The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031607	Xanthomonas hortorum strain VT106 chromosome, complete genome	5101806	2089402	2099304	5101806	tRNA	Moraxella_phage(16.67%)	7	NA	NA
WP_006453298.1|2089402_2091079_+	2-polyprenylphenol 6-hydroxylase	NA	A0A0R6PKQ6	Moraxella_phage	30.2	8.4e-42
WP_006453297.1|2091188_2091830_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	1.8e-13
WP_006453296.1|2092002_2093037_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.1e-113
WP_006453295.1|2093320_2093809_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_006453294.1|2093909_2096558_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.1	6.3e-84
WP_003481884.1|2096697_2096910_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_074058838.1|2097330_2099304_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.1	3.3e-13
>prophage 2
NZ_CP031607	Xanthomonas hortorum strain VT106 chromosome, complete genome	5101806	3153293	3216735	5101806	transposase,tRNA,protease	Staphylococcus_prophage(16.67%)	49	NA	NA
WP_154844751.1|3153293_3154250_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.3	1.4e-38
WP_006450572.1|3154589_3155018_-	group 1 truncated hemoglobin	NA	NA	NA	NA	NA
WP_074057130.1|3155017_3155893_-	DUF3034 family protein	NA	NA	NA	NA	NA
WP_074057129.1|3155889_3158274_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_074057128.1|3158270_3158960_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_074057127.1|3159165_3160104_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_074057126.1|3160229_3161579_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_074057125.1|3161706_3162591_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_046933005.1|3163046_3163853_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_074057124.1|3163891_3164101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154844752.1|3164100_3165318_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_074057122.1|3165426_3166401_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.5	1.2e-08
WP_074057121.1|3166521_3167190_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_074057120.1|3167186_3167960_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_046933010.1|3168132_3168540_-	VOC family protein	NA	NA	NA	NA	NA
WP_081376526.1|3168536_3170561_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_074057118.1|3170672_3171698_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_074057117.1|3171784_3172873_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.8	1.1e-15
WP_074057116.1|3172865_3173969_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	39.9	2.3e-72
WP_095574848.1|3173958_3174447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006450475.1|3174436_3175363_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006450476.1|3175443_3176094_+	SCO family protein	NA	NA	NA	NA	NA
WP_074057114.1|3176090_3176939_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006450478.1|3177312_3178896_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	3.2e-11
WP_154844753.1|3179189_3180695_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.5	8.8e-83
WP_074057112.1|3180725_3181277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056307.1|3181764_3182979_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	34.0	2.3e-57
WP_074057111.1|3183921_3185196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154844754.1|3185213_3185456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154844755.1|3185959_3186391_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043908272.1|3186457_3187006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074057110.1|3188131_3190222_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_095574850.1|3190367_3191319_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.1	2.0e-96
WP_074057109.1|3191547_3191733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154845069.1|3192009_3193227_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_074058776.1|3193580_3194087_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_006452349.1|3194208_3195582_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_006452350.1|3195764_3196427_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_006452351.1|3196423_3196876_+	HIT family protein	NA	NA	NA	NA	NA
WP_006452352.1|3196903_3197071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074057108.1|3197417_3197609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006452354.1|3197634_3198204_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.6	3.1e-73
WP_074057107.1|3198300_3199152_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_043910464.1|3199489_3202480_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.4	7.0e-15
WP_095574853.1|3202856_3205940_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_154844756.1|3206140_3207097_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.3	4.5e-40
WP_095575309.1|3209023_3211165_+	peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.0	5.4e-70
WP_154844757.1|3213802_3215815_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_043889734.1|3216039_3216735_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP031607	Xanthomonas hortorum strain VT106 chromosome, complete genome	5101806	3673048	3693457	5101806	transposase,protease	Leptospira_phage(25.0%)	20	NA	NA
WP_074056887.1|3673048_3673855_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_074056886.1|3674011_3674293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056885.1|3674243_3675050_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095574670.1|3676132_3677241_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	5.0e-43
