The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044257	Salmonella enterica strain CFSAN096147 chromosome, complete genome	4757321	1011974	1124608	4757321	tail,tRNA,integrase,lysis,capsid,transposase,portal,terminase,plate,head	Salmonella_phage(62.07%)	114	1093751:1093795	1120823:1120867
WP_017441156.1|1011974_1014605_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1014839_1015025_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1016165_1016732_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_017441157.1|1016728_1017154_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611821.1|1017230_1018787_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130193.1|1018936_1019452_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_017441158.1|1019797_1021168_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_001187297.1|1021216_1022755_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_017441159.1|1022771_1023944_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1024070_1024601_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165769.1|1025097_1026282_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216613.1|1026446_1027442_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775022.1|1027511_1028576_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985529.1|1028568_1029771_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
WP_000777901.1|1030125_1031085_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	1.8e-129
WP_017441160.1|1031095_1033240_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.6	8.4e-196
WP_001275401.1|1033212_1033623_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
WP_000028870.1|1033619_1033865_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_072103493.1|1033963_1034140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209808.1|1034136_1034568_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_017441161.1|1034656_1035991_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1036074_1036401_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281304.1|1036562_1036913_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492669.1|1036947_1037397_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1038295_1038697_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000494943.1|1038786_1038966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000022011.1|1039044_1039572_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_017441162.1|1039581_1039881_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1040063_1040222_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522406.1|1040321_1040771_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
WP_000126152.1|1040792_1041470_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000531282.1|1041511_1042912_-	GABA permease	NA	NA	NA	NA	NA
WP_017441163.1|1043042_1044326_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	7.9e-32
WP_001176523.1|1044340_1045789_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017441164.1|1045810_1047079_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_151122849.1|1047104_1048091_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_017441165.1|1048384_1049899_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1049909_1050344_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744413.1|1050355_1051333_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237934.1|1051487_1052162_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872338.1|1052148_1053564_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_017441166.1|1053696_1054710_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701504.1|1055431_1056328_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178739.1|1056621_1057551_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_023242670.1|1058068_1059121_+	type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_077907224.1|1059294_1059627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031615615.1|1060151_1062332_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274361.1|1062373_1063309_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017441169.1|1063340_1064585_-	esterase family protein	NA	NA	NA	NA	NA
WP_017441170.1|1064694_1068351_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	2.3e-44
WP_017441171.1|1068431_1069547_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_151122853.1|1070119_1071211_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.1	8.4e-152
WP_001086836.1|1071207_1071813_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268285.1|1071805_1072714_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_000177580.1|1072700_1073060_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000993777.1|1073056_1073635_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_000829123.1|1074265_1074718_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.5	9.4e-57
WP_001039945.1|1074710_1075142_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000196196.1|1075237_1075666_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	89.4	1.8e-57
WP_077908404.1|1075662_1076139_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	2.6e-81
WP_000171568.1|1076158_1076374_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|1076377_1076581_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|1076580_1077045_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000059203.1|1077140_1077791_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	1.6e-110
WP_000742498.1|1077794_1078853_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216222.1|1078869_1079703_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	7.9e-118
WP_001098431.1|1079845_1081612_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520352.1|1081611_1082646_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	2.8e-173
WP_000245245.1|1082654_1083353_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_000366628.1|1083642_1084254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516592.1|1084302_1084563_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	62.2	5.8e-19
WP_001217566.1|1084636_1084870_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	92.2	3.7e-33
WP_001154434.1|1084880_1085069_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_024140583.1|1085221_1087636_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_000104156.1|1087632_1088490_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	7.1e-162
WP_000752613.1|1088486_1088714_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|1088713_1088947_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000963473.1|1089014_1089356_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956182.1|1089319_1089520_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460857.1|1089527_1090037_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	96.4	3.5e-84
WP_000063849.1|1090069_1090318_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	71.6	3.4e-24
WP_000616876.1|1090437_1091070_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	91.0	8.1e-107
WP_006666820.1|1091071_1092085_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	95.5	7.7e-192
WP_000615103.1|1092097_1093618_+	hypothetical protein	NA	NA	NA	NA	NA
1093751:1093795	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_023242842.1|1093960_1095190_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	89.2	1.0e-214
