	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	62.7	4.2e-41
WP_040100376.1|3369223_3369775_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	81.9	7.6e-85
WP_040100378.1|3369752_3370142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100379.1|3370134_3370317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151039372.1|3370309_3370852_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	85.9	1.5e-85
WP_001107927.1|3370951_3371476_-	host-nuclease inhibitor Gam family protein	NA	A0A0C4UQY5	Shigella_phage	96.6	1.4e-88
WP_040100384.1|3371496_3371784_-	hypothetical protein	NA	A0A0C4UQR4	Shigella_phage	92.6	1.9e-42
WP_001151278.1|3371803_3372073_-	hypothetical protein	NA	C9DGL5	Escherichia_phage	60.7	1.5e-22
WP_000987801.1|3372105_3372333_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	85.3	8.9e-32
WP_001026713.1|3372346_3373285_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	88.1	1.3e-153
WP_040100386.1|3373323_3375312_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0C4UR24	Shigella_phage	98.2	0.0e+00
WP_001473846.1|3375319_3375541_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	100.0	4.9e-35
WP_040100388.1|3375728_3376253_+	hypothetical protein	NA	A0A0C4UQZ2	Shigella_phage	99.4	3.3e-93
WP_000498836.1|3377754_3379815_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_050938923.1|3379844_3380804_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001324279.1|3380821_3381232_-	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_001297673.1|3381297_3382107_-	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001034492.1|3382254_3386817_-|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
>prophage 13
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	4340585	4442580	5264517	protease,lysis,portal,tRNA,head,integrase,transposase,terminase,capsid,tail,plate,holin	Escherichia_phage(39.13%)	104	4369736:4369795	4441491:4442775
WP_000560983.1|4340585_4341023_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4341067_4342009_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4342072_4342981_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4343209_4343521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4343521_4343812_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4344416_4344635_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|4344853_4345096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|4345324_4346305_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000027708.1|4346751_4347681_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4347677_4348313_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4348309_4349212_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4349224_4352275_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|4352468_4353302_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001298963.1|4353454_4354495_+	YiiG family protein	NA	NA	NA	NA	NA
WP_050938947.1|4354544_4356293_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_050938948.1|4356292_4357363_-	aminopeptidase	NA	NA	NA	NA	NA
WP_050938949.1|4357352_4358804_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729597.1|4358814_4359261_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4359561_4359876_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|4359885_4360710_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211502.1|4360951_4362211_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144072.1|4362207_4363677_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217139.1|4363964_4364801_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|4364784_4365723_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063489.1|4365719_4366754_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4367038_4367659_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166066.1|4367918_4368902_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270266.1|4369050_4369725_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
4369736:4369795	attL	GTAGATACTGTTATGGCCTGCAAGTTTTTTCCTGGTCCGGTTTCCCGGATTGCAGGCATG	NA	NA	NA	NA
WP_000399648.1|4369844_4370825_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000580417.1|4371156_4372530_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4372526_4373225_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4373374_4373875_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_021578869.1|4374061_4375042_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.7	1.0e-185
WP_000777029.1|4375111_4375405_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4375541_4375814_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|4375983_4376484_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557701.1|4376547_4376772_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_042964138.1|4376771_4377074_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	97.0	1.9e-45
WP_001113264.1|4377073_4377298_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_024243679.1|4377294_4377570_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	1.1e-44
WP_042964139.1|4377559_4379845_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_042964140.1|4379956_4381795_+	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	85.9	4.4e-310
WP_042964141.1|4382144_4383179_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	5.5e-201
WP_021538485.1|4383178_4384951_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085953.1|4385124_4385979_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_001248558.1|4386037_4387111_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_044860736.1|4387114_4387858_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_000988633.1|4387957_4388467_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|4388466_4388670_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|4388673_4388955_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144090.1|4388954_4389452_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_044860737.1|4389466_4389892_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	6.1e-58
WP_044860738.1|4389879_4390305_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.3e-65
WP_072146842.1|4390276_4390450_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_042964144.1|4390412_4390880_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_001001786.1|4390872_4391325_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001697715.1|4391391_4392027_+|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	100.0	3.1e-114
WP_000127172.1|4392023_4392371_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_042964146.1|4392375_4393284_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	2.0e-162
WP_042964147.1|4393276_4393807_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.3	5.6e-101
