The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044285	Hymenobacter sp. BRD72 chromosome, complete genome	4428884	1749074	1801384	4428884	transposase,integrase	Flavobacterium_phage(12.5%)	50	1750455:1750474	1801429:1801448
WP_151087399.1|1749074_1750328_-|integrase	site-specific integrase	integrase	A0A1B0WMK0	Flavobacterium_phage	31.4	1.1e-14
1750455:1750474	attL	CTAGTACCCAGAGCCGGGGT	NA	NA	NA	NA
WP_151087400.1|1750582_1751743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087401.1|1751891_1752197_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151087402.1|1752349_1752940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087403.1|1752936_1753869_+	YdaU family protein	NA	NA	NA	NA	NA
WP_151087404.1|1753875_1755276_+	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	39.2	1.8e-69
WP_151087405.1|1755381_1756383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087406.1|1756911_1757994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087407.1|1757986_1760200_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	30.3	1.0e-23
WP_151087408.1|1763726_1766918_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.8	9.6e-63
WP_151087409.1|1766928_1767603_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_151087410.1|1767708_1768887_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_151087411.1|1768908_1769784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087412.1|1769808_1770762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087413.1|1771615_1772818_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_151087414.1|1773163_1773718_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151087415.1|1773488_1774373_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	31.9	1.5e-26
WP_151087416.1|1774784_1775564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087417.1|1775584_1777234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087418.1|1777274_1778843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087419.1|1778853_1779621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087420.1|1779816_1780347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087421.1|1780743_1781346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087422.1|1781781_1782456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087423.1|1782530_1782731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087424.1|1782840_1783137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087425.1|1783326_1783725_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_151087426.1|1783930_1784323_-	VOC family protein	NA	NA	NA	NA	NA
WP_151087427.1|1784568_1785348_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_151087428.1|1785560_1786319_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_151087429.1|1786760_1787444_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_151087430.1|1787509_1787932_-	M15 family metallopeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	41.9	4.1e-14
WP_151087431.1|1787915_1788200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087432.1|1789622_1790021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087433.1|1790013_1790220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087434.1|1790269_1790476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087205.1|1790462_1791260_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_151087435.1|1791450_1791765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087436.1|1791812_1792049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087437.1|1792897_1793341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087438.1|1793345_1794023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087439.1|1794138_1795128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087440.1|1795156_1796269_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	49.3	3.1e-32
WP_151087441.1|1796386_1796932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087442.1|1796962_1797511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087443.1|1797532_1797799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087444.1|1797881_1798907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087445.1|1798973_1799516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087446.1|1799586_1799823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087447.1|1799980_1801384_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.0	2.1e-14
1801429:1801448	attR	CTAGTACCCAGAGCCGGGGT	NA	NA	NA	NA
>prophage 2
NZ_CP044285	Hymenobacter sp. BRD72 chromosome, complete genome	4428884	2463497	2490331	4428884	transposase	Acinetobacter_phage(100.0%)	17	NA	NA
WP_151089583.1|2463497_2463638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151087953.1|2464189_2466439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087954.1|2467532_2468741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151087955.1|2470922_2476421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087956.1|2476318_2478223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087957.1|2478252_2478648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087958.1|2478580_2479129_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_151087959.1|2479226_2479769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087960.1|2479809_2480754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087961.1|2480984_2485286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087962.1|2485413_2486625_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_151087963.1|2486734_2487001_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_151086484.1|2487230_2488271_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_151087964.1|2488267_2488522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151087965.1|2488735_2489044_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151087966.1|2489040_2489940_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.8	3.2e-32
WP_151087967.1|2490160_2490331_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP044285	Hymenobacter sp. BRD72 chromosome, complete genome	4428884	3473388	3493904	4428884	integrase,protease,transposase,tail	Cellulophaga_phage(25.0%)	24	3473344:3473359	3490290:3490305
3473344:3473359	attL	CAGGAAGCATAGGCAC	NA	NA	NA	NA
