The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038216	Burkholderia pseudomallei strain Yap7 chromosome 1, complete sequence	3932431	442627	453603	3932431	protease	Streptococcus_phage(16.67%)	11	NA	NA
WP_004197486.1|442627_444742_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_071897722.1|444866_445055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526282.1|445051_445561_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.2e-13
WP_071810810.1|445752_445971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189780.1|446233_446812_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004189552.1|447079_448339_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189626.1|448311_448494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004546221.1|448506_450126_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|450255_450459_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|450991_451306_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|451302_453603_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
>prophage 2
NZ_CP038216	Burkholderia pseudomallei strain Yap7 chromosome 1, complete sequence	3932431	992638	999414	3932431	integrase	Burkholderia_virus(33.33%)	11	990441:990461	1016132:1016152
990441:990461	attL	TCGCGGCGGGCGGCGGCGTGC	NA	NA	NA	NA
WP_004192768.1|992638_993340_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	44.8	9.9e-13
WP_004526695.1|993636_994545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029671251.1|994740_994848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521810.1|995092_995923_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_071810706.1|996231_996660_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.4	4.6e-21
WP_009941993.1|996610_996817_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.7e-16
WP_076846902.1|996837_997176_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	58.0	3.2e-25
WP_076831547.1|997541_997985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038728719.1|998019_998493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038728717.1|998485_998992_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	3.9e-19
WP_076838831.1|998988_999414_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
1016132:1016152	attR	GCACGCCGCCGCCCGCCGCGA	NA	NA	NA	NA
>prophage 3
NZ_CP038216	Burkholderia pseudomallei strain Yap7 chromosome 1, complete sequence	3932431	2051696	2124679	3932431	portal,head,protease,tail,plate,terminase,tRNA,capsid,integrase	uncultured_Caudovirales_phage(26.32%)	94	2096034:2096051	2113722:2113739
WP_009931101.1|2051696_2053166_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_004193249.1|2053209_2054181_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_004205123.1|2054284_2055223_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004192752.1|2055270_2056668_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	1.8e-42
WP_004191389.1|2056956_2057622_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004191635.1|2057678_2058254_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	5.3e-12
WP_004193779.1|2058334_2058826_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	33.3	4.2e-10
WP_004550230.1|2058850_2059651_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_009921276.1|2059719_2059932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193377.1|2059986_2060772_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_014917760.1|2060962_2061877_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004532151.1|2061873_2062125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191664.1|2062168_2062972_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_004527347.1|2063240_2063513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009921282.1|2063541_2063793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009954883.1|2063696_2063912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076809161.1|2064243_2064435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192883.1|2064420_2064648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076853220.1|2064710_2064950_+	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_024430922.1|2065149_2065983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038714120.1|2065979_2067119_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080002259.1|2067379_2067586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534654.1|2067771_2069724_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004534916.1|2070068_2070518_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	68.5	1.8e-47
WP_004534728.1|2070507_2070768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122836968.1|2071075_2072032_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	38.7	1.7e-47
WP_122794587.1|2072006_2072315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534755.1|2073534_2073960_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_004534452.1|2073956_2074466_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	37.7	9.7e-18
WP_076910187.1|2074807_2075407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076812051.1|2075838_2076147_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	62.1	5.0e-25
WP_076819500.1|2076182_2076971_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.6	6.7e-151
WP_038712566.1|2077114_2077660_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	95.0	1.0e-81
WP_050883818.1|2077659_2078202_-	lysozyme	NA	A4JX20	Burkholderia_virus	90.6	1.3e-84
WP_004533694.1|2078194_2078389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122656927.1|2078464_2079517_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	45.8	7.0e-79
WP_004540041.1|2079526_2079733_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
WP_004547832.1|2079707_2080589_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	36.6	1.5e-29
WP_076889983.1|2080597_2083012_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.5	5.2e-69
WP_004552769.1|2083099_2083402_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_004552768.1|2083471_2083975_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	4.3e-42
WP_076900924.1|2083985_2085155_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.9	8.1e-161
