The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	262172	288992	2896393	tRNA,transposase	Streptococcus_phage(50.0%)	25	NA	NA
WP_002295743.1|262172_263081_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002295755.1|263136_263634_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002340421.1|263670_264354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|264700_264967_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|264993_265293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|265466_266018_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296258.1|266163_266457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946666.1|266449_266746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296256.1|266820_267819_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000997695.1|267954_269133_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|269288_270242_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294735.1|270340_271057_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002296623.1|271255_272551_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_025478783.1|272597_274646_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002294732.1|275855_277097_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002294730.1|277243_277879_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294728.1|278069_278810_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002296909.1|278954_280592_-	membrane protein	NA	NA	NA	NA	NA
WP_002321965.1|280557_281079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|281117_282296_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002287592.1|282365_283772_+	membrane protein	NA	NA	NA	NA	NA
WP_002287590.1|283758_285393_+	membrane protein	NA	NA	NA	NA	NA
WP_002287588.1|285567_286401_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002287587.1|286480_287470_+	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002297185.1|287696_288992_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 2
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	532536	597976	2896393	protease,integrase,tRNA,transposase	Streptococcus_phage(23.08%)	57	528089:528108	604825:604844
528089:528108	attL	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
WP_002286726.1|532536_533658_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002286721.1|533903_535325_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_002286711.1|535338_536457_+	aminotransferase	NA	NA	NA	NA	NA
WP_002286708.1|536516_537809_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002326790.1|537958_538519_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286704.1|538647_539025_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_002304230.1|538957_541030_+	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_002289773.1|541240_542188_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	51.0	5.0e-84
WP_002289775.1|542433_542898_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.7	8.8e-18
WP_002289776.1|542959_544003_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_002291188.1|544379_545345_-	TDT family transporter	NA	NA	NA	NA	NA
WP_002297022.1|545578_546424_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002353096.1|546432_546630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291183.1|546614_547802_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_002295166.1|547807_548164_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	42.3	2.7e-22
WP_002291179.1|548165_548504_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_002304234.1|548898_549933_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	4.2e-28
WP_002287674.1|549925_550612_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287678.1|550635_551484_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287679.1|551680_552454_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.1e-08
WP_002287681.1|552466_553753_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002287683.1|553749_554985_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.7	3.9e-113
WP_002287684.1|554971_555442_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002287686.1|555446_556838_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002287705.1|556932_558075_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.8	3.3e-58
WP_002287709.1|558113_558848_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071974479.1|558849_559035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287723.1|559079_559355_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048946547.1|559452_561450_+	hypothetical protein	NA	A0A1Z1LZK7	Bacillus_phage	24.4	5.5e-24
WP_002301912.1|561525_561861_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048946548.1|562239_562602_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_048946549.1|562647_562974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298392.1|563309_563537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298390.1|563816_565640_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
WP_002298389.1|565653_567063_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	3.2e-42
WP_002298387.1|567080_567917_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002317770.1|567981_568764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094850654.1|569167_570293_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	54.1	2.3e-75
WP_002297848.1|571645_571846_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002297850.1|571921_572119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317979.1|572067_572298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297851.1|572415_573963_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	S4VPC4	Pandoravirus	25.7	4.6e-10
WP_002297853.1|574046_574850_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297855.1|574852_575635_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002297856.1|575631_576411_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002297857.1|576382_577174_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.3e-21
WP_002297858.1|577234_578164_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002340328.1|579201_580245_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002312603.1|580308_581772_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.3e-125
WP_002340332.1|582184_583363_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|583583_584492_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002321318.1|584620_585220_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_002321317.1|585219_585795_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_002344971.1|585819_589491_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_002340336.1|589554_593187_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_002321314.1|593302_595825_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_002321313.1|595942_597976_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
604825:604844	attR	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
>prophage 3
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	740455	748927	2896393		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|740455_741100_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|741114_741444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|741457_742396_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|742431_743256_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|743248_743596_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|743664_744537_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002288079.1|744648_745767_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|745820_746423_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|746737_748927_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 4
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	801936	900067	2896393	transposase,capsid,portal,holin,tRNA,tail,head,terminase,integrase,protease	Streptococcus_phage(31.25%)	111	795237:795252	892058:892073
795237:795252	attL	AGCAAATCCTACAAAA	NA	NA	NA	NA
WP_002286621.1|801936_804735_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|804783_806310_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|806324_806972_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|807155_807485_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|807661_808390_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|808405_809419_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|809418_810696_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|810758_813461_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|813612_813930_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|813959_814280_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002371581.1|814387_815848_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|815915_816137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|816167_816350_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|816349_816763_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|816885_818067_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|818597_819737_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|820035_820671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|820783_821419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|821452_821914_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|822043_822475_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|822492_822813_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|823111_823888_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|823902_824106_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107532006.1|824121_824460_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|824446_824626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|824668_825139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|825225_825924_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|826101_826443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|826435_827107_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002330486.1|827112_827805_+	hypothetical protein	NA	A0A0S2MYA3	Enterococcus_phage	52.3	9.7e-61