WP_074056884.1|3677359_3677629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095575325.1|3677625_3677922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056882.1|3678222_3681306_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_074056881.1|3681313_3681901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154844810.1|3681897_3682569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056880.1|3682565_3683645_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	38.9	7.3e-55
WP_074056879.1|3683641_3685828_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	25.5	1.5e-35
WP_074056878.1|3685900_3686791_-	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_074056877.1|3686831_3687140_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_074056876.1|3687146_3687410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056875.1|3687790_3688321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056874.1|3688522_3689815_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	37.6	8.4e-74
WP_081376439.1|3690242_3690440_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_074056873.1|3690557_3691022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_023902980.1|3691454_3692318_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_074056872.1|3692314_3693457_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 4
NZ_CP031607	Xanthomonas hortorum strain VT106 chromosome, complete genome	5101806	3748256	3831473	5101806	integrase,plate,transposase,portal,tail,terminase,capsid,head,holin,protease	Stenotrophomonas_phage(47.62%)	97	3792079:3792131	3833073:3833125
WP_154844824.1|3748256_3749744_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_154844825.1|3749866_3750862_-	Abi family protein	NA	A3QSC6	Clostridium_virus	28.7	1.6e-24
WP_095575210.1|3751683_3752791_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	1.3e-43
WP_154844826.1|3752729_3753173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154844827.1|3753176_3754955_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_154844828.1|3755384_3755627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154844829.1|3755834_3757445_-	plasmid mobilization protein	NA	NA	NA	NA	NA
WP_154845079.1|3757984_3758680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154844830.1|3758754_3759519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154845080.1|3759479_3759884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154844831.1|3760359_3761448_-	Fic family protein	NA	NA	NA	NA	NA
WP_154844832.1|3762011_3762752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154844833.1|3762792_3763143_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154844834.1|3763249_3763570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154844835.1|3763583_3763898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154844836.1|3764089_3764314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116890403.1|3764411_3764603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154844837.1|3764786_3766124_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_154844838.1|3766151_3766556_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_154844839.1|3766624_3767065_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_154844840.1|3767064_3767898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154844841.1|3767934_3768444_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_154844842.1|3768462_3769167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056848.1|3769761_3770211_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_074056847.1|3770207_3770453_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_074056846.1|3770449_3770947_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_074056845.1|3771023_3772058_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_074056844.1|3772057_3772807_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	25.6	1.6e-08
WP_006448434.1|3772806_3773556_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_006448435.1|3773576_3774626_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_104550703.1|3774731_3775136_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	37.3	5.0e-17
WP_006450178.1|3775525_3776230_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_154844843.1|3776226_3776961_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	41.6	5.1e-36
WP_023902882.1|3776973_3777426_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	56.1	4.2e-41
WP_006450175.1|3777457_3778114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056839.1|3778126_3778894_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_074056838.1|3778890_3780069_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_074058747.1|3780516_3782487_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_006451749.1|3783014_3783287_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	3.8e-21
WP_006451748.1|3783501_3785973_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.8	5.4e-223
WP_006451747.1|3786117_3787404_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.6	1.5e-136
WP_023902875.1|3787528_3788155_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.7e-56
WP_006451745.1|3788228_3789524_-	trigger factor	NA	NA	NA	NA	NA
WP_074056837.1|3790099_3791395_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_074056836.1|3791399_3791858_-	hypothetical protein	NA	NA	NA	NA	NA
3792079:3792131	attL	TTTTATTTGGTGGGCCGTCAAGGATTCGAACCTTGGACCTATTGATTAAGAGT	NA	NA	NA	NA
WP_081376522.1|3792267_3792513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574912.1|3793576_3794233_+	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_095574913.1|3794552_3798296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376437.1|3798234_3798972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574914.1|3799007_3799718_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.6	4.5e-106
