The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038214	Burkholderia pseudomallei strain Yap6 chromosome 1, complete sequence	3932929	437394	448370	3932929	protease	Streptococcus_phage(16.67%)	11	NA	NA
WP_004197486.1|437394_439509_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_071897722.1|439633_439822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526282.1|439818_440328_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.2e-13
WP_071810810.1|440519_440738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189780.1|441000_441579_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004189552.1|441846_443106_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189626.1|443078_443261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004546221.1|443273_444893_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|445022_445226_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|445758_446073_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|446069_448370_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
>prophage 2
NZ_CP038214	Burkholderia pseudomallei strain Yap6 chromosome 1, complete sequence	3932929	987314	994090	3932929	integrase	Burkholderia_virus(33.33%)	11	985117:985137	1010817:1010837
985117:985137	attL	TCGCGGCGGGCGGCGGCGTGC	NA	NA	NA	NA
WP_004192768.1|987314_988016_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	44.8	9.9e-13
WP_004526695.1|988312_989221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029671251.1|989416_989524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521810.1|989768_990599_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_071810706.1|990907_991336_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.4	4.6e-21
WP_009941993.1|991286_991493_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.7e-16
WP_076846902.1|991513_991852_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	58.0	3.2e-25
WP_076831547.1|992217_992661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038728719.1|992695_993169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038728717.1|993161_993668_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	3.9e-19
WP_076838831.1|993664_994090_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
1010817:1010837	attR	GCACGCCGCCGCCCGCCGCGA	NA	NA	NA	NA
>prophage 3
NZ_CP038214	Burkholderia pseudomallei strain Yap6 chromosome 1, complete sequence	3932929	2045312	2118295	3932929	terminase,integrase,portal,head,capsid,plate,protease,tail,tRNA	uncultured_Caudovirales_phage(26.32%)	94	2089650:2089667	2107338:2107355
WP_009931101.1|2045312_2046782_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_004193249.1|2046825_2047797_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_004205123.1|2047900_2048839_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004192752.1|2048886_2050284_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	1.8e-42
WP_004191389.1|2050572_2051238_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004191635.1|2051294_2051870_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	5.3e-12
WP_004193779.1|2051950_2052442_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	33.3	4.2e-10
WP_004550230.1|2052466_2053267_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_009921276.1|2053335_2053548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193377.1|2053602_2054388_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_014917760.1|2054578_2055493_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004532151.1|2055489_2055741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191664.1|2055784_2056588_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_004527347.1|2056856_2057129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009921282.1|2057157_2057409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009954883.1|2057312_2057528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076809161.1|2057859_2058051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192883.1|2058036_2058264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076853220.1|2058326_2058566_+	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_024430922.1|2058765_2059599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038714120.1|2059595_2060735_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080002259.1|2060995_2061202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534654.1|2061387_2063340_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004534916.1|2063684_2064134_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	68.5	1.8e-47
WP_004534728.1|2064123_2064384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122836968.1|2064691_2065648_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	38.7	1.7e-47
WP_122794587.1|2065622_2065931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534755.1|2067150_2067576_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_004534452.1|2067572_2068082_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	37.7	9.7e-18
WP_076910187.1|2068423_2069023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076812051.1|2069454_2069763_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	62.1	5.0e-25
WP_076819500.1|2069798_2070587_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.6	6.7e-151
WP_038712566.1|2070730_2071276_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	95.0	1.0e-81
WP_050883818.1|2071275_2071818_-	lysozyme	NA	A4JX20	Burkholderia_virus	90.6	1.3e-84
WP_004533694.1|2071810_2072005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122656927.1|2072080_2073133_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	45.8	7.0e-79
WP_004540041.1|2073142_2073349_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
WP_004547832.1|2073323_2074205_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	36.6	1.5e-29
WP_076889983.1|2074213_2076628_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.5	5.2e-69
WP_004552769.1|2076715_2077018_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_004552768.1|2077087_2077591_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	4.3e-42