WP_002317389.1|827812_828328_+	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	37.5	2.9e-17
WP_002305397.1|828432_829263_+	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002305396.1|829279_830131_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305394.1|830127_830487_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002290675.1|830501_830663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305393.1|830659_830965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729719.1|830964_831282_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	1.0e-09
WP_151061491.1|831278_831674_+	hypothetical protein	NA	A0A2H4IZZ8	uncultured_Caudovirales_phage	38.2	3.0e-14
WP_002371781.1|831670_832009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347048.1|832005_832374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347047.1|832370_832676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347046.1|832699_832903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151061493.1|832899_833196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002318885.1|833271_833688_+	autolysin	NA	C9E2P5	Enterococcus_phage	68.1	4.8e-47
WP_002287522.1|834039_834444_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|834460_835609_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_060809366.1|835882_836143_+	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	50.0	1.0e-15
WP_060809365.1|836183_836411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200793.1|836475_837048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974384.1|837048_837360_+	HNH endonuclease	NA	A0A1S5SFB3	Streptococcus_phage	59.2	6.3e-28
WP_071244186.1|837350_837611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073357560.1|837771_838131_+	hypothetical protein	NA	A0A2H4JAH7	uncultured_Caudovirales_phage	67.2	5.2e-34
WP_073357561.1|838127_839771_+|terminase	terminase large subunit	terminase	A0A1S5SF58	Streptococcus_phage	65.3	1.8e-206
WP_106913984.1|839730_840888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151061495.1|840931_842104_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	46.3	7.6e-82
WP_002371767.1|842090_842795_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	45.9	9.5e-48
WP_071244203.1|842799_843960_+|capsid	phage major capsid protein	capsid	D2XR18	Bacillus_phage	39.7	8.3e-65
WP_002371763.1|844035_844314_+	hypothetical protein	NA	A0A1W6JQ66	Staphylococcus_phage	48.2	1.8e-13
WP_073357576.1|844294_844666_+|head,tail	phage head-tail adapter protein	head,tail	A0A059T6F2	Listeria_phage	55.4	1.2e-28
WP_073357564.1|844681_845086_+	hypothetical protein	NA	A0A2H4J7V9	uncultured_Caudovirales_phage	38.5	7.7e-18
WP_077974383.1|845082_845493_+	hypothetical protein	NA	A0A059T681	Listeria_phage	48.0	1.6e-23
WP_077974382.1|845553_846141_+|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	41.0	1.6e-35
WP_002371755.1|846213_846681_+	Ig domain-containing protein	NA	C9E2K1	Enterococcus_phage	43.9	8.1e-19
WP_002337251.1|846726_847035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974380.1|847229_853964_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	36.6	2.0e-17
WP_002342059.1|853967_854840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974378.1|855424_855886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200791.1|855889_856714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200790.1|856731_858774_+	DUF2479 domain-containing protein	NA	A0A096XSZ6	Enterococcus_phage	46.8	2.0e-82
WP_002332429.1|858933_859380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002327992.1|859381_859519_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002303476.1|859555_859849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|859845_860070_+|holin	holin	holin	NA	NA	NA	NA
WP_079200789.1|860066_861086_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002286474.1|862262_862670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|862683_863085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|863086_863458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101706188.1|863493_863793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070647711.1|863798_864029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286921.1|864645_865308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286924.1|865386_868614_+	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002286925.1|868727_869042_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286926.1|869054_869429_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_074399752.1|869429_869783_+	damage-inducible protein J	NA	NA	NA	NA	NA
WP_002286930.1|869853_871206_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.6	5.9e-163
WP_002286932.1|871265_872408_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286933.1|872432_872687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286934.1|872942_874127_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002305703.1|874123_874261_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|875006_876917_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033657400.1|877020_877245_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002288934.1|877257_877758_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002288935.1|877854_879702_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002297208.1|879704_880601_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288938.1|880650_881040_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002321772.1|881026_883372_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002296840.1|883464_884652_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002305732.1|884839_887167_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288982.1|890279_891452_+	class C sortase	NA	NA	NA	NA	NA
WP_002296796.1|891448_891646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946670.1|891661_892108_-	hypothetical protein	NA	NA	NA	NA	NA
892058:892073	attR	TTTTGTAGGATTTGCT	NA	NA	NA	NA
WP_002321037.1|892104_892299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288984.1|892693_893116_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002288985.1|893281_894475_-	MFS transporter	NA	NA	NA	NA	NA
WP_002288986.1|894698_895076_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321036.1|895063_895402_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288989.1|895535_895979_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002303949.1|896240_897056_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002321035.1|897065_897281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|897364_898543_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296623.1|898771_900067_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
>prophage 5
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	906355	963130	2896393	protease,tRNA,transposase	Streptococcus_phage(33.33%)	51	NA	NA
WP_002297185.1|906355_907651_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002297218.1|907795_909091_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288584.1|909289_911410_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.1	2.8e-220
WP_002288581.1|911639_912818_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002288579.1|912833_913592_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288577.1|913614_914100_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|914170_915424_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|915540_916890_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|917001_918348_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|918655_919042_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002312603.1|919265_920729_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.3e-125
WP_002311774.1|921765_922725_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002297633.1|923588_923801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|924078_925878_-	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|926001_926598_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002286097.1|926789_927743_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296337.1|928014_928359_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002296336.1|928359_928779_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|928870_929221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296334.1|929186_930518_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296332.1|930773_931340_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997695.1|932584_933763_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_073466279.1|934372_935836_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	4.0e-125