WP_151039388.1|4393817_4396073_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	60.9	3.4e-232
WP_042964149.1|4396074_4396602_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.0	5.4e-88
WP_170990657.1|4396871_4397417_+	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	97.2	2.1e-95
WP_042964151.1|4397746_4398937_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|4398949_4399468_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_016235448.1|4399524_4399800_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.8e-40
WP_000785970.1|4399832_4399952_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_042964152.1|4399944_4402392_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	91.7	0.0e+00
WP_042964153.1|4402406_4402886_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.7	5.6e-84
WP_042964155.1|4402885_4404049_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	8.3e-206
WP_000468308.1|4404130_4404349_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|4404585_4405488_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|4405668_4406631_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_050939263.1|4406950_4407940_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708998.1|4408046_4408802_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4408856_4409624_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4409731_4410331_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|4410431_4410872_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4411083_4411383_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4411409_4411838_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4411842_4412589_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4412685_4413696_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4413830_4415339_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4415361_4416207_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4416632_4416878_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4416962_4417448_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4417540_4418467_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4418533_4419865_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4419874_4420405_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068837.1|4420497_4421457_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|4421548_4422574_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001341957.1|4422729_4424928_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4425130_4425343_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_151039390.1|4425502_4429687_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_001323627.1|4429688_4430012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797341.1|4430918_4431527_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|4431710_4432028_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_050940270.1|4432304_4433465_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110772.1|4433467_4435900_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000007523.1|4436248_4437139_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001297636.1|4437467_4439648_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_050940273.1|4439741_4440647_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647874.1|4440673_4441291_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|4441599_4442580_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
4441491:4442775	attR	GTAGATACTGTTATGGCCTGCAAGTTTTTTCCTGGTCCGGTTTCCCGGATTGCAGGCATGCCAGACACAGCGCCGTCAGGCGCTGTTTTTTTCATCCCTTCCGCGATTTTTACGCCGCTACCGGATTATGCCGTGACGCATCGAACGGCACGCCTGACTTCAGCACTCCATACGCCACCTGTGCCAGCTTGCGCATCATCGCGCCGAGAATCACCTTTCCTTTCTTGCCATTAGCCGCCAGACGGTCGCGGAACGCCCGTCCCCACTCAGTCTTACTGGTGGCTACCATTGCGGGCATATACAACGCCCTGCGAAGCGACACATGTCCGGCCTTACTCATCCGGCTCGCCCCTCTCACACTGCTACCTGATTCATAACGCCGTGGTGTCAGACCCGCAAAAGCGGCGAACTGTCTGGCATGGGCGAAGCGGTCCTTCAGACCGATATAAGCCAGCAATACCGCAGATGTTTTCTCTCCGATACCCGGGATGCTTTCCAGCAGTTTCCTGCGGTGTTTCATATCCGGATCATCGTCTGTCAGGTCTTTTATCTGCTTCTCAAGACGCTTCAGCTCTGCTTCAAGCCACAGAAGGTGAGCATCAATGCTCGGTCTCTGGACTTCCCGCGCCGTTTCAGTGCGATTCAGTTCCTGCGTGTGCATATCTGTCAGCGCCTGGTGGCGGACTACCAGGGCACGCAACGCGCGTTCAAGCGGGTGAGGCGCTTCCCAGGCTGCAGGGCGCTTCTGACGACAGAACTCTGCCAGCATGCGCGCATCCACGGTATCAGTCTTGTTACGCAGTCCTTCACTCTGAGCGAAAGCTTTACCCAGCGCAGGATTAATGACTGACACTATGTAGCCAGCATCGTAAAGGCACTCAGCGACAGGTTCCATATAGGTGCCGGTCGCTTCGATGCAGATATGCGCATGGTCAATCTTGTGACCTTTCAGCCAGCTCACCAGCTCATCGTGCCCTTTAGTGGTGTTAGCGAATTTTTTGGTGCGATGACGACCATCAGGACGCAACACATCGACATCCAGTTTCTCTTTAGCGGTGTCGATACCGATATAATGAAGTTCATGTTCCATAGTGAAACCAACCTTGCAAATACGGATTACCGGGAAAACCGGTCCATGATACTGTCCGGTTTATCACTTTGGGAGAAAGGCAGTCCGCTGCATAAATCTACGCAACAGGTTAGAACCCAAGGCCCGATACGGCATGCGGACTGCAGGCAGAGAAAACTGGCCGATTTTCTCTGCACTGGAGGGATAATACAAGGC	NA	NA	NA	NA
>prophage 14
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	4864401	4876245	5264517	integrase	Enterobacteria_phage(90.0%)	15	4859040:4859054	4892233:4892247
4859040:4859054	attL	TCAAAAGCCAGCTGG	NA	NA	NA	NA
WP_000776997.1|4864401_4865667_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.5	2.2e-74
WP_000418440.1|4865724_4866618_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000932801.1|4866626_4867142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205027.1|4867339_4867651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001825860.1|4867960_4868533_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_021038238.1|4868606_4869107_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_033810335.1|4869103_4869838_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	5.2e-129
WP_001149160.1|4870390_4870657_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_080213683.1|4870653_4871244_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
WP_001244670.1|4871236_4871524_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_080213682.1|4871516_4871972_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856725.1|4872107_4872428_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_136829793.1|4872442_4874776_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_044815386.1|4875122_4875317_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001219054.1|4875534_4876245_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.7	1.8e-41
4892233:4892247	attR	TCAAAAGCCAGCTGG	NA	NA	NA	NA
>prophage 15
NZ_CP044311	Escherichia coli strain RM13752 chromosome, complete genome	5264517	4968376	5040271	5264517	protease,portal,head,tRNA,integrase,transposase,terminase,capsid,tail,holin	Escherichia_phage(32.76%)	82	4963013:4963027	4997564:4997578
4963013:4963027	attL	TGCCTGACTGAACTG	NA	NA	NA	NA
WP_050940454.1|4968376_4969600_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	4.4e-234
WP_000040218.1|4969886_4970606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940456.1|4971083_4971704_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	90.8	4.8e-112