WP_076900924.1|2077601_2078771_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.9	8.1e-161
WP_009909071.1|2078836_2079289_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	77.7	4.8e-45
WP_004552413.1|2079304_2080768_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.2	1.6e-214
WP_004547894.1|2080755_2081331_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_004547860.1|2081323_2082217_-|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	40.7	6.4e-49
WP_004547840.1|2082213_2082558_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004547866.1|2082554_2082761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122657137.1|2082825_2083506_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
WP_004533675.1|2083508_2084042_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_004539763.1|2084031_2084562_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_004555262.1|2084563_2084854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550216.1|2084857_2085883_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	1.7e-109
WP_004539732.1|2085917_2086262_-|head	head decoration protein	head	NA	NA	NA	NA
WP_004555261.1|2086288_2087389_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.3	7.9e-49
WP_122766286.1|2087385_2088879_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	7.5e-135
WP_004533700.1|2088875_2089082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552756.1|2089092_2091078_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	2.1e-180
2089650:2089667	attL	CGACCGACGCGCGCGGCG	NA	NA	NA	NA
WP_009935700.1|2091040_2091610_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024430516.1|2091705_2091894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123903064.1|2092035_2092344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123903065.1|2092294_2092654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017844234.1|2092814_2093588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150976906.1|2093805_2096298_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	4.7e-97
WP_004555257.1|2096417_2096888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024430956.1|2097018_2097198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555256.1|2097261_2097825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143293908.1|2097883_2098399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555255.1|2098426_2098759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|2098772_2099300_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_085955187.1|2099399_2099579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076840169.1|2099729_2100239_+	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	42.1	3.6e-12
WP_038758334.1|2100183_2100657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|2100789_2101008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004533940.1|2101059_2101395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038758333.1|2101391_2101997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004533966.1|2101993_2102443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150976904.1|2102442_2103759_+	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_004555250.1|2103872_2104202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555249.1|2104210_2104684_+	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_009890227.1|2104692_2104935_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_024430959.1|2104885_2106187_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.7	2.6e-147
WP_137984612.1|2106358_2109031_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
2107338:2107355	attR	CGCCGCGCGCGTCGGTCG	NA	NA	NA	NA
WP_038741765.1|2109017_2110316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524740.1|2110295_2110841_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_076887471.1|2110933_2112097_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_009904701.1|2112153_2112423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550225.1|2112328_2112583_+	lipoprotein	NA	NA	NA	NA	NA
WP_076903200.1|2112823_2113600_-	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	1.5e-09
WP_004544024.1|2113604_2114747_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_004191516.1|2114857_2115760_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_150976902.1|2115804_2116422_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191887.1|2116418_2117621_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004192745.1|2117629_2118295_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 4
NZ_CP038214	Burkholderia pseudomallei strain Yap6 chromosome 1, complete sequence	3932929	2408243	2417131	3932929		Tanapox_virus(16.67%)	9	NA	NA
WP_004547474.1|2408243_2409086_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	5.5e-18
WP_122656575.1|2409428_2410352_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_151018678.1|2410479_2411856_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004550116.1|2412082_2412985_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_076853525.1|2412996_2413323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189725.1|2413335_2413653_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004190173.1|2413724_2414717_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004522359.1|2414775_2415762_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.8	6.7e-15
WP_004522358.1|2415730_2417131_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
>prophage 5
NZ_CP038214	Burkholderia pseudomallei strain Yap6 chromosome 1, complete sequence	3932929	2754312	2763568	3932929		unidentified_phage(16.67%)	7	NA	NA
WP_004522151.1|2754312_2755860_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_009971015.1|2755896_2756424_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004532195.1|2756420_2757104_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194137.1|2757168_2757984_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_058040641.1|2758167_2760186_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.2	7.0e-51