WP_009909071.1|2085220_2085673_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	77.7	4.8e-45
WP_004552413.1|2085688_2087152_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.2	1.6e-214
WP_004547894.1|2087139_2087715_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_004547860.1|2087707_2088601_-|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	40.7	6.4e-49
WP_004547840.1|2088597_2088942_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004547866.1|2088938_2089145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122657137.1|2089209_2089890_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
WP_004533675.1|2089892_2090426_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_004539763.1|2090415_2090946_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_004555262.1|2090947_2091238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550216.1|2091241_2092267_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	1.7e-109
WP_004539732.1|2092301_2092646_-|head	head decoration protein	head	NA	NA	NA	NA
WP_004555261.1|2092672_2093773_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.3	7.9e-49
WP_122766286.1|2093769_2095263_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	7.5e-135
WP_004533700.1|2095259_2095466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552756.1|2095476_2097462_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	2.1e-180
2096034:2096051	attL	CGACCGACGCGCGCGGCG	NA	NA	NA	NA
WP_009935700.1|2097424_2097994_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024430516.1|2098089_2098278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123903064.1|2098419_2098728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123903065.1|2098678_2099038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017844234.1|2099198_2099972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150976906.1|2100189_2102682_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	4.7e-97
WP_004555257.1|2102801_2103272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024430956.1|2103402_2103582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555256.1|2103645_2104209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143293908.1|2104267_2104783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555255.1|2104810_2105143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|2105156_2105684_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_085955187.1|2105783_2105963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076840169.1|2106113_2106623_+	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	42.1	3.6e-12
WP_038758334.1|2106567_2107041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|2107173_2107392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004533940.1|2107443_2107779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038758333.1|2107775_2108381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004533966.1|2108377_2108827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150976904.1|2108826_2110143_+	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_004555250.1|2110256_2110586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555249.1|2110594_2111068_+	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_009890227.1|2111076_2111319_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_024430959.1|2111269_2112571_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.7	2.6e-147
WP_137984612.1|2112742_2115415_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
2113722:2113739	attR	CGCCGCGCGCGTCGGTCG	NA	NA	NA	NA
WP_038741765.1|2115401_2116700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524740.1|2116679_2117225_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_076887471.1|2117317_2118481_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_009904701.1|2118537_2118807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550225.1|2118712_2118967_+	lipoprotein	NA	NA	NA	NA	NA
WP_076903200.1|2119207_2119984_-	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	1.5e-09
WP_004544024.1|2119988_2121131_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_004191516.1|2121241_2122144_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_150976902.1|2122188_2122806_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191887.1|2122802_2124005_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004192745.1|2124013_2124679_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 4
NZ_CP038216	Burkholderia pseudomallei strain Yap7 chromosome 1, complete sequence	3932431	2413089	2421977	3932431		Tanapox_virus(16.67%)	9	NA	NA
WP_004547474.1|2413089_2413932_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	5.5e-18
WP_122656575.1|2414274_2415198_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_151018678.1|2415325_2416702_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004550116.1|2416928_2417831_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_076853525.1|2417842_2418169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189725.1|2418181_2418499_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004190173.1|2418570_2419563_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004522359.1|2419621_2420608_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.8	6.7e-15
WP_004522358.1|2420576_2421977_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
>prophage 5
NZ_CP038216	Burkholderia pseudomallei strain Yap7 chromosome 1, complete sequence	3932431	2759238	2768493	3932431		unidentified_phage(16.67%)	7	NA	NA
WP_004522151.1|2759238_2760786_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_009971015.1|2760822_2761350_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004532195.1|2761346_2762030_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194137.1|2762094_2762910_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_058040641.1|2763092_2765111_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.2	7.0e-51
WP_004533593.1|2765144_2766275_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_004194034.1|2766540_2768493_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 6