WP_002288533.1|936110_938006_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002288531.1|938200_938647_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002296119.1|938874_939024_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002296121.1|939111_939630_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002293906.1|939706_940663_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293905.1|940828_941635_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002320813.1|941631_942621_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002296124.1|942617_943622_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002289886.1|943753_944296_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002289885.1|944315_945014_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002293902.1|945034_945247_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_002288462.1|945246_946209_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002288461.1|946226_946622_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288459.1|946784_947150_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288458.1|947146_948958_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288457.1|949019_949187_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288452.1|949434_950424_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288451.1|950435_951920_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288449.1|951943_952924_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288447.1|953012_953837_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288446.1|953820_954363_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288445.1|954369_954834_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288444.1|954830_955847_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	7.1e-60
WP_002288442.1|956455_957157_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288439.1|957617_958847_+	arginine deiminase	NA	NA	NA	NA	NA
WP_002288437.1|958937_959957_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288434.1|960071_961019_+	carbamate kinase	NA	NA	NA	NA	NA
WP_002288432.1|961438_963130_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
>prophage 6
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	1112143	1172478	2896393	integrase,tRNA,transposase	Streptococcus_phage(25.0%)	54	1128546:1128561	1171620:1171635
WP_002297218.1|1112143_1113439_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_151061500.1|1113643_1114345_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|1114341_1115463_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|1115477_1116710_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|1116841_1117750_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002288344.1|1117784_1118057_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288347.1|1118067_1119114_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288348.1|1119364_1121974_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_151061501.1|1122124_1122796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|1122788_1123283_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|1123302_1124523_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010729311.1|1124669_1126505_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_010729312.1|1126700_1127612_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1128546:1128561	attL	AAAGAAGAAGCGAATA	NA	NA	NA	NA
WP_010710562.1|1128607_1128859_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	58.5	1.1e-06
WP_002312949.1|1128941_1129214_+	hypothetical protein	NA	A0A1W6JN36	Lactococcus_phage	57.4	1.6e-19
WP_010729313.1|1129303_1129543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729314.1|1129689_1133973_+	VaFE repeat-containing surface-anchored protein	NA	NA	NA	NA	NA
WP_010729315.1|1134071_1134437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729316.1|1134438_1134891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050566171.1|1135504_1136815_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	36.8	1.3e-61
WP_010729318.1|1136837_1137149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729319.1|1137509_1138766_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729320.1|1138762_1139308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729321.1|1139308_1139809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729324.1|1140465_1140810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729325.1|1140828_1141740_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_010729326.1|1141818_1142811_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_002312989.1|1142807_1143026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729327.1|1143038_1143449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729328.1|1143500_1146029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729329.1|1146044_1148255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729330.1|1148262_1149354_+	CHAP domain-containing protein	NA	A0A0B5A7F4	Streptococcus_phage	29.9	4.6e-25
WP_010710550.1|1149374_1149917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729331.1|1150111_1150369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729332.1|1150382_1150715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729333.1|1150759_1151308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729334.1|1151314_1151767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729337.1|1152923_1153595_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729338.1|1153898_1155530_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010729339.1|1155532_1156612_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_010729340.1|1156685_1158113_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_010729341.1|1158196_1158844_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_010729700.1|1158963_1160340_+	MFS transporter	NA	NA	NA	NA	NA
WP_010729343.1|1160349_1161144_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010729344.1|1161156_1162923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729345.1|1162945_1164754_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	48.4	2.3e-154
WP_010729346.1|1164940_1165342_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002353648.1|1165335_1165581_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729347.1|1165934_1166120_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_010729348.1|1166124_1167267_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	4.5e-39
WP_002297185.1|1167553_1168849_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288357.1|1169006_1170134_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|1170190_1171144_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|1171299_1172478_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
1171620:1171635	attR	TATTCGCTTCTTCTTT	NA	NA	NA	NA
>prophage 7
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	1640636	1700800	2896393	transposase	Streptococcus_phage(50.0%)	46	NA	NA
WP_002398627.1|1640636_1641911_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.4	9.2e-57
WP_002289271.1|1642067_1644509_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_048946671.1|1644693_1645848_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_002289269.1|1645869_1646622_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002294372.1|1646985_1649652_-	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	30.1	1.6e-82
WP_002289473.1|1649992_1651444_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002289472.1|1651772_1652588_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002289474.1|1652881_1653157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289471.1|1653583_1654039_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002289470.1|1654118_1654868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289468.1|1654868_1655195_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289467.1|1655342_1655783_-	universal stress protein	NA	NA	NA	NA	NA
WP_002296967.1|1655863_1657261_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002294365.1|1657413_1658685_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_077495159.1|1658751_1659531_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288275.1|1659908_1660883_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_002288276.1|1660935_1661541_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002288278.1|1661634_1662387_-	aldolase	NA	NA	NA	NA	NA
WP_002288318.1|1662400_1662661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288281.1|1662682_1664044_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288285.1|1664116_1664416_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1664825_1666076_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002291790.1|1666218_1666551_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002297183.1|1666550_1668413_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|1668637_1669591_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289063.1|1669857_1670052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289065.1|1670320_1670620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289050.1|1670716_1671151_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002295327.1|1671382_1672093_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002289048.1|1672082_1672943_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002288832.1|1672947_1673586_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_002288830.1|1673600_1673900_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303570.1|1673942_1675427_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002295331.1|1675446_1675908_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002288825.1|1675925_1676993_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_002288823.1|1677210_1677981_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002288821.1|1678253_1679081_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002288819.1|1679648_1680884_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002295336.1|1681882_1682143_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002288817.1|1682169_1683471_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288815.1|1683762_1684221_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002303716.1|1684233_1685559_-	maltose-6'-phosphate glucosidase	NA	NA	NA	NA	NA
WP_002297218.1|1687891_1689187_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288809.1|1689393_1690269_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002297218.1|1690953_1692249_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002303667.1|1699459_1700800_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