WP_004533593.1|2760219_2761350_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_004194034.1|2761615_2763568_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 6
NZ_CP038214	Burkholderia pseudomallei strain Yap6 chromosome 1, complete sequence	3932929	3048207	3106550	3932929	transposase,integrase,plate,tail,tRNA	Burkholderia_phage(27.27%)	63	3052428:3052445	3109744:3109761
WP_004521984.1|3048207_3049506_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004527811.1|3049572_3050655_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_004534980.1|3050698_3051556_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004186955.1|3051635_3051944_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004521981.1|3051958_3052555_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
3052428:3052445	attL	CCGCGTTCTACGCGATGC	NA	NA	NA	NA
WP_004545630.1|3052839_3053628_+	dioxygenase	NA	NA	NA	NA	NA
WP_004527813.1|3054075_3055677_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|3056110_3056314_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_076841889.1|3056300_3056438_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_150976838.1|3056500_3057763_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_122658173.1|3057886_3058159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198059.1|3058425_3059031_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198060.1|3058992_3059568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004535445.1|3059527_3060811_-	MFS transporter	NA	NA	NA	NA	NA
WP_150976836.1|3060969_3061650_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076808608.1|3061640_3061991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527819.1|3061987_3062611_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004527820.1|3062695_3063598_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004535007.1|3063725_3064862_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075018965.1|3064858_3065074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075018814.1|3065021_3065144_+	aromatic ring-opening dioxygenase LigA	NA	NA	NA	NA	NA
WP_004535015.1|3065218_3066337_-	acyltransferase	NA	NA	NA	NA	NA
WP_150976833.1|3066335_3066815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205258.1|3066774_3067221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527825.1|3067581_3067704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009932025.1|3067747_3067843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038763718.1|3067881_3070047_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_150976831.1|3070004_3070265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071893038.1|3070628_3071027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205259.1|3071069_3071339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|3071441_3071672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004553843.1|3071748_3071931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004521964.1|3071905_3072262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|3072287_3073556_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_076891085.1|3073570_3075832_+	peptidase domain-containing ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	2.3e-10
WP_009932031.1|3075828_3077277_+	TolC family protein	NA	NA	NA	NA	NA
WP_004521961.1|3077261_3077411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555447.1|3077486_3078473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527832.1|3078484_3079450_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_009922418.1|3079467_3079746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024428656.1|3079721_3083615_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004200003.1|3083611_3084601_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004535030.1|3084605_3085538_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004521957.1|3085736_3086858_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004202807.1|3086947_3089617_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.0	3.8e-89
WP_004200010.1|3089650_3090751_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011205262.1|3090714_3092541_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011205263.1|3092632_3093145_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004527837.1|3093172_3093676_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004521953.1|3093748_3095239_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004521952.1|3095255_3095774_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004531875.1|3095810_3096482_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521950.1|3096856_3097471_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004521949.1|3097579_3098926_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521948.1|3098922_3099708_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004547581.1|3099809_3100175_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	1.5e-52
WP_111963042.1|3100278_3100869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122798709.1|3101264_3101768_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	90.6	2.1e-81
WP_028358682.1|3101764_3102178_-|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	99.2	6.8e-70
WP_123903074.1|3102265_3102793_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	49.2	5.1e-30
WP_100209513.1|3102717_3103233_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	52.5	4.0e-27
WP_004555440.1|3103191_3105489_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_004555439.1|3105545_3106550_-	AAA family ATPase	NA	Q677Q6	Lymphocystis_disease_virus	31.7	2.6e-14
3109744:3109761	attR	GCATCGCGTAGAACGCGG	NA	NA	NA	NA
>prophage 7
NZ_CP038214	Burkholderia pseudomallei strain Yap6 chromosome 1, complete sequence	3932929	3329131	3340360	3932929	integrase	Burkholderia_phage(22.22%)	11	3330404:3330420	3338245:3338261
WP_076859550.1|3329131_3329833_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.5	3.7e-07
3330404:3330420	attL	GGCGCGATCGCGCGGCT	NA	NA	NA	NA