WP_023242843.1|1095537_1096950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017442269.1|1097024_1098146_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_024156456.1|1098223_1099924_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_023242845.1|1099935_1100778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242846.1|1100850_1101315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129369178.1|1101327_1101528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093976750.1|1101937_1103048_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	8.4e-06
WP_086016394.1|1103028_1104119_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	87.7	6.7e-141
WP_017442260.1|1104550_1104778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017442261.1|1104808_1105768_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_061341684.1|1105817_1106657_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000388871.1|1107281_1107821_-	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
WP_024137368.1|1107888_1109394_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000190908.1|1109485_1110052_+	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	73.2	3.5e-69
WP_151122856.1|1110763_1111204_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	5.8e-51
WP_006673255.1|1111175_1111778_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	6.6e-98
WP_050498778.1|1111777_1112329_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.1	8.8e-57
WP_000905033.1|1112356_1112923_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046133.1|1113065_1114238_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.3e-203
WP_001207660.1|1114247_1114763_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1114817_1115120_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1115134_1115254_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_006674729.1|1115246_1118324_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_000980400.1|1118320_1118806_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_151122859.1|1118802_1119903_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	6.5e-176
WP_000980502.1|1119971_1120190_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	76.4	2.2e-27
WP_000391796.1|1120216_1120699_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	4.6e-17
WP_072101449.1|1121256_1122420_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1120823:1120867	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_017442216.1|1122427_1124608_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
>prophage 2
NZ_CP044257	Salmonella enterica strain CFSAN096147 chromosome, complete genome	4757321	1413093	1454913	4757321	coat,integrase,portal	Salmonella_phage(66.07%)	63	1432357:1432373	1455195:1455211
WP_017441412.1|1413093_1413297_-	excisionase	NA	C6ZR24	Salmonella_phage	95.5	4.7e-32
WP_024137319.1|1413393_1414029_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	88.2	6.3e-107
WP_017441413.1|1414273_1414540_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	1.1e-44
WP_017441415.1|1415511_1415769_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
WP_023242786.1|1415770_1416538_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	60.1	1.3e-69
WP_023242787.1|1416534_1416780_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	92.3	1.0e-33
WP_010835575.1|1416776_1417007_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	89.3	5.5e-29
WP_023242788.1|1417003_1417501_-	hypothetical protein	NA	A0A0N6WGF1	Salmonella_phage	82.4	3.5e-73
WP_001214770.1|1417497_1417668_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_001111292.1|1417678_1417972_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	97.9	8.8e-48
WP_001253476.1|1418018_1418303_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_023242790.1|1418302_1419010_-	recombination protein	NA	K7PKU3	Enterobacteria_phage	86.4	1.3e-116
WP_001181693.1|1419293_1419488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023242791.1|1419472_1419607_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	78.0	2.1e-09
WP_000401881.1|1419692_1419947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023242793.1|1420106_1420577_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
WP_039584552.1|1420585_1420918_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	2.5e-51
WP_000856895.1|1421285_1421948_-	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	99.1	1.8e-125
WP_000067726.1|1422066_1422282_+	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_000424166.1|1422389_1422668_+	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
WP_023233620.1|1422850_1423699_+	replication protein	NA	C6ZR51	Salmonella_phage	94.7	8.0e-150
WP_151122862.1|1423806_1425687_+	bifunctional DNA primase/helicase	NA	I6S1U6	Salmonella_phage	98.7	0.0e+00
WP_001064628.1|1425687_1425966_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	100.0	5.2e-50
WP_000736922.1|1426039_1426477_+	recombination protein NinB	NA	C6ZR55	Salmonella_phage	100.0	7.7e-80
WP_000679702.1|1426473_1426647_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113764.1|1426613_1426790_+	NinE family protein	NA	I6RSI9	Salmonella_phage	96.6	4.3e-26
WP_000566853.1|1426786_1426963_+	protein ninF	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.0e-27
WP_001014910.1|1427218_1427614_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	1.4e-69
WP_000149926.1|1427610_1427814_+	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_000219138.1|1427794_1427974_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
WP_001235465.1|1427970_1428594_+	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
WP_017441426.1|1428867_1429065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133454.1|1429311_1429539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994440.1|1429513_1429981_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	45.8	2.5e-28
WP_000182933.1|1430204_1430492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994441.1|1430858_1431380_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	98.3	1.8e-99
WP_017441429.1|1431726_1432107_+	hypothetical protein	NA	Q716B1	Shigella_phage	97.6	1.0e-64
WP_000807793.1|1432210_1432453_+	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
1432357:1432373	attL	CCAGTCAGGCGGCGCTA	NA	NA	NA	NA
WP_017441430.1|1432455_1432860_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	99.3	1.5e-66
WP_000729924.1|1432863_1433352_+	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_017441431.1|1433329_1434829_+	DNA packaging protein	NA	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
WP_151122865.1|1434828_1437006_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
WP_044128237.1|1437019_1437931_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
WP_044128239.1|1437930_1439223_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.5	1.9e-243
WP_010835894.1|1439261_1439471_+	hypothetical protein	NA	I1TEI9	Salmonella_phage	100.0	2.8e-32
WP_080084958.1|1439454_1439955_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.2	6.7e-88
WP_023198766.1|1439914_1441333_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.9	1.5e-273
WP_023198767.1|1441336_1442038_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	93.1	4.0e-70
WP_050068186.1|1442037_1442493_+	DUF2824 family protein	NA	A0A1R3Y5P3	Salmonella_virus	98.7	2.0e-86
WP_050068187.1|1442495_1443191_+	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	96.9	2.2e-113
WP_079959335.1|1443201_1444551_+	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	70.2	3.1e-172
WP_151122868.1|1444535_1446704_+	hypothetical protein	NA	A0A0A0P1R1	Enterobacteria_phage	28.6	8.6e-47