>prophage 8
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	1784933	1840051	2896393	integrase,transposase	Streptococcus_phage(26.67%)	49	1788197:1788212	1849969:1849984
WP_000997695.1|1784933_1786112_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1787184_1788138_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
1788197:1788212	attL	GGCTTTTTTATTTGTC	NA	NA	NA	NA
WP_060809400.1|1788626_1789922_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_002289372.1|1790095_1791043_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_002289370.1|1791047_1791800_-	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289368.1|1791800_1792709_-	dehydrogenase	NA	NA	NA	NA	NA
WP_002289366.1|1792708_1793686_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002326811.1|1793698_1794841_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289363.1|1794830_1795508_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002289362.1|1795480_1796629_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002292874.1|1796625_1797630_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289359.1|1797641_1798649_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292875.1|1798661_1800083_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002302730.1|1800069_1801140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292877.1|1801141_1802569_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002289068.1|1802561_1803524_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_151061510.1|1803556_1804642_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289071.1|1804660_1805701_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289073.1|1805716_1807108_-	sugar transferase	NA	NA	NA	NA	NA
WP_002289074.1|1807485_1808469_+	serine hydrolase	NA	NA	NA	NA	NA
WP_002289076.1|1808836_1810975_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289078.1|1811013_1812600_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002289079.1|1812589_1813810_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289081.1|1813821_1814628_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042957143.1|1814837_1816118_-	membrane protein	NA	NA	NA	NA	NA
WP_002302719.1|1816161_1818195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286428.1|1818228_1819080_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002294532.1|1819177_1820206_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286442.1|1820227_1820800_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002286449.1|1820813_1821680_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002321540.1|1821779_1822514_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286453.1|1822491_1823319_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286455.1|1823318_1824119_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286457.1|1824111_1825251_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_021391141.1|1825455_1826649_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	64.1	8.4e-145
WP_032518109.1|1826727_1826934_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	88.9	3.9e-26
WP_021391143.1|1826926_1828069_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	36.2	4.8e-65
WP_008788621.1|1828580_1829216_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022278536.1|1829557_1830193_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022278535.1|1830299_1831538_+	MFS transporter	NA	NA	NA	NA	NA
WP_022278534.1|1831764_1832184_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_008788617.1|1832188_1832428_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286461.1|1832652_1833576_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002294533.1|1833607_1834372_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286465.1|1834529_1834970_+	flavodoxin	NA	NA	NA	NA	NA
WP_002286467.1|1835147_1835717_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286469.1|1835970_1837203_+	aminopeptidase	NA	NA	NA	NA	NA
WP_002297218.1|1837315_1838611_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297185.1|1838755_1840051_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
1849969:1849984	attR	GGCTTTTTTATTTGTC	NA	NA	NA	NA
>prophage 9
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	1846324	1890306	2896393	tRNA,integrase,transposase	Enterococcus_phage(17.86%)	60	1862862:1862877	1899876:1899891
WP_086956687.1|1846324_1847487_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002330559.1|1847562_1848711_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	91.0	1.0e-200
WP_002287522.1|1848727_1849132_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002318885.1|1849483_1849900_-	autolysin	NA	C9E2P5	Enterococcus_phage	68.1	4.8e-47
WP_151061493.1|1849975_1850272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347046.1|1850268_1850472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347047.1|1850495_1850801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347048.1|1850797_1851166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371781.1|1851162_1851501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151061491.1|1851497_1851893_-	hypothetical protein	NA	A0A2H4IZZ8	uncultured_Caudovirales_phage	38.2	3.0e-14
WP_010729719.1|1851889_1852207_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	1.0e-09
WP_002305393.1|1852206_1852512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290675.1|1852508_1852670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305394.1|1852684_1853044_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002305396.1|1853040_1853892_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305397.1|1853908_1854739_-	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002317389.1|1854843_1855359_-	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	37.5	2.9e-17
WP_002330486.1|1855366_1856059_-	hypothetical protein	NA	A0A0S2MYA3	Enterococcus_phage	52.3	9.7e-61
WP_002286557.1|1856064_1856736_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1856728_1857070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1857247_1857946_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1858032_1858503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|1858545_1858725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325021.1|1858755_1859004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315391.1|1859015_1859201_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002337457.1|1859486_1859861_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	44.6	6.9e-21
WP_070676686.1|1859865_1860294_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_077974389.1|1860384_1861299_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_077974390.1|1861414_1862551_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	37.1	1.7e-54
WP_002286913.1|1862682_1863030_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
1862862:1862877	attL	CGCTGATTCCAGCACC	NA	NA	NA	NA
WP_002293717.1|1863165_1863927_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1863916_1864438_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1864607_1865399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1865523_1865775_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1865786_1866062_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1866314_1866869_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1866947_1867469_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1867472_1868051_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1868162_1869581_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1869601_1869940_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1869899_1870403_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1870533_1871238_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297195.1|1871234_1872971_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1873073_1875545_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_099745856.1|1875549_1875732_-	RNA helicase	NA	NA	NA	NA	NA
WP_002320964.1|1875817_1877086_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	1.9e-54
WP_002296623.1|1877191_1878487_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289807.1|1878889_1879780_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002289809.1|1879976_1880459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1880666_1881032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1881122_1881440_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002296840.1|1881700_1882888_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_074394542.1|1882909_1883101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1883710_1885006_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002287105.1|1885161_1886136_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002287107.1|1886545_1887796_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1888081_1888339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1888570_1888984_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002294831.1|1889352_1890045_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	43.4	2.3e-30
WP_002296536.1|1890039_1890306_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	56.5	1.4e-07
1899876:1899891	attR	CGCTGATTCCAGCACC	NA	NA	NA	NA
>prophage 10
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	1911583	1971986	2896393	bacteriocin,tRNA,transposase	Streptococcus_phage(33.33%)	56	NA	NA
WP_002288767.1|1911583_1912882_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002296294.1|1912921_1914112_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002321579.1|1914132_1914660_-	peptidase	NA	NA	NA	NA	NA