WP_004525721.1|3330676_3330925_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004530408.1|3331081_3332161_-	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_009932249.1|3332160_3332613_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_009932250.1|3332870_3333413_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_004530410.1|3333666_3334584_-	hypothetical protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009922658.1|3334583_3334901_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004533467.1|3335280_3336024_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	47.3	1.9e-54
WP_076804979.1|3336039_3336219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202928.1|3337050_3337950_+	cytochrome c	NA	NA	NA	NA	NA
WP_004524472.1|3338272_3340360_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	35.8	1.9e-99
3338245:3338261	attR	GGCGCGATCGCGCGGCT	NA	NA	NA	NA
>prophage 1
NZ_CP038215	Burkholderia pseudomallei strain Yap6 chromosome 2, complete sequence	3171459	400141	443455	3171459	tRNA,portal,transposase,protease,integrase	Streptococcus_phage(20.0%)	37	396338:396356	436576:436594
396338:396356	attL	CGGCCGTCGCGCCGCTCGC	NA	NA	NA	NA
WP_038802333.1|400141_401262_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_058040323.1|401501_408101_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_009935573.1|409343_409604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935574.1|409740_410463_+|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
WP_025991576.1|410825_411020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004538372.1|411110_412574_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004552017.1|412979_414020_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	2.2e-93
WP_004530324.1|414159_415383_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190342.1|415462_415675_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004190948.1|415841_416288_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004530325.1|416382_418257_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	2.4e-66
WP_004549232.1|418303_418642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190933.1|418700_420743_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_004538372.1|421182_422646_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004195713.1|422764_423574_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004525143.1|423724_425629_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004525142.1|425712_426597_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|426593_426887_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|427156_428263_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004190656.1|428410_429280_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|429338_430214_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004525140.1|430373_430595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934941.1|430667_430760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009950019.1|430933_432727_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|433060_434443_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076913543.1|434752_437524_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	4.9e-71
436576:436594	attR	CGGCCGTCGCGCCGCTCGC	NA	NA	NA	NA
WP_004530319.1|437525_438275_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190924.1|438271_438541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529031.1|438692_438977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009934946.1|439636_440128_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_009926491.1|440463_440640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934948.1|440564_440828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934949.1|440826_441000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529035.1|441006_442233_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123875335.1|442349_442538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529037.1|442786_442924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004553592.1|443167_443455_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	1.7e-43
>prophage 2
NZ_CP038215	Burkholderia pseudomallei strain Yap6 chromosome 2, complete sequence	3171459	777952	836209	3171459	transposase,plate	Streptococcus_phage(22.22%)	41	NA	NA
WP_004539275.1|777952_778681_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_004544687.1|778727_778862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076913332.1|778900_780334_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004552566.1|780359_781013_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004539275.1|781193_781922_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_004552499.1|781931_782189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123874560.1|782351_782570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025991558.1|782553_783693_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_025991559.1|783692_785453_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004555168.1|785495_785738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150977081.1|785992_795271_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_076808576.1|795422_795620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533385.1|795620_795884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076859446.1|796475_801107_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_004530178.1|801120_802389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935222.1|802404_804609_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.0	1.7e-42
WP_004529305.1|804576_804792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935223.1|805025_805472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935224.1|805478_805772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935225.1|806626_807226_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_004524853.1|807250_807661_-	RidA family protein	NA	NA	NA	NA	NA
WP_004530174.1|809090_809438_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	4.7e-40
WP_004524833.1|809434_809842_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.5	3.2e-11