WP_010364016.1|3799635_3799881_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	52.5	1.8e-14
WP_074056833.1|3799906_3800929_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.8	3.1e-140
WP_095574915.1|3800928_3802713_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.3	9.5e-270
WP_095574916.1|3802834_3803677_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.6	9.9e-68
WP_154844844.1|3803723_3804740_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.8	1.4e-137
WP_074056829.1|3804743_3805463_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.8	1.7e-68
WP_074056828.1|3805561_3806029_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	51.0	5.7e-33
WP_005917735.1|3806028_3806238_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_074056827.1|3806587_3806863_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	58.6	1.5e-20
WP_095574918.1|3806859_3807501_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	61.5	1.8e-48
WP_074056825.1|3807500_3807989_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	53.1	5.8e-28
WP_074056824.1|3807985_3808405_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.4	2.0e-40
WP_074056823.1|3808392_3808839_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.1	1.4e-36
WP_074056822.1|3809047_3809473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056821.1|3809853_3810291_+	phosphotransferase	NA	NA	NA	NA	NA
WP_095574920.1|3810450_3811341_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	52.4	1.7e-81
WP_074056819.1|3811333_3811882_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	53.1	6.1e-50
WP_095574921.1|3811885_3813091_+|tail	phage tail protein	tail	E5FFH1	Burkholderia_phage	41.5	2.8e-31
WP_074056817.1|3813092_3813320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056816.1|3813398_3813962_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	48.1	9.7e-27
WP_074056815.1|3813958_3814318_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	4.3e-36
WP_074056814.1|3814329_3815496_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.9	4.5e-135
WP_006450505.1|3815526_3816036_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	77.5	2.2e-70
WP_057672078.1|3816081_3816384_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	68.6	6.3e-25
WP_005922203.1|3816392_3816506_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_095574922.1|3816535_3819406_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	50.3	8.0e-210
WP_074056812.1|3819418_3819820_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	59.1	7.4e-37
WP_095574923.1|3819816_3820806_+	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	53.9	1.7e-90
WP_074056811.1|3820927_3821299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154844845.1|3821390_3821981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056810.1|3822204_3822633_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	37.0	1.6e-13
WP_074056809.1|3822699_3822954_+	DNA-binding protein	NA	A0A1B0VRL1	Pseudomonas_phage	46.7	2.2e-07
WP_074056808.1|3822960_3823272_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.0	8.5e-25
WP_011038117.1|3823449_3823575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011038118.1|3823571_3823811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154845081.1|3823838_3826502_+	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.6	0.0e+00
WP_074056805.1|3826813_3827032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575329.1|3827082_3827307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851182.1|3827303_3827567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056803.1|3827645_3828056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056802.1|3828217_3828493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056801.1|3828489_3828735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056800.1|3828731_3829004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056799.1|3829000_3829207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056798.1|3829203_3829425_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	56.9	4.2e-18
WP_095575330.1|3829649_3830606_+|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.9	2.3e-92
WP_095574585.1|3830709_3831473_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3833073:3833125	attR	TTTTATTTGGTGGGCCGTCAAGGATTCGAACCTTGGACCTATTGATTAAGAGT	NA	NA	NA	NA
>prophage 5
NZ_CP031607	Xanthomonas hortorum strain VT106 chromosome, complete genome	5101806	4240065	4246438	5101806		Escherichia_phage(33.33%)	6	NA	NA
WP_154844897.1|4240065_4241412_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	5.7e-33
WP_074056633.1|4241457_4242861_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	7.2e-47
WP_154844898.1|4242982_4243891_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	34.3	5.8e-29
WP_006449668.1|4243887_4244445_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.6	4.1e-46
WP_074056631.1|4244441_4245329_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.8	1.7e-94
WP_074056630.1|4245382_4246438_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.7	1.8e-82
>prophage 6
NZ_CP031607	Xanthomonas hortorum strain VT106 chromosome, complete genome	5101806	5024987	5034165	5101806		Escherichia_phage(33.33%)	6	NA	NA
WP_074058683.1|5024987_5025731_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.4	1.5e-06
WP_055829449.1|5025853_5026144_-	HigA family addiction module antidote protein	NA	A0A076G6J7	Escherichia_phage	34.3	2.8e-06
WP_074058684.1|5026161_5026443_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	42.6	1.2e-09
WP_074058685.1|5026657_5027713_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	50.6	6.4e-88
WP_154845001.1|5027851_5030095_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.4	1.3e-08
WP_154845002.1|5030091_5034165_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	20.9	3.5e-09