NZ_CP038216	Burkholderia pseudomallei strain Yap7 chromosome 1, complete sequence	3932431	3052973	3111301	3932431	tail,plate,tRNA,transposase,integrase	Burkholderia_phage(27.27%)	61	3057194:3057211	3114495:3114512
WP_004521984.1|3052973_3054272_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004527811.1|3054338_3055421_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_004534980.1|3055464_3056322_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004186955.1|3056401_3056710_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004521981.1|3056724_3057321_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
3057194:3057211	attL	CCGCGTTCTACGCGATGC	NA	NA	NA	NA
WP_004545630.1|3057605_3058394_+	dioxygenase	NA	NA	NA	NA	NA
WP_004527813.1|3058841_3060443_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|3060876_3061080_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_076841889.1|3061066_3061204_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_150976838.1|3061266_3062529_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_122658173.1|3062652_3062925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198059.1|3063191_3063797_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198060.1|3063758_3064334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004535445.1|3064293_3065577_-	MFS transporter	NA	NA	NA	NA	NA
WP_151018681.1|3065735_3066404_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076808608.1|3066394_3066745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527819.1|3066741_3067365_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004527820.1|3067449_3068352_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004535007.1|3068479_3069616_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075018965.1|3069612_3069828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075018814.1|3069775_3069898_+	aromatic ring-opening dioxygenase LigA	NA	NA	NA	NA	NA
WP_004535015.1|3069972_3071091_-	acyltransferase	NA	NA	NA	NA	NA
WP_150976833.1|3071089_3071569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205258.1|3071528_3071975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527825.1|3072335_3072458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009932025.1|3072501_3072597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038763718.1|3072635_3074801_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_150976831.1|3074758_3075019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071893038.1|3075382_3075781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205259.1|3075823_3076093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|3076195_3076426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004553843.1|3076502_3076685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004521964.1|3076659_3077016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|3077041_3078310_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_076891085.1|3078324_3080586_+	peptidase domain-containing ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	2.3e-10
WP_009932031.1|3080582_3082031_+	TolC family protein	NA	NA	NA	NA	NA
WP_004521961.1|3082015_3082165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527832.1|3083237_3084203_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_009922418.1|3084220_3084499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200003.1|3088363_3089353_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_151018682.1|3089371_3090289_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004521957.1|3090487_3091609_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004202807.1|3091698_3094368_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.0	3.8e-89
WP_004200010.1|3094401_3095502_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011205262.1|3095465_3097292_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011205263.1|3097383_3097896_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004527837.1|3097923_3098427_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004521953.1|3098499_3099990_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004521952.1|3100006_3100525_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004531875.1|3100561_3101233_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521950.1|3101607_3102222_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004521949.1|3102330_3103677_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521948.1|3103673_3104459_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004547581.1|3104560_3104926_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	1.5e-52
WP_111963042.1|3105029_3105620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122798709.1|3106015_3106519_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	90.6	2.1e-81
WP_028358682.1|3106515_3106929_-|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	99.2	6.8e-70
WP_123903074.1|3107016_3107544_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	49.2	5.1e-30
WP_100209513.1|3107468_3107984_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	52.5	4.0e-27
WP_004555440.1|3107942_3110240_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_004555439.1|3110296_3111301_-	AAA family ATPase	NA	Q677Q6	Lymphocystis_disease_virus	31.7	2.6e-14
3114495:3114512	attR	GCATCGCGTAGAACGCGG	NA	NA	NA	NA
>prophage 7
NZ_CP038216	Burkholderia pseudomallei strain Yap7 chromosome 1, complete sequence	3932431	3333836	3345065	3932431	integrase	Burkholderia_phage(22.22%)	11	3335109:3335125	3342950:3342966
WP_076859550.1|3333836_3334538_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.5	3.7e-07
3335109:3335125	attL	GGCGCGATCGCGCGGCT	NA	NA	NA	NA
WP_004525721.1|3335381_3335630_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004530408.1|3335786_3336866_-	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_009932249.1|3336865_3337318_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_009932250.1|3337575_3338118_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_004530410.1|3338371_3339289_-	hypothetical protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009922658.1|3339288_3339606_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004533467.1|3339985_3340729_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	47.3	1.9e-54