WP_004530171.1|810274_812308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004546333.1|812548_814720_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004524829.1|814724_815576_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004544732.1|815576_816530_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524827.1|816562_817804_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004524825.1|817839_819084_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_009935227.1|819126_819765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131201358.1|820599_821034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076812937.1|821328_821541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927050.1|821537_822596_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552182.1|823988_824774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050376279.1|825505_826765_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_076812934.1|826724_827435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|827450_829655_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004533146.1|829651_832318_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_100227576.1|832330_833776_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004553897.1|833772_835644_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|835648_836209_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP038215	Burkholderia pseudomallei strain Yap6 chromosome 2, complete sequence	3171459	1242693	1307249	3171459	transposase,plate,holin	Ralstonia_phage(28.57%)	55	NA	NA
WP_004187738.1|1242693_1244889_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_076805246.1|1245086_1245242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975938.1|1246790_1247831_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004558008.1|1247794_1248247_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085510102.1|1248896_1249625_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004544882.1|1249611_1250466_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004523726.1|1250462_1251494_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004531014.1|1252119_1253340_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	100.0	1.1e-240
WP_004528499.1|1253449_1253755_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_080305612.1|1254083_1256855_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.8	6.8e-89
WP_150977042.1|1256868_1259109_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.4	3.4e-22
WP_150977040.1|1259247_1260783_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_004524152.1|1260792_1261056_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004523721.1|1261470_1261890_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|1261909_1262236_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004529617.1|1262321_1262537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531588.1|1262468_1262696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004531587.1|1262707_1263400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932418.1|1263438_1263753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038735890.1|1263792_1263981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076892633.1|1263985_1264609_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_004523716.1|1264695_1266291_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	1.9e-06
WP_009932421.1|1266240_1266528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932423.1|1266555_1266810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009932424.1|1267439_1268897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523712.1|1269056_1269245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076809385.1|1269256_1269721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150977312.1|1270449_1272555_+	hypothetical protein	NA	A0A2C9CZG8	Yersinia_phage	46.1	4.9e-07
WP_004551161.1|1272621_1274109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523708.1|1274144_1274360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004549711.1|1274370_1274925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523706.1|1275509_1276055_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025991399.1|1276119_1276857_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_076866615.1|1277080_1279714_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004529637.1|1279706_1280279_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_076892806.1|1280343_1281000_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009932432.1|1281002_1282679_+	OmpA family protein	NA	NA	NA	NA	NA
WP_076892803.1|1282825_1283023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523700.1|1283068_1283608_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004523699.1|1283641_1285141_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004529642.1|1285340_1285823_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_095413485.1|1285950_1286493_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004523698.1|1286498_1287848_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009932435.1|1287844_1289146_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_009932436.1|1289160_1293069_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009932439.1|1293258_1293828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122799165.1|1293892_1296538_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	9.2e-35
WP_004523693.1|1296612_1296882_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_150977038.1|1296894_1300347_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_004531572.1|1300239_1301598_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.2	3.4e-110
WP_004529650.1|1301630_1302659_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004529651.1|1302713_1303784_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_004523688.1|1303802_1304852_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004523687.1|1304848_1306729_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004523686.1|1306730_1307249_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP038215	Burkholderia pseudomallei strain Yap6 chromosome 2, complete sequence	3171459	1855558	1927136	3171459	plate,holin	Vibrio_phage(25.0%)	58	NA	NA