WP_002288763.1|1914706_1917496_-	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002288762.1|1917642_1917843_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002296295.1|1918295_1918616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294874.1|1919118_1920237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296298.1|1920707_1922015_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002296299.1|1922135_1923335_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002296300.1|1923361_1924630_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.3	4.4e-43
WP_002296301.1|1924799_1925441_-	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002308675.1|1925512_1925716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296302.1|1925849_1926353_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002294889.1|1926475_1927240_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1927347_1927623_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002317189.1|1928182_1929133_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002311321.1|1929178_1929580_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311319.1|1929593_1930403_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002311317.1|1930389_1931280_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002311314.1|1931947_1932889_-	hexose kinase	NA	NA	NA	NA	NA
WP_002311313.1|1932885_1933881_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311312.1|1933873_1935070_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002311311.1|1935087_1935816_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002311310.1|1936256_1937231_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002294893.1|1937227_1937686_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002317191.1|1937682_1939146_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002317192.1|1939127_1940060_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002347297.1|1940201_1940870_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002337813.1|1940793_1941747_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077974463.1|1941948_1942065_-	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_002323245.1|1942282_1943455_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002296127.1|1945728_1947276_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|1947376_1947730_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1947719_1947914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125314462.1|1948258_1948489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317228.1|1949769_1950810_-	sugar kinase	NA	NA	NA	NA	NA
WP_002321992.1|1950817_1951336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974461.1|1951281_1951860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297160.1|1951994_1953578_-	3-hydroxy-3-methylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_002297161.1|1953596_1954256_-	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002297162.1|1954348_1955770_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002343622.1|1955766_1956855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321991.1|1956938_1958174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297168.1|1958791_1959847_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002297169.1|1959868_1960891_-	polysaccharide biosynthesis protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	30.8	5.3e-07
WP_002297170.1|1960896_1962003_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_048946718.1|1962002_1963139_-	glycosyltransferase family 4 protein	NA	A0A1V0SD18	Indivirus	24.5	5.9e-07
WP_002317234.1|1963170_1964622_-	sugar transferase	NA	NA	NA	NA	NA
WP_002296215.1|1964665_1965430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296213.1|1965457_1966156_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.6	2.4e-27
WP_002296211.1|1966167_1966947_-	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002296209.1|1966962_1967907_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002296207.1|1967952_1968732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010726792.1|1970489_1971398_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002296756.1|1971432_1971783_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002296753.1|1971782_1971986_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 11
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	2300049	2406377	2896393	transposase,capsid,portal,holin,tail,bacteriocin,head,terminase,integrase,protease	Enterococcus_phage(24.49%)	114	2352016:2352075	2387251:2387311
WP_002351803.1|2300049_2301369_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002287264.1|2301595_2302465_-	extradiol dioxygenase	NA	NA	NA	NA	NA
WP_002287265.1|2303168_2305061_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	1.6e-60
WP_002287267.1|2305057_2306785_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	5.6e-49
WP_002287269.1|2306800_2307451_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287271.1|2307654_2307951_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002287272.1|2308142_2308763_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_002287273.1|2308854_2310021_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287274.1|2310032_2310386_-	PTS sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287276.1|2310513_2311536_+	lactonase family protein	NA	NA	NA	NA	NA
WP_002287278.1|2311974_2312409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287279.1|2312518_2314378_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_002321042.1|2314378_2314519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287280.1|2314495_2315656_-	D-3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.1	1.9e-61
WP_002287282.1|2315962_2317387_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_002287284.1|2317402_2318101_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002287286.1|2318057_2319719_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_002287287.1|2319936_2321337_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_002287288.1|2321588_2322668_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287289.1|2322753_2323713_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_002287290.1|2323724_2325248_-	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_002287292.1|2325827_2326691_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287294.1|2326704_2327601_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287295.1|2327775_2329047_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287297.1|2329036_2330554_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_002287299.1|2330751_2331642_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287302.1|2331714_2332539_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.8	6.1e-78
WP_002287304.1|2332550_2334023_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.0	1.2e-108
WP_002287305.1|2334659_2335022_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002287306.1|2335244_2335997_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321047.1|2336136_2337060_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287308.1|2337074_2337347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|2337690_2338878_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288864.1|2339290_2340916_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_002288862.1|2340966_2341251_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002288860.1|2341475_2342138_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002288858.1|2342213_2343506_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288856.1|2343675_2344305_+	flavin reductase	NA	NA	NA	NA	NA
WP_002288854.1|2344407_2345217_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002288853.1|2345271_2346141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|2346141_2347458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288851.1|2347454_2349290_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	4.0e-37
WP_002288850.1|2349294_2349999_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002288847.1|2350188_2351049_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	2.7e-12
WP_002322652.1|2351035_2351605_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
2352016:2352075	attL	ACTCTTAATCAGCGGGTCGCGGGTTCGAGCCCCTCACGGCCCATTGGGTGCCAAACCCAC	NA	NA	NA	NA
WP_107553916.1|2352584_2352890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151061514.1|2353666_2354677_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.8e-61
WP_002349356.1|2354673_2355063_-|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	70.6	5.3e-40
WP_002302750.1|2355162_2355303_-	XkdX family protein	NA	A0A2H4JD72	uncultured_Caudovirales_phage	54.8	1.1e-08
WP_002332774.1|2355295_2355643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151061516.1|2355656_2357738_-	hypothetical protein	NA	A0A096XSZ6	Enterococcus_phage	38.5	5.1e-81
WP_061100002.1|2357761_2360053_-	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.2	1.5e-89
WP_002286500.1|2360062_2360800_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_061100003.1|2360850_2364183_-	hypothetical protein	NA	D2J070	Enterococcus_phage	44.4	5.2e-51
WP_002305377.1|2364200_2364383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299170.1|2364385_2364748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061100004.1|2364767_2365376_-	hypothetical protein	NA	Q8W5Z9	Listeria_phage	40.5	1.2e-33
WP_002286516.1|2365387_2365792_-	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002296598.1|2365784_2366186_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286522.1|2366175_2366529_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_002286523.1|2366518_2366830_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_061100005.1|2366826_2367702_-	hypothetical protein	NA	D2IYX3	Enterococcus_phage	73.9	2.1e-129
WP_002286525.1|2367711_2368872_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286527.1|2368871_2369558_-|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_111994840.1|2369520_2370699_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.7	1.9e-80