WP_076804979.1|3340744_3340924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202928.1|3341755_3342655_+	cytochrome c	NA	NA	NA	NA	NA
WP_004524472.1|3342977_3345065_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	35.8	1.9e-99
3342950:3342966	attR	GGCGCGATCGCGCGGCT	NA	NA	NA	NA
>prophage 1
NZ_CP038217	Burkholderia pseudomallei strain Yap7 chromosome 2, complete sequence	3147867	15997	70609	3147867	transposase,plate	Leptospira_phage(16.67%)	42	NA	NA
WP_038802950.1|15997_17118_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_055315292.1|17534_18476_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024429095.1|18572_19910_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_004552203.1|20081_20996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004524799.1|21177_21882_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004190854.1|22374_22551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004205458.1|22599_22917_-	chorismate lyase	NA	NA	NA	NA	NA
WP_071898311.1|22853_23099_-	chorismate lyase	NA	NA	NA	NA	NA
WP_024429094.1|23226_24471_-	flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004544579.1|24735_24921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024429093.1|24939_26838_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_004533164.1|26880_28317_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004190377.1|28371_28773_-	lipoprotein	NA	NA	NA	NA	NA
WP_004190712.1|29411_29930_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004190585.1|29926_31330_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|31345_32662_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004524806.1|32664_36294_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_076891691.1|36299_37196_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004529325.1|37180_37408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122804786.1|37406_39992_+	protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_004524810.1|41185_41764_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|41756_43265_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|43324_43816_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004196148.1|43834_44395_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004553897.1|44399_46271_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_100227576.1|46267_47713_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004533146.1|47725_50392_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_004203275.1|50388_52593_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_076812934.1|52608_53319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050376279.1|53278_54538_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_004552182.1|55269_56055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927050.1|57447_58506_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_076812937.1|58502_58715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131201358.1|59009_59444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935227.1|60278_60917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524825.1|60959_62204_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_004524827.1|62239_63481_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004544732.1|63513_64467_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524829.1|64467_65319_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004546333.1|65323_67495_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004530171.1|67735_69769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524833.1|70201_70609_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.5	3.2e-11
>prophage 2
NZ_CP038217	Burkholderia pseudomallei strain Yap7 chromosome 2, complete sequence	3147867	436613	479918	3147867	integrase,portal,protease,transposase,tRNA	Streptococcus_phage(20.0%)	37	444161:444177	486606:486622
WP_004553592.1|436613_436901_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	1.7e-43
WP_004529037.1|437144_437282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123875335.1|437530_437719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004529035.1|437835_439062_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_009934949.1|439068_439242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934948.1|439240_439504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009926491.1|439428_439605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009934946.1|439940_440432_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004529031.1|441091_441376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190924.1|441527_441797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530319.1|441793_442543_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_076913543.1|442544_445316_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	4.9e-71
444161:444177	attL	CGTGCTGATCGACGGCG	NA	NA	NA	NA
WP_004190401.1|445625_447008_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009950019.1|447333_449127_-	membrane protein	NA	NA	NA	NA	NA
WP_009934941.1|449300_449393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525140.1|449465_449687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190499.1|449846_450722_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004190656.1|450780_451650_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190814.1|451797_452904_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004190549.1|453173_453467_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004525142.1|453463_454348_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004525143.1|454431_456336_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004195713.1|456486_457296_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004538372.1|457414_458878_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004190933.1|459317_461360_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_004549232.1|461418_461757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530325.1|461803_463678_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	2.4e-66