WP_151088760.1|3473388_3474204_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_151088761.1|3474403_3474811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151088762.1|3474873_3475215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151088763.1|3475361_3476075_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_151088764.1|3476693_3478076_-	RtcB family protein	NA	R9ZZC9	Cellulophaga_phage	52.5	7.0e-135
WP_151088765.1|3478100_3478820_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_151088766.1|3478952_3479621_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_151088767.1|3479646_3480219_-	glycerol acyltransferase	NA	NA	NA	NA	NA
WP_151088768.1|3480277_3481093_-	hypothetical protein	NA	A0A2H4UUE4	Bodo_saltans_virus	26.1	1.0e-13
WP_151088769.1|3481135_3481984_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_151088770.1|3482060_3483008_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_151088771.1|3483465_3483891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151088772.1|3484198_3484510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151088773.1|3484563_3485628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_151088774.1|3485666_3486113_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2P1JR32	Mycobacterium_phage	31.1	2.3e-07
WP_151088775.1|3485946_3486483_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_151088776.1|3486525_3486816_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_151088777.1|3486772_3487237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151088778.1|3487221_3487521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151088779.1|3488432_3488876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151088780.1|3489189_3489420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151088781.1|3489859_3490249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151088782.1|3490637_3491510_+	DMT family transporter	NA	NA	NA	NA	NA
3490290:3490305	attR	CAGGAAGCATAGGCAC	NA	NA	NA	NA
WP_151088783.1|3491759_3493904_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	32.2	2.4e-70
>prophage 4
NZ_CP044285	Hymenobacter sp. BRD72 chromosome, complete genome	4428884	4071215	4141467	4428884	protease,tail,tRNA	Agrobacterium_phage(18.18%)	48	NA	NA
WP_151089205.1|4071215_4073846_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.5	3.1e-123
WP_151089206.1|4074017_4074422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151089207.1|4074905_4077653_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_151089208.1|4077671_4078919_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151089669.1|4079011_4079812_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_151089209.1|4079980_4082308_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_151089210.1|4082471_4082669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151089211.1|4082772_4084332_+	serine hydrolase	NA	NA	NA	NA	NA
WP_151089212.1|4084350_4084833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151089213.1|4084918_4085968_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	3.6e-75
WP_151089214.1|4086024_4086690_-	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
WP_151089215.1|4086776_4087358_-	DUF1990 family protein	NA	NA	NA	NA	NA
WP_151089216.1|4087499_4088189_+	deoxyribonuclease V	NA	A0A2K9V7A2	Bandra_megavirus	33.0	8.5e-17
WP_151089217.1|4088295_4090995_+	T9SS type A sorting domain-containing protein	NA	A0A2K9L5D3	Tupanvirus	33.7	8.0e-18
WP_151089218.1|4091020_4091911_-|tRNA	tRNA glutamyl-Q synthetase	tRNA	NA	NA	NA	NA
WP_151089219.1|4091959_4093057_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_151089220.1|4093043_4093490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151089221.1|4093510_4094515_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_151089222.1|4094683_4096162_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_151089223.1|4096266_4097691_+	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_151089224.1|4099312_4099966_-	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_151089225.1|4100093_4100483_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151089226.1|4100525_4100831_+	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_151089227.1|4100846_4101542_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_151089670.1|4102223_4102499_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_151089228.1|4102551_4103088_+|tail	phage tail protein	tail	A0A2R3ZZT3	Microbacterium_phage	35.8	5.3e-14
WP_151089229.1|4103132_4103681_+|tail	phage tail protein	tail	A0A2R4A082	Microbacterium_phage	39.9	3.4e-16
WP_151089230.1|4103730_4104261_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	37.5	6.1e-15
WP_151089231.1|4104345_4105281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151089232.1|4105355_4112054_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_151089233.1|4112140_4112326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151089234.1|4112500_4114168_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_151089235.1|4114764_4115523_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_151089236.1|4115625_4116522_+	sulfate adenylyltransferase subunit 2	NA	NA	NA	NA	NA
WP_151089671.1|4116664_4117954_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	27.5	1.8e-28
WP_151089237.1|4117977_4118775_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_151089238.1|4118758_4120606_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_151089239.1|4120834_4123738_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_151089240.1|4123824_4125531_+	NADPH-dependent assimilatory sulfite reductase hemoprotein subunit	NA	NA	NA	NA	NA
WP_151089241.1|4125553_4127095_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_151089242.1|4133177_4133900_+	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_151089243.1|4133888_4135157_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	31.0	6.3e-50
WP_151089244.1|4135286_4135637_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_151089672.1|4135708_4136161_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_151089673.1|4136377_4136713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151089245.1|4136712_4138917_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.0	2.9e-10
WP_151089246.1|4139272_4140607_+	trigger factor	NA	NA	NA	NA	NA
WP_151089247.1|4140759_4141467_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	51.9	5.3e-46