WP_151061517.1|2370718_2372413_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.8	7.9e-149
WP_002286538.1|2372390_2372705_-|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002296599.1|2372807_2373089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|2373093_2373438_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002347042.1|2374345_2374762_-	ArpU family phage transcriptional regulator	NA	C9E2P5	Enterococcus_phage	68.8	3.6e-47
WP_151061493.1|2374837_2375134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347046.1|2375130_2375334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347047.1|2375357_2375663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347048.1|2375659_2376028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371781.1|2376024_2376363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151061491.1|2376359_2376755_-	hypothetical protein	NA	A0A2H4IZZ8	uncultured_Caudovirales_phage	38.2	3.0e-14
WP_010729719.1|2376751_2377069_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	1.0e-09
WP_002305393.1|2377068_2377374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290675.1|2377370_2377532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305394.1|2377546_2377906_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002305396.1|2377902_2378754_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305397.1|2378770_2379601_-	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002317389.1|2379705_2380221_-	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	37.5	2.9e-17
WP_002330486.1|2380228_2380921_-	hypothetical protein	NA	A0A0S2MYA3	Enterococcus_phage	52.3	9.7e-61
WP_002286557.1|2380926_2381598_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|2381590_2381932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|2382109_2382808_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|2382894_2383365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151061518.1|2383407_2383587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347060.1|2383562_2383814_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002323901.1|2383827_2384019_-	hypothetical protein	NA	Q9T1I7	Lactobacillus_phage	35.5	1.4e-06
WP_002347061.1|2384311_2384632_+	helix-turn-helix transcriptional regulator	NA	A0A182BQC8	Lactococcus_phage	49.1	1.2e-18
WP_002347063.1|2384649_2385072_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002329429.1|2385154_2385790_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	52.6	5.1e-32
WP_002347064.1|2385907_2387119_+|integrase	site-specific integrase	integrase	A0A0B5CTW8	Listeria_phage	30.6	1.4e-35
WP_000222572.1|2387469_2388423_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
2387251:2387311	attR	ACTCTTAATCAGCGGGTCGCGGGTTCGAGCCCCTCACGGCCCATTGGGTGCCAAACCCACG	NA	NA	NA	NA
WP_002321654.1|2388419_2388566_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002287810.1|2388669_2388981_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002304799.1|2388982_2389180_-	enterocin	NA	NA	NA	NA	NA
WP_002287807.1|2389573_2391301_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002287805.1|2391293_2392487_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287801.1|2392673_2393318_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002304795.1|2393265_2393457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290587.1|2393411_2393546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287799.1|2393547_2395680_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002287797.1|2395676_2396150_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287795.1|2396550_2396775_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287793.1|2396933_2399093_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287792.1|2399142_2400108_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287791.1|2400196_2401336_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287788.1|2401644_2402358_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287787.1|2402611_2403313_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002290558.1|2403546_2405079_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002295743.1|2405468_2406377_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	2571744	2582515	2896393	tRNA,transposase	Staphylococcus_phage(50.0%)	7	NA	NA
WP_002285916.1|2571744_2574159_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002326691.1|2574375_2575455_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	36.2	9.2e-50
WP_002301403.1|2575974_2577993_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2578362_2579019_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2579018_2579975_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2579974_2580541_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_002285885.1|2580745_2582515_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
>prophage 13
NZ_CP044274	Enterococcus faecium strain V2937 chromosome, complete genome	2896393	2718340	2819734	2896393	integrase,transposase	Streptococcus_phage(50.0%)	95	2711296:2711313	2764014:2764031
2711296:2711313	attL	TTGTTCATAAAAAGAGAA	NA	NA	NA	NA
WP_086956687.1|2718340_2719503_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002331276.1|2719543_2719789_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002331275.1|2719887_2720202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331274.1|2720269_2720764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331273.1|2720756_2721071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321376.1|2721051_2721243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321375.1|2721286_2722678_-	relaxase/mobilisation nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_002321374.1|2722662_2723274_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_002322532.1|2723277_2723475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340550.1|2723465_2726144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023043245.1|2726130_2726349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321717.1|2726424_2727477_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_002321715.1|2727629_2727956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319736.1|2727967_2728168_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002321714.1|2728242_2728893_+	helix-turn-helix transcriptional regulator	NA	Q20DG0	Lactobacillus_phage	33.3	3.2e-05
WP_002318021.1|2728947_2730114_+|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	34.0	3.3e-45
WP_002305526.1|2730530_2733758_+	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002303694.1|2733869_2734184_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	51.5	1.9e-24
WP_002302502.1|2734196_2734571_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	63.9	6.4e-35
WP_002305525.1|2734571_2734925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002346767.1|2734993_2736010_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	56.6	5.7e-102
WP_002330681.1|2736603_2738478_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096929203.1|2738603_2738960_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	84.6	1.3e-45
WP_002302494.1|2739004_2740147_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.4	1.6e-129
WP_002305523.1|2740681_2741866_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	63.2	8.3e-145
WP_002302478.1|2741862_2741976_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2742745_2744656_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033657400.1|2744759_2744984_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002302474.1|2744996_2745500_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	60.4	2.0e-52
WP_002302472.1|2745626_2746664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946567.1|2746678_2748376_+	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
WP_002302466.1|2748368_2748830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302464.1|2748842_2749703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302462.1|2749740_2750130_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	67.5	5.1e-43
WP_002302460.1|2750116_2752564_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.4	0.0e+00
WP_002302459.1|2752568_2754677_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.9	4.5e-178
WP_002302457.1|2754673_2755678_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	64.8	5.6e-118
WP_002302456.1|2755696_2756608_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	41.1	3.0e-62
WP_002297343.1|2757269_2757485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094029191.1|2757743_2757911_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	75.0	4.4e-12
WP_002303678.1|2760242_2760914_-	hypothetical protein	NA	A0A0C5K996	Enterococcus_phage	33.9	4.1e-08
WP_010727027.1|2761262_2762714_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	46.1	1.9e-18
WP_002303673.1|2762825_2764169_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
2764014:2764031	attR	TTCTCTTTTTATGAACAA	NA	NA	NA	NA
WP_151061522.1|2764302_2769753_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_002303670.1|2770369_2770675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303669.1|2770819_2772025_-	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
WP_002302419.1|2772718_2773105_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002302418.1|2773202_2773394_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002305515.1|2773907_2774240_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002303668.1|2774149_2774353_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002348989.1|2774383_2774530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348988.1|2774536_2774692_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002303667.1|2774967_2776308_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_002330794.1|2778280_2778499_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106914383.1|2778519_2779155_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.2e-17