WP_022630937.1|1446749_1447049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653511.1|1447074_1447260_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	96.7	4.3e-08
WP_001036008.1|1447234_1447444_-	hypothetical protein	NA	I6R975	Salmonella_phage	97.1	1.7e-29
WP_001283827.1|1447440_1447692_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	1.2e-34
WP_071653510.1|1447797_1447938_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	4.4e-05
WP_079959333.1|1448036_1448960_+	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	97.1	1.5e-173
WP_080201808.1|1449060_1450848_+	hypothetical protein	NA	I6S5Y0	Salmonella_phage	86.7	1.2e-57
WP_024137322.1|1450879_1452334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023138703.1|1452323_1453250_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	92.8	2.2e-161
WP_023138702.1|1453246_1453609_-	GtrA family protein	NA	I1TED9	Salmonella_phage	82.5	6.2e-51
WP_151122871.1|1453743_1454913_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	99.0	7.7e-228
1455195:1455211	attR	TAGCGCCGCCTGACTGG	NA	NA	NA	NA
>prophage 3
NZ_CP044257	Salmonella enterica strain CFSAN096147 chromosome, complete genome	4757321	1697429	1706600	4757321	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_017441997.1|1697429_1698377_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	3.7e-10
WP_000824854.1|1698360_1699092_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1699072_1699180_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1699239_1699971_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1700193_1701879_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1701875_1702595_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_017441996.1|1702641_1703109_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.0e-74
WP_017441995.1|1703165_1703696_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1703867_1704326_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195334.1|1704566_1706600_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP044257	Salmonella enterica strain CFSAN096147 chromosome, complete genome	4757321	1879383	1886615	4757321		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1879383_1879803_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_017441837.1|1879805_1881074_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
WP_000208509.1|1881519_1881732_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1881742_1881931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017441838.1|1882190_1883375_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.1	5.1e-110
WP_000107435.1|1884024_1884336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017441839.1|1884415_1885111_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_017441840.1|1885184_1886615_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP044257	Salmonella enterica strain CFSAN096147 chromosome, complete genome	4757321	4315134	4362781	4757321	tail,tRNA,plate	Burkholderia_phage(36.36%)	50	NA	NA
WP_001825318.1|4315134_4316133_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4316220_4317531_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_017441254.1|4317777_4318293_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4318391_4318601_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4318622_4318736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4318732_4320058_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4320236_4320845_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4320953_4321322_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4321492_4323913_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4324011_4324884_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_017441255.1|4324897_4325395_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4325575_4326493_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_001594897.1|4326656_4328012_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4328100_4329210_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_001651229.1|4329571_4330762_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4330893_4332438_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4332452_4333343_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4333508_4333919_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4334061_4336158_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_017441256.1|4336157_4336895_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4336891_4337560_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4337593_4337836_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790025.1|4338279_4339929_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136392.1|4340317_4341667_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_001651225.1|4341801_4342149_-	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	52.6	7.5e-22
WP_001226440.1|4342725_4343013_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_017441257.1|4343015_4343621_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.0e-58
WP_000777266.1|4343633_4343948_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_017441258.1|4344107_4344563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875313.1|4344559_4344757_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_017441259.1|4344746_4346174_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.8e-194
WP_017441260.1|4346173_4346698_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	1.8e-67
WP_001003641.1|4346749_4347067_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4347026_4347155_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_017441261.1|4347251_4349606_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.5	3.4e-65
WP_017441262.1|4349605_4350559_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4350558_4350768_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_017441263.1|4350755_4351799_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.5e-76
WP_000679395.1|4351808_4352531_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4352857_4353220_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|4353216_4354146_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_017441264.1|4354145_4355693_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	5.0e-49
WP_001093501.1|4355856_4356216_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_017441265.1|4356206_4357322_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.7	3.1e-101
WP_000359502.1|4357314_4357947_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_017441266.1|4357949_4359608_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	8.0e-53
WP_017441267.1|4359614_4360229_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_017441268.1|4360225_4360681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024142925.1|4361057_4361474_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000587738.1|4362052_4362781_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	0	1037	290830		Escherichia_phage(100.0%)	1	NA	NA
WP_000149862.1|773_1037_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
>prophage 2
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	6255	7311	290830		Salmonella_phage(100.0%)	1	NA	NA
WP_031275323.1|6255_7311_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	50.9	2.1e-83
>prophage 3
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	12909	21629	290830		Salmonella_phage(80.0%)	8	NA	NA
WP_000096325.1|12909_14601_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.1	5.8e-67