WP_001404194.1|4971703_4972066_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_001401560.1|4972056_4972593_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_050940458.1|4972720_4973545_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.5	1.1e-148
WP_000135680.1|4973610_4973973_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|4974659_4975334_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4975424_4975625_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_032206597.1|4975668_4976220_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	98.9	1.3e-100
WP_050940460.1|4976216_4977053_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.3	8.4e-152
WP_000933942.1|4977045_4977282_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
WP_021522644.1|4977278_4978097_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.4	6.2e-123
WP_072095577.1|4978093_4978588_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	2.1e-86
WP_050940465.1|4978587_4979241_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	9.6e-127
WP_050940467.1|4979237_4979564_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	5.9e-53
WP_000767113.1|4979560_4979950_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061414.1|4979969_4980767_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_063113543.1|4980774_4981764_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.5	2.3e-193
WP_050940472.1|4981781_4982135_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	87.7	1.6e-56
WP_050940475.1|4982467_4982875_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	63.2	1.1e-43
WP_001318187.1|4982910_4983642_+	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	74.4	5.2e-97
WP_024186198.1|4984192_4984408_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
WP_050940478.1|4984412_4984763_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_050940480.1|4984826_4985360_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	6.2e-100
WP_001228684.1|4985576_4985762_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	2.7e-18
WP_001323403.1|4985985_4986765_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000255944.1|4986764_4987787_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_135259168.1|4987843_4988176_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	99.0	1.7e-55
WP_050939787.1|4988323_4988806_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	1.1e-84
WP_050939785.1|4988805_4990563_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478567.1|4990574_4990757_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466244.1|4990756_4991998_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	2.2e-241
WP_001193631.1|4991975_4992626_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_050939783.1|4992640_4993846_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	98.0	3.6e-220
WP_000601355.1|4993896_4994085_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_050939781.1|4994096_4994402_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	92.1	1.6e-39
WP_050939779.1|4994410_4994749_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	98.2	4.6e-56
WP_050939778.1|4994745_4995195_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	3.9e-63
WP_050939774.1|4995191_4995536_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	2.1e-56
WP_050939772.1|4995596_4996301_+	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	96.6	7.9e-119
WP_000164661.1|4996315_4996687_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_050939796.1|4996710_4996989_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	1.6e-43
WP_077793285.1|4997035_5000311_+	tape measure protein	NA	A0A1B5FPE2	Escherichia_phage	80.2	3.2e-303
4997564:4997578	attR	CAGTTCAGTCAGGCA	NA	NA	NA	NA
WP_050939768.1|5000314_5000782_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	52.3	8.3e-40
WP_050939762.1|5000778_5001261_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	69.2	1.6e-57
WP_050939760.1|5001271_5001652_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	82.5	9.0e-61
WP_050939757.1|5001648_5004351_+	MoaD/ThiS family protein	NA	A0A286S259	Klebsiella_phage	58.1	0.0e+00
WP_157904466.1|5004393_5006304_+|tail	phage tail protein	tail	B1GS50	Salmonella_phage	46.6	5.1e-27
WP_072095528.1|5006275_5006680_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_050940596.1|5008106_5008634_+	hypothetical protein	NA	Q9LA59	Enterobacterial_phage	73.2	3.7e-60
WP_050939632.1|5009021_5009270_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	4.5e-37
WP_000202564.1|5009489_5011076_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|5011468_5012074_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5012200_5012362_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|5012483_5013557_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563055.1|5013553_5014336_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088405.1|5014448_5015312_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_047087182.1|5015283_5016834_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|5017091_5017871_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477811.1|5017997_5019320_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_000816471.1|5019371_5020595_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|5020674_5021394_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566138.1|5021668_5021818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105865.1|5021849_5022866_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|5022893_5023538_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|5023643_5024612_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_151039448.1|5024660_5026043_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|5026063_5027296_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|5027602_5029270_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|5029480_5031418_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|5031507_5031834_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001338221.1|5031875_5032388_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_050939635.1|5032439_5033087_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|5033083_5033953_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|5034163_5034637_+	protein CreA	NA	NA	NA	NA	NA
WP_001188659.1|5034649_5035339_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219614.1|5035338_5036763_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_000920337.1|5036820_5038173_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|5038232_5038949_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|5039044_5039185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223181.1|5039584_5040271_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