WP_002303663.1|2779347_2779587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303662.1|2779610_2781134_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002302412.1|2781151_2781274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303661.1|2781303_2782287_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2782310_2782460_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2782480_2782858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2782889_2783069_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2783083_2783353_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002303659.1|2783875_2785618_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	4.5e-30
WP_002303657.1|2785601_2787356_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002302405.1|2787465_2788035_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002323245.1|2788118_2789291_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_151061524.1|2789375_2790809_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_002297304.1|2790810_2791479_-	cobalt transporter	NA	NA	NA	NA	NA
WP_071875988.1|2791609_2792194_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048946685.1|2792528_2792759_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_002297295.1|2792773_2793724_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297294.1|2793720_2794563_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002305510.1|2794695_2795421_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.6e-19
WP_002302388.1|2795881_2796196_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002302387.1|2796211_2797807_-	solute:sodium symporter family transporter	NA	NA	NA	NA	NA
WP_002302386.1|2797829_2798720_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_002302385.1|2798736_2799762_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_002302384.1|2799785_2800793_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002330790.1|2800905_2802066_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002302381.1|2802141_2803596_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002287107.1|2804004_2805255_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305507.1|2805442_2806267_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002305506.1|2806305_2808222_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	24.4	6.2e-25
WP_002305505.1|2808232_2809267_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_002305504.1|2809423_2810440_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002346694.1|2810541_2810739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351803.1|2810710_2812030_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002346694.1|2812183_2812381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351803.1|2812352_2813672_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002303714.1|2814412_2815393_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_002302368.1|2815405_2816284_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_002303713.1|2816299_2817100_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_151061525.1|2818443_2818818_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	34.6	1.6e-09
WP_002303710.1|2818825_2819734_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP044275	Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence	201015	3223	57683	201015	transposase	Streptococcus_phage(25.0%)	57	NA	NA
WP_002287522.1|3223_3628_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002330559.1|3644_4793_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	91.0	1.0e-200
WP_086956687.1|4868_6030_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_080032696.1|6014_6218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299885.1|6553_6793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014748767.1|6904_7099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330606.1|7184_7856_+	class A sortase	NA	NA	NA	NA	NA
WP_048946524.1|7908_9885_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002305221.1|9899_10652_+	class C sortase	NA	NA	NA	NA	NA
WP_002317431.1|10667_11423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302867.1|11435_11696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305225.1|11692_13783_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002310966.1|13809_14274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305229.1|14270_14513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295662.1|14530_14833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946525.1|14902_16966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321281.1|16965_19578_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_048946526.1|19574_22106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297506.1|22155_22488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002313112.1|22488_23082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296364.1|23244_25269_+	ATPase	NA	NA	NA	NA	NA
WP_002302853.1|25268_26468_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	38.1	2.5e-32
WP_014401499.1|26483_27128_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_048946527.1|27138_27945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002313120.1|27966_28197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002341614.1|28710_29019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322697.1|29020_29443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946531.1|29462_31052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305032.1|31063_31399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302840.1|31539_31734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287107.1|31869_33120_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_010733686.1|33528_35901_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	50.8	7.0e-10
WP_010733685.1|35961_37422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946614.1|37432_39637_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.9	4.7e-117
WP_002296244.1|39876_40470_+	abortive infection protein	NA	NA	NA	NA	NA
WP_010733696.1|40482_41382_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_048946612.1|41384_41882_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	59.4	2.2e-43
WP_002296240.1|42247_42508_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002325537.1|42952_43159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110300627.1|43206_43410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332738.1|43425_43863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332739.1|43855_44563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010733722.1|44726_44927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305761.1|44942_45122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287514.1|45446_45710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|45703_46054_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002318230.1|46077_46692_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002288787.1|47005_47428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|47437_47641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|47851_48436_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_086322086.1|48719_49406_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_002305879.1|49718_50591_-	ROK family protein	NA	NA	NA	NA	NA
WP_002352509.1|50854_52801_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|52985_54425_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|54426_55389_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|55558_56985_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|57227_57683_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
>prophage 2
NZ_CP044275	Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence	201015	62899	171580	201015	integrase,transposase	Streptococcus_phage(31.82%)	112	97064:97087	171626:171649
WP_086956687.1|62899_64062_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002322543.1|64327_64519_-	fructokinase	NA	NA	NA	NA	NA
WP_002305874.1|64564_64813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287870.1|65179_65698_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002313170.1|66040_66244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301591.1|67773_68859_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002287760.1|68966_69920_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.3e-34
WP_002301126.1|70050_71301_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|71319_72246_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|72324_73320_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|73335_74505_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|74520_75255_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|76025_77188_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_086953915.1|77446_78785_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301811.1|79176_80469_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|80742_81003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|81253_82432_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_002300493.1|82594_83764_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060797506.1|84553_85234_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	4.2e-109
WP_000195429.1|85556_86729_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_025189010.1|87538_87931_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_000195429.1|88629_89802_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002319817.1|90778_91459_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_010729776.1|91464_91935_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	33.6	1.5e-09