WP_000114860.1|14848_16012_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
WP_001121574.1|16381_17194_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	38.9	1.2e-46
WP_000970401.1|17202_18057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000838219.1|18291_19008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594930.1|19004_19205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065778.1|19224_20277_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	31.2	1.1e-12
WP_000594611.1|20753_21629_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.7	7.9e-60
>prophage 4
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	37477	38482	290830		Aeromonas_phage(100.0%)	1	NA	NA
WP_001278838.1|37477_38482_+	ParB N-terminal domain-containing protein	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
>prophage 5
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	41587	42625	290830		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000818954.1|41587_42625_+	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
>prophage 6
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	57307	59092	290830		Bacillus_virus(100.0%)	1	NA	NA
WP_151122800.1|57307_59092_+	AAA family ATPase	NA	G3MA40	Bacillus_virus	23.1	1.3e-21
>prophage 7
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	78824	121316	290830	protease,integrase,transposase	Escherichia_phage(25.0%)	42	77127:77140	95039:95052
77127:77140	attL	AAAAAGTTACTTTT	NA	NA	NA	NA
WP_000795949.1|78824_80000_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|80169_80382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|80742_81825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284315.1|81990_83490_-	kinase	NA	NA	NA	NA	NA
WP_000081059.1|83515_85153_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|85152_86193_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|86277_86916_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|86915_87557_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|87579_88218_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|88680_89148_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|89165_90374_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|90384_91341_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|91340_92420_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|92421_93195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|93187_94330_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012477371.1|94339_95398_-	hypothetical protein	NA	NA	NA	NA	NA
95039:95052	attR	AAAAGTAACTTTTT	NA	NA	NA	NA
WP_000254137.1|95718_96300_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|96299_97457_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_151122812.1|97479_97935_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|97957_98998_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|99046_99625_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|99693_100269_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|100697_101939_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|102029_102485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|102725_102917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|103008_103350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|104335_104590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|104592_106632_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000211823.1|106628_107615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|108535_108928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115314327.1|110820_111525_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	77.0	3.0e-102
WP_001044210.1|111530_111671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|112156_112894_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|112890_113115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|113325_114819_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|114849_115734_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|115950_117165_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|117192_117498_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|117721_118426_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|118741_119299_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|119481_120342_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000462754.1|120659_121316_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	126223	166746	290830	transposase,integrase	Escherichia_phage(27.27%)	44	143629:143682	143950:144003
WP_001641519.1|126223_127039_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.2	2.5e-15
WP_000278471.1|127291_127717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|128265_128574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477564.1|128904_129495_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|129631_130204_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|130240_131632_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|132411_133068_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_012477595.1|134664_135522_-	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
WP_040212993.1|135586_136690_-	peptidoglycan synthetase FtsI	NA	NA	NA	NA	NA
WP_001351729.1|138451_138844_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|138981_139866_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|139897_141097_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|141202_141853_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_087758686.1|141884_142040_-	replication initiator protein	NA	NA	NA	NA	NA
WP_001067855.1|142030_142735_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|142863_143628_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
143629:143682	attL	TCGGCGCAGAGCGACAGCCTACCTCTGACTGCCGCCAATCTTTGCAACAGAGCC	NA	NA	NA	NA
WP_001375131.1|143691_143949_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	61.9	8.9e-12
WP_000993245.1|144186_144399_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
143950:144003	attR	TCGGCGCAGAGCGACAGCCTACCTCTGACTGCCGCCAATCTTTGCAACAGAGCC	NA	NA	NA	NA
WP_001446012.1|144361_144481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|144464_144701_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|144697_145063_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|145080_146766_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|146804_147230_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|147257_147533_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|147548_147914_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|147985_148441_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001287391.1|149721_150126_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|150303_150597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|150622_150859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|150899_151355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447900.1|151414_152080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|152137_152518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833813.1|153269_154112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151122815.1|154098_156222_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_001049182.1|156221_157670_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_024143025.1|157711_159268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262426.1|159279_160206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097217.1|160568_160868_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151122818.1|161430_161589_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_148577032.1|161585_163256_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.9	6.0e-08