WP_004525541.1|1855558_1856326_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004206084.1|1856364_1857366_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004525542.1|1857362_1858136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188272.1|1858132_1858822_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|1859186_1860701_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004525545.1|1862420_1863359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202234.1|1863392_1863941_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004530038.1|1863937_1865449_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|1865592_1866120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190879.1|1866199_1866631_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|1866644_1868507_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|1868503_1869493_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_122648489.1|1869495_1872366_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_050868720.1|1872356_1874648_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|1874813_1877102_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004547074.1|1877105_1879322_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|1879321_1880392_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004530790.1|1880394_1881111_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|1881153_1881543_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|1881548_1882142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525552.1|1882138_1883500_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004530043.1|1883525_1885241_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004525554.1|1885237_1888741_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|1888799_1889159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|1889181_1889607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530793.1|1889831_1890203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009923697.1|1890300_1890474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004528661.1|1890753_1891653_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_076846473.1|1891750_1891879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857650.1|1891886_1893206_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011205597.1|1893202_1894789_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004524284.1|1895029_1896025_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_038724161.1|1896150_1896333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004532078.1|1896329_1897913_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_076883461.1|1897896_1898193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038730208.1|1898405_1899659_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_076882195.1|1899875_1900178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150976984.1|1900172_1901837_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.4	1.2e-56
WP_004530051.1|1901969_1903535_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004530052.1|1903723_1904740_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|1905291_1906491_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|1906668_1907694_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009933096.1|1907863_1908115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523136.1|1908126_1909401_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_004535113.1|1909473_1910445_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|1910595_1911129_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_150977306.1|1911189_1913253_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|1913255_1915181_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004202150.1|1915185_1916358_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|1916354_1917140_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523139.1|1917164_1918433_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530056.1|1918453_1919599_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|1919708_1920572_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530057.1|1920752_1922408_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|1922494_1923370_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_076809203.1|1923513_1924413_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|1924548_1926102_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_076887547.1|1926137_1927136_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 5
NZ_CP038215	Burkholderia pseudomallei strain Yap6 chromosome 2, complete sequence	3171459	2487863	2598816	3171459	terminase,plate,transposase,protease,tail,integrase	Burkholderia_phage(86.0%)	78	2517699:2517718	2588511:2588530
WP_004526384.1|2487863_2489126_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_143293927.1|2489242_2489479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528254.1|2489445_2490618_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004551638.1|2491003_2492236_-	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_004528257.1|2492655_2492790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151038835.1|2492837_2506613_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.5	2.7e-21
WP_151018855.1|2506746_2524161_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	33.2	1.3e-23
2517699:2517718	attL	CGAGTTGACCGCGCTGTCCG	NA	NA	NA	NA
WP_151038837.1|2524157_2539346_+	amino acid adenylation domain-containing protein	NA	D0R7J2	Paenibacillus_phage	45.2	2.7e-86
WP_150977238.1|2539329_2544024_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_009957834.1|2544106_2545765_+	halogenase	NA	NA	NA	NA	NA
WP_004539123.1|2545847_2547290_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	37.5	2.4e-53
WP_151018701.1|2547913_2549833_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004524104.1|2549867_2550281_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004528269.1|2550421_2551615_-	HPP family protein	NA	NA	NA	NA	NA