WP_004190948.1|463772_464219_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004190342.1|464385_464598_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004530324.1|464677_465901_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004552017.1|466040_467081_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	2.2e-93
WP_004538372.1|467486_468950_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_025991576.1|469040_469235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935574.1|469597_470320_-|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
WP_009935573.1|470456_470717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058040323.1|471959_478559_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_038802333.1|478798_479918_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
486606:486622	attR	CGTGCTGATCGACGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP038217	Burkholderia pseudomallei strain Yap7 chromosome 2, complete sequence	3147867	1611488	1722427	3147867	integrase,protease,terminase,transposase,tail,plate	Burkholderia_phage(91.49%)	72	1641324:1641343	1712122:1712141
WP_004526384.1|1611488_1612751_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004551638.1|1614621_1615854_-	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_004528257.1|1616273_1616408_-	hypothetical protein	NA	NA	NA	NA	NA
1641324:1641343	attL	CGAGTTGACCGCGCTGTCCG	NA	NA	NA	NA
WP_150977238.1|1662941_1667636_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_009957834.1|1667718_1669377_+	halogenase	NA	NA	NA	NA	NA
WP_004539123.1|1669459_1670902_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	37.5	2.4e-53
WP_151018701.1|1671525_1673445_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004524104.1|1673479_1673893_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004528269.1|1674033_1675227_-	HPP family protein	NA	NA	NA	NA	NA
WP_004524105.1|1675288_1675552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198340.1|1675572_1676544_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038719591.1|1676589_1676952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524106.1|1677095_1678181_-	ionic transporter y4hA	NA	NA	NA	NA	NA
WP_004542782.1|1678908_1679697_+	MarC family protein	NA	NA	NA	NA	NA
WP_004198335.1|1679684_1679840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199327.1|1680043_1680916_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004199325.1|1681127_1681832_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011205503.1|1682007_1683054_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004199295.1|1683730_1683889_+	lipoprotein	NA	NA	NA	NA	NA
WP_004199294.1|1683904_1684426_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	27.1	5.1e-06
WP_004551650.1|1684422_1685247_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_004198481.1|1686340_1686700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017882257.1|1686696_1686924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076886874.1|1686920_1687139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038791906.1|1687258_1687693_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	76.5	2.3e-44
WP_009927864.1|1687706_1688993_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	61.9	6.5e-127
WP_009927863.1|1689004_1689601_-	DUF2313 domain-containing protein	NA	B5TAB0	Burkholderia_phage	61.7	2.0e-59
WP_076949407.1|1689600_1690722_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	70.8	6.9e-149
WP_038724610.1|1690718_1691306_-|tail	tail protein	tail	B5TAA8	Burkholderia_phage	67.7	9.0e-76
WP_100565532.1|1691391_1691886_-|plate	baseplate assembly protein	plate	B5TAA7	Burkholderia_phage	62.0	2.0e-52
WP_009927857.1|1691882_1693049_-	bacteriophage Mu P	NA	B5TAA6	Burkholderia_phage	80.3	8.9e-184
WP_100565531.1|1693052_1694429_-	multidrug DMT transporter	NA	B5TAA5	Burkholderia_phage	74.0	1.2e-192
WP_100565530.1|1694428_1697104_-|tail	phage tail protein	tail	B5TAA4	Burkholderia_phage	60.4	3.0e-203
WP_058040209.1|1697152_1697701_-	hypothetical protein	NA	B5TAA3	Burkholderia_phage	67.9	6.9e-62
WP_038724605.1|1697794_1698166_-	hypothetical protein	NA	B5TAA2	Burkholderia_phage	72.4	1.2e-46
WP_058040208.1|1698212_1699691_-|tail	phage tail protein	tail	B5TAA1	Burkholderia_phage	76.0	6.8e-221
WP_058040207.1|1699737_1700004_-	hypothetical protein	NA	B5TAA0	Burkholderia_phage	63.2	1.4e-15
WP_058040206.1|1699990_1700587_-	DUF1834 family protein	NA	B5TA99	Burkholderia_phage	51.8	7.8e-51
WP_058040205.1|1700586_1701021_-	virion morphogenesis protein	NA	B5TA98	Burkholderia_phage	75.7	1.3e-55
WP_058040204.1|1701017_1701521_-	DUF1320 domain-containing protein	NA	B5TA97	Burkholderia_phage	91.6	2.0e-87
WP_076949414.1|1701517_1701919_-	hypothetical protein	NA	B5TA96	Burkholderia_phage	67.9	8.5e-09
WP_038755861.1|1701992_1702940_-	hypothetical protein	NA	B5TA95	Burkholderia_phage	92.7	9.8e-165
WP_150977234.1|1702995_1703352_-	hypothetical protein	NA	B5TA94	Burkholderia_phage	76.3	7.4e-41
WP_009927838.1|1703396_1704545_-	hypothetical protein	NA	B5TA92	Burkholderia_phage	83.1	9.1e-181
WP_150977232.1|1704760_1705162_-	hypothetical protein	NA	B5TA91	Burkholderia_phage	86.5	1.4e-59
WP_058040201.1|1705158_1705593_-	regulatory protein GemA	NA	B5TA90	Burkholderia_phage	81.7	2.4e-57
WP_009927831.1|1705594_1705906_-	hypothetical protein	NA	B5TA89	Burkholderia_phage	63.6	4.4e-29
WP_058040200.1|1706057_1706375_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	68.3	2.2e-07
WP_058040199.1|1706463_1706736_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	85.6	3.3e-33
WP_058040198.1|1706799_1707192_-	ASCH domain-containing protein	NA	B5TA86	Burkholderia_phage	82.3	8.7e-59
WP_038724592.1|1707205_1707832_-	DUF3164 family protein	NA	B5TA85	Burkholderia_phage	90.4	3.3e-100
WP_058040197.1|1707828_1708416_-	hypothetical protein	NA	B5TA84	Burkholderia_phage	91.8	1.3e-82
WP_038721762.1|1708402_1708708_-	hypothetical protein	NA	B5TA83	Burkholderia_phage	73.3	6.4e-33
WP_038790982.1|1708704_1708893_-	hypothetical protein	NA	B5TA82	Burkholderia_phage	65.5	5.9e-13
WP_009927794.1|1708900_1709893_-	AAA family ATPase	NA	B5TA81	Burkholderia_phage	87.9	1.1e-166
WP_058040196.1|1709902_1711528_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	B5TA80	Burkholderia_phage	95.6	2.0e-303