WP_000694954.1|163422_163773_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	2.1e-19
WP_151122821.1|163916_164348_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555738.1|164597_166073_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.3	1.9e-26
WP_000697969.1|166065_166746_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
>prophage 9
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	170118	177375	290830		Leptospira_phage(33.33%)	5	NA	NA
WP_032620969.1|170118_173265_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	3.6e-62
WP_000758228.1|173351_173792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023331515.1|173918_176366_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	7.6e-84
WP_000843494.1|176406_176604_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|176637_177375_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
>prophage 10
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	182469	184547	290830		Bacillus_phage(100.0%)	2	NA	NA
WP_001188930.1|182469_183150_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|183146_184547_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
>prophage 11
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	191306	193464	290830		Burkholderia_phage(50.0%)	2	NA	NA
WP_000833380.1|191306_192734_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_011152982.1|192948_193464_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
>prophage 12
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	205141	206819	290830		Cronobacter_phage(100.0%)	2	NA	NA
WP_000111290.1|205141_205576_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_000281824.1|205559_206819_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.5	1.5e-96
>prophage 13
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	230528	284066	290830	transposase	uncultured_Caudovirales_phage(26.67%)	66	NA	NA
WP_000952985.1|230528_231710_+	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	7.5e-13
WP_000338612.1|231711_232443_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000210769.1|232729_233083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091367.1|233148_233433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|234058_235267_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000428546.1|235780_236374_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089072.1|236486_237692_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001322387.1|237770_238397_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|238374_239061_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|239068_239455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|239447_239768_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599531.1|240211_241417_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|241782_242991_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_058671460.1|243050_243245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537761.1|243677_244046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800251.1|244271_244808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286108.1|244875_245313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856246.1|245357_245654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237191.1|245788_246490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000708863.1|246804_247086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272971.1|247151_248336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000778029.1|249439_250384_+	DUF5417 domain-containing protein	NA	NA	NA	NA	NA
WP_001031420.1|250482_251082_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
WP_000743059.1|251141_251492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015183.1|251538_251742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000332796.1|252023_252344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001615628.1|252995_254108_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001447866.1|254301_254460_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_040150689.1|254666_255095_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	9.6e-51
WP_040150692.1|255107_256397_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_151122832.1|256441_256762_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.6	2.0e-21
WP_040150695.1|256847_257546_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.2	2.5e-88
WP_100249820.1|257554_258924_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.7	5.0e-77
WP_000137794.1|259252_259858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|260074_260356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|260731_261043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|261265_261466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|261505_261730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781547.1|261784_261988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371932.1|262540_263032_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001165367.1|263036_263348_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000071366.1|263864_264185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|264363_264594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000252081.1|264765_265659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609386.1|265648_266761_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_001371906.1|266757_267543_-	toxic anion resistance protein TelA	NA	NA	NA	NA	NA
WP_000280723.1|268137_268746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000241452.1|268859_269393_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	6.8e-46
WP_087776199.1|269484_270692_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
WP_000159617.1|270799_270994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|270990_271302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|271364_271604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000469469.1|271853_274238_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_000182312.1|274403_274853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774871.1|274903_275695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052325.1|275924_276182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556023.1|276247_276574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834113.1|276816_277137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000104394.1|277431_278682_-	site-specific DNA-methyltransferase	NA	G8I4P9	Mycobacterium_phage	43.1	6.1e-05
WP_151122835.1|278852_279461_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	38.5	4.4e-25
WP_001290639.1|279616_279874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000069824.1|279938_280367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000645320.1|280458_280836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|281207_282416_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_011152995.1|282579_283761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000581857.1|283769_284066_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	3.2e-05
>prophage 14
NZ_CP044256	Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence	290830	288521	288953	290830		Salmonella_phage(100.0%)	1	NA	NA
WP_001251242.1|288521_288953_-	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	49.6	4.2e-22