WP_000824191.1|91979_92147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|92180_92480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|92520_93138_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|93462_93858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151061530.1|93937_96307_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_001015311.1|96351_97032_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
97064:97087	attL	ATTTAAAACTTTGCAACAGAACCA	NA	NA	NA	NA
WP_002300494.1|97133_98453_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|98449_99103_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002349129.1|99164_99305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348630.1|99812_100529_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_002302256.1|100578_100788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|102444_103476_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002313180.1|103482_104313_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302265.1|104309_105116_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|105121_105946_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002302268.1|105935_107036_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302270.1|107213_107999_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002330694.1|108031_108415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|108490_108622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322470.1|108590_108827_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_077828693.1|108838_109006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302275.1|108904_109876_-	radical SAM protein	NA	NA	NA	NA	NA
WP_049142603.1|110527_112150_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	3.4e-125
WP_002298085.1|112435_113812_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|113811_114468_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|114477_115755_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_111944785.1|116004_117166_+|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_010706480.1|117803_118154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115250354.1|118620_119782_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.8	5.9e-79
WP_002305938.1|120394_120601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305939.1|120738_121698_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	4.5e-32
WP_002305121.1|121684_122290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002343836.1|122529_123678_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	90.8	3.9e-200
WP_002287522.1|123694_124099_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002303574.1|124347_124902_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.7	6.6e-36
WP_127820643.1|125366_126320_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.0	1.5e-11
WP_000195429.1|127132_128305_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_060797506.1|128627_129308_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	4.2e-109
WP_002351514.1|129368_129965_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.4	2.9e-13
WP_002351513.1|129961_130912_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_002351512.1|131430_131844_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	39.6	1.3e-15
WP_002351511.1|131840_132077_-	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002351510.1|132213_132447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351509.1|132431_133034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351507.1|133896_134085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340535.1|134105_134318_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002340534.1|134307_134703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340533.1|134795_135476_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	1.3e-110
WP_002340532.1|135558_136176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340531.1|136339_136672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002351685.1|136736_136958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340530.1|136995_137157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111944786.1|137188_137869_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	1.6e-108
WP_002340528.1|137866_138145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002339787.1|138303_138570_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002339788.1|138559_138916_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002340527.1|138998_139778_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_002340526.1|139791_140508_-	Fic family protein	NA	NA	NA	NA	NA
WP_002340525.1|140556_141156_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.6	4.2e-28
WP_002351732.1|142107_142704_-	YdhK family protein	NA	NA	NA	NA	NA
WP_002307659.1|142724_142931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351733.1|142945_143995_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.8	4.2e-39
WP_002340523.1|143991_144339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974500.1|144522_144711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126355944.1|144694_145857_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002297218.1|146407_147703_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002301358.1|147889_148432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002307628.1|148744_149296_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.7	2.9e-31
WP_002340522.1|149588_151520_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.9	1.2e-97
WP_002320191.1|151818_152133_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002340521.1|152174_153083_+	cation transporter	NA	NA	NA	NA	NA
WP_002340520.1|153184_153796_-	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_002340519.1|153812_154175_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	41.3	1.4e-15
WP_048946522.1|154484_156389_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	1.7e-99
WP_002301447.1|156586_156820_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_002322689.1|156966_157821_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002300938.1|157805_158144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292156.1|158371_159076_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002292150.1|159220_159793_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	3.9e-23
WP_002296623.1|160074_161370_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289586.1|161586_162429_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002289584.1|162465_163932_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002298230.1|163987_165832_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
WP_002292681.1|168320_168869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048946720.1|168869_169727_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002300557.1|170012_170300_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|170289_170619_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_151061529.1|170893_171580_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	5.0e-126
171626:171649	attR	ATTTAAAACTTTGCAACAGAACCA	NA	NA	NA	NA
>prophage 1
NZ_CP044276	Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence	40955	10607	18958	40955	transposase	Streptococcus_phage(33.33%)	8	NA	NA
WP_002342448.1|10607_11933_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.8	1.4e-100
WP_002323245.1|12219_13392_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001280781.1|13543_14239_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|14216_15371_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|15585_16554_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|16546_17578_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|17583_18192_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_002354485.1|18271_18958_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
>prophage 2
NZ_CP044276	Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence	40955	24328	40499	40955	transposase	Streptococcus_phage(68.75%)	21	NA	NA
WP_001062587.1|24328_24946_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.6	2.9e-16
WP_002360685.1|26134_26431_+	hypothetical protein	NA	A0A2K5B2B2	Erysipelothrix_phage	91.8	4.6e-44
WP_000323438.1|26431_26848_+	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	98.6	1.2e-71
WP_002390960.1|26867_28412_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	88.7	1.8e-256
WP_000205227.1|28554_28779_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060763469.1|28793_29663_+	DNA polymerase	NA	A0A1X9I6C9	Streptococcus_phage	90.7	8.8e-152
WP_000662263.1|29643_30378_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|30410_31319_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000627290.1|31315_31858_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|31950_32745_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_078154339.1|33377_33593_+	WYL domain-containing protein	NA	E4ZFP5	Streptococcus_phage	98.6	3.4e-33
WP_002334978.1|33890_34787_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	97.2	9.0e-152
WP_000527318.1|34885_35095_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	98.6	1.4e-31
WP_002331065.1|35111_35384_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	96.7	5.4e-07
WP_074394525.1|35385_36249_+	toxin zeta	NA	NA	NA	NA	NA
WP_002321849.1|36511_37249_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	100.0	3.7e-135
WP_001814874.1|37373_37457_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_011799058.1|37597_38284_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.7e-126
WP_099124473.1|38287_38905_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000599739.1|39305_39911_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_000170424.1|39926_40499_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