WP_004524105.1|2551676_2551940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198340.1|2551960_2552932_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038719591.1|2552977_2553340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524106.1|2553483_2554569_-	ionic transporter y4hA	NA	NA	NA	NA	NA
WP_004542782.1|2555296_2556085_+	MarC family protein	NA	NA	NA	NA	NA
WP_004198335.1|2556072_2556228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199327.1|2556431_2557304_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004199325.1|2557515_2558220_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011205503.1|2558395_2559442_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004199295.1|2560118_2560277_+	lipoprotein	NA	NA	NA	NA	NA
WP_004199294.1|2560292_2560814_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	27.1	5.1e-06
WP_004551650.1|2560810_2561635_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_004524113.1|2561703_2562690_+	YceI family protein	NA	NA	NA	NA	NA
WP_004198481.1|2562729_2563089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017882257.1|2563085_2563313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076886874.1|2563309_2563528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038791906.1|2563647_2564082_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	76.5	2.3e-44
WP_009927864.1|2564095_2565382_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	61.9	6.5e-127
WP_009927863.1|2565393_2565990_-	DUF2313 domain-containing protein	NA	B5TAB0	Burkholderia_phage	61.7	2.0e-59
WP_076949407.1|2565989_2567111_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	70.8	6.9e-149
WP_038724610.1|2567107_2567695_-|tail	tail protein	tail	B5TAA8	Burkholderia_phage	67.7	9.0e-76
WP_100565532.1|2567780_2568275_-|plate	baseplate assembly protein	plate	B5TAA7	Burkholderia_phage	62.0	2.0e-52
WP_009927857.1|2568271_2569438_-	bacteriophage Mu P	NA	B5TAA6	Burkholderia_phage	80.3	8.9e-184
WP_100565531.1|2569441_2570818_-	multidrug DMT transporter	NA	B5TAA5	Burkholderia_phage	74.0	1.2e-192
WP_100565530.1|2570817_2573493_-|tail	phage tail protein	tail	B5TAA4	Burkholderia_phage	60.4	3.0e-203
WP_058040209.1|2573541_2574090_-	hypothetical protein	NA	B5TAA3	Burkholderia_phage	67.9	6.9e-62
WP_038724605.1|2574183_2574555_-	hypothetical protein	NA	B5TAA2	Burkholderia_phage	72.4	1.2e-46
WP_058040208.1|2574601_2576080_-|tail	phage tail protein	tail	B5TAA1	Burkholderia_phage	76.0	6.8e-221
WP_058040207.1|2576126_2576393_-	hypothetical protein	NA	B5TAA0	Burkholderia_phage	63.2	1.4e-15
WP_058040206.1|2576379_2576976_-	DUF1834 family protein	NA	B5TA99	Burkholderia_phage	51.8	7.8e-51
WP_058040205.1|2576975_2577410_-	virion morphogenesis protein	NA	B5TA98	Burkholderia_phage	75.7	1.3e-55
WP_058040204.1|2577406_2577910_-	DUF1320 domain-containing protein	NA	B5TA97	Burkholderia_phage	91.6	2.0e-87
WP_076949414.1|2577906_2578308_-	hypothetical protein	NA	B5TA96	Burkholderia_phage	67.9	8.5e-09
WP_038755861.1|2578381_2579329_-	hypothetical protein	NA	B5TA95	Burkholderia_phage	92.7	9.8e-165
WP_150977234.1|2579384_2579741_-	hypothetical protein	NA	B5TA94	Burkholderia_phage	76.3	7.4e-41
WP_009927838.1|2579785_2580934_-	hypothetical protein	NA	B5TA92	Burkholderia_phage	83.1	9.1e-181
WP_150977232.1|2581149_2581551_-	hypothetical protein	NA	B5TA91	Burkholderia_phage	86.5	1.4e-59
WP_058040201.1|2581547_2581982_-	regulatory protein GemA	NA	B5TA90	Burkholderia_phage	81.7	2.4e-57
WP_009927831.1|2581983_2582295_-	hypothetical protein	NA	B5TA89	Burkholderia_phage	63.6	4.4e-29
WP_058040200.1|2582446_2582764_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	68.3	2.2e-07
WP_058040199.1|2582852_2583125_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	85.6	3.3e-33
WP_058040198.1|2583188_2583581_-	ASCH domain-containing protein	NA	B5TA86	Burkholderia_phage	82.3	8.7e-59
WP_038724592.1|2583594_2584221_-	DUF3164 family protein	NA	B5TA85	Burkholderia_phage	90.4	3.3e-100
WP_058040197.1|2584217_2584805_-	hypothetical protein	NA	B5TA84	Burkholderia_phage	91.8	1.3e-82
WP_038721762.1|2584791_2585097_-	hypothetical protein	NA	B5TA83	Burkholderia_phage	73.3	6.4e-33
WP_038790982.1|2585093_2585282_-	hypothetical protein	NA	B5TA82	Burkholderia_phage	65.5	5.9e-13
WP_009927794.1|2585289_2586282_-	AAA family ATPase	NA	B5TA81	Burkholderia_phage	87.9	1.1e-166
WP_058040196.1|2586291_2587917_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	B5TA80	Burkholderia_phage	95.6	2.0e-303
WP_058040195.1|2587956_2589003_-	hypothetical protein	NA	B5TA79	Burkholderia_phage	77.3	2.4e-135
2588511:2588530	attR	CGGACAGCGCGGTCAACTCG	NA	NA	NA	NA
WP_009927791.1|2588999_2589191_-	DNA-binding protein	NA	B5TA78	Burkholderia_phage	89.3	2.7e-21
WP_038724587.1|2589272_2589758_+	helix-turn-helix transcriptional regulator	NA	B5TA77	Burkholderia_phage	72.0	1.3e-51
WP_038756160.1|2589801_2590335_+	hypothetical protein	NA	B5TA76	Burkholderia_phage	74.6	9.1e-67
WP_009927787.1|2590700_2591183_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_058040194.1|2591179_2591452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038721770.1|2591572_2591884_+	membrane protein	NA	B5TA74	Burkholderia_phage	70.2	4.4e-37
WP_058040193.1|2591880_2592555_+	lytic transglycosylase domain-containing protein	NA	B5TA73	Burkholderia_phage	70.1	6.9e-88
WP_076949408.1|2592551_2593016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038724579.1|2593123_2593345_+	hypothetical protein	NA	B5TA71	Burkholderia_phage	89.0	4.3e-31
WP_009927781.1|2593341_2593632_+	hypothetical protein	NA	B5TA70	Burkholderia_phage	89.6	1.3e-40
WP_038755846.1|2593635_2594133_+	DUF1804 family protein	NA	B5TA69	Burkholderia_phage	93.9	3.5e-81
WP_150977229.1|2594139_2595756_+|terminase	phage terminase large subunit	terminase	B5TA68	Burkholderia_phage	92.8	6.3e-305
WP_058040191.1|2595745_2597278_+	DUF935 family protein	NA	B5TA67	Burkholderia_phage	89.5	2.9e-251
WP_009927776.1|2597322_2597583_+	hypothetical protein	NA	B5TA66	Burkholderia_phage	72.1	1.0e-23
WP_038791867.1|2597583_2598816_+	hypothetical protein	NA	B5TA65	Burkholderia_phage	89.0	6.1e-215