WP_058040195.1|1711567_1712614_-	hypothetical protein	NA	B5TA79	Burkholderia_phage	77.3	2.4e-135
1712122:1712141	attR	CGGACAGCGCGGTCAACTCG	NA	NA	NA	NA
WP_009927791.1|1712610_1712802_-	DNA-binding protein	NA	B5TA78	Burkholderia_phage	89.3	2.7e-21
WP_038724587.1|1712883_1713369_+	helix-turn-helix transcriptional regulator	NA	B5TA77	Burkholderia_phage	72.0	1.3e-51
WP_038756160.1|1713412_1713946_+	hypothetical protein	NA	B5TA76	Burkholderia_phage	74.6	9.1e-67
WP_009927787.1|1714311_1714794_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_058040194.1|1714790_1715063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038721770.1|1715183_1715495_+	membrane protein	NA	B5TA74	Burkholderia_phage	70.2	4.4e-37
WP_058040193.1|1715491_1716166_+	lytic transglycosylase domain-containing protein	NA	B5TA73	Burkholderia_phage	70.1	6.9e-88
WP_076949408.1|1716162_1716627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038724579.1|1716734_1716956_+	hypothetical protein	NA	B5TA71	Burkholderia_phage	89.0	4.3e-31
WP_009927781.1|1716952_1717243_+	hypothetical protein	NA	B5TA70	Burkholderia_phage	89.6	1.3e-40
WP_038755846.1|1717246_1717744_+	DUF1804 family protein	NA	B5TA69	Burkholderia_phage	93.9	3.5e-81
WP_150977229.1|1717750_1719367_+|terminase	phage terminase large subunit	terminase	B5TA68	Burkholderia_phage	92.8	6.3e-305
WP_058040191.1|1719356_1720889_+	DUF935 family protein	NA	B5TA67	Burkholderia_phage	89.5	2.9e-251
WP_009927776.1|1720933_1721194_+	hypothetical protein	NA	B5TA66	Burkholderia_phage	72.1	1.0e-23
WP_038791867.1|1721194_1722427_+	hypothetical protein	NA	B5TA65	Burkholderia_phage	89.0	6.1e-215
>prophage 4
NZ_CP038217	Burkholderia pseudomallei strain Yap7 chromosome 2, complete sequence	3147867	2720762	2785317	3147867	holin,transposase,plate	Xanthomonas_phage(20.0%)	53	NA	NA
WP_004523686.1|2720762_2721281_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004523687.1|2721282_2723163_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004523688.1|2723159_2724209_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004529651.1|2724227_2725298_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_004529650.1|2725352_2726381_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004531572.1|2726413_2727772_+	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.2	3.4e-110
WP_150977038.1|2727664_2731117_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004523693.1|2731129_2731399_-	PAAR motif protein	NA	NA	NA	NA	NA
WP_122799165.1|2731473_2734119_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	9.2e-35
WP_009932439.1|2734183_2734753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009932436.1|2734942_2738851_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009932435.1|2738865_2740167_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004523698.1|2740163_2741513_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_095413485.1|2741518_2742061_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004529642.1|2742188_2742671_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004523699.1|2742870_2744370_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004523700.1|2744403_2744943_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_076892803.1|2744988_2745186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009932432.1|2745332_2747009_-	OmpA family protein	NA	NA	NA	NA	NA
WP_076892806.1|2747011_2747668_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004529637.1|2747732_2748305_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_076866615.1|2748297_2750931_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025991399.1|2751154_2751892_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004523706.1|2751956_2752502_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004549711.1|2753086_2753641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523708.1|2753651_2753867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004551161.1|2753902_2755390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150977312.1|2755456_2757562_-	hypothetical protein	NA	A0A2C9CZG8	Yersinia_phage	46.1	4.9e-07
WP_076809385.1|2758290_2758755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523712.1|2758766_2758955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151018709.1|2759114_2760572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932423.1|2761201_2761456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932421.1|2761483_2761771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523716.1|2761720_2763316_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	1.9e-06
WP_076892633.1|2763402_2764026_+	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_038735890.1|2764030_2764219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932418.1|2764258_2764573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531587.1|2764611_2765304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531588.1|2765315_2765543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004529617.1|2765474_2765690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523720.1|2765775_2766102_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523721.1|2766121_2766541_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_004524152.1|2766955_2767219_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_150977040.1|2767228_2768764_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_004528499.1|2774254_2774560_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004531014.1|2774669_2775890_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	100.0	1.1e-240
WP_004523726.1|2776515_2777547_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004544882.1|2777543_2778398_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004523728.1|2778384_2779302_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004558008.1|2779763_2780216_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099975938.1|2780179_2781220_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_076805246.1|2782768_2782924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187738.1|2783121_2785317_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
