The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	0	110529	4925831	protease,transposase,portal,head,coat,integrase,tail,terminase,plate,lysis	Salmonella_phage(51.32%)	128	5635:5650	113017:113032
WP_000671495.1|505_1963_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_015975193.1|2021_4025_-|tail	tailspike protein	tail	A0A192Y6X2	Salmonella_phage	100.0	0.0e+00
WP_015975192.1|4235_5138_-	phage antirepressor Ant	NA	A0A192Y6V0	Salmonella_phage	100.0	8.5e-174
WP_015975191.1|5206_5368_-	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	100.0	1.2e-22
WP_015975190.1|5458_5710_+	Arc family DNA-binding protein	NA	A0A192Y840	Salmonella_phage	100.0	9.9e-40
5635:5650	attL	CGCTGATGAGCAGTCA	NA	NA	NA	NA
WP_015975201.1|5809_5989_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	100.0	6.2e-28
WP_000757526.1|6002_6368_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_015975200.1|6398_6893_+	hypothetical protein	NA	A8CGD7	Salmonella_phage	100.0	3.8e-83
WP_015975199.1|6915_8745_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	100.0	0.0e+00
WP_015975198.1|8744_10160_-	injection protein	NA	A0A192Y834	Salmonella_phage	100.0	6.2e-248
WP_015975197.1|10170_10860_-	hypothetical protein	NA	A0A192Y6A3	Salmonella_phage	100.0	1.9e-117
WP_000627697.1|10862_11318_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000774927.1|11317_12019_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_001122424.1|12022_13441_-	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_015975196.1|13400_13901_-|head	head completion protein	head	A0A192Y830	Salmonella_phage	100.0	3.2e-90
WP_000684729.1|13884_14094_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001196938.1|14132_15425_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000433852.1|15424_16336_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_015975195.1|16349_18527_-|portal	portal protein	portal	A0A192Y922	Salmonella_phage	100.0	0.0e+00
WP_015975189.1|18526_20026_-|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	100.0	4.8e-307
WP_000729925.1|20003_20492_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_001278047.1|20515_20695_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000807785.1|20696_20939_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001177703.1|21241_21928_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_001682204.1|21914_22106_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	95.2	1.1e-27
WP_001531485.1|22140_22578_-|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_000074137.1|22666_23164_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_000286100.1|23141_23345_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_015675486.1|23484_23694_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	100.0	6.7e-34
WP_001235453.1|23783_24407_-	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000219131.1|24403_24583_-	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_000149925.1|24563_24767_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000036317.1|24763_24988_-	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_001129733.1|24984_25596_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000950959.1|25588_25765_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001531428.1|25757_26090_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000113772.1|26092_26269_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|26235_26409_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000736921.1|26405_26843_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_001248406.1|26916_28293_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000067075.1|28289_29105_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|29097_29244_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424167.1|29278_29557_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000276884.1|29663_29849_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|29929_30580_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000216175.1|30933_31236_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001682202.1|31256_31835_-	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000213983.1|32049_32244_+	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_000651935.1|32280_32517_+	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_001737461.1|32516_32720_+	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000776964.1|32867_33179_+	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_000582314.1|33264_33423_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000158027.1|33403_33592_+	hypothetical protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000031375.1|33721_34339_+	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001253481.1|34338_34623_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	97.9	2.6e-44
WP_015975204.1|34669_34963_+	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	100.0	1.9e-50
WP_001214434.1|34973_35144_+	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	100.0	3.5e-25
WP_015975203.1|35131_35629_+	hypothetical protein	NA	A0A0N6WGF1	Salmonella_phage	99.4	2.3e-88
WP_015975202.1|35737_36097_+	hypothetical protein	NA	T1SA95	Salmonella_phage	100.0	4.0e-66
WP_023170976.1|36093_36687_+	ead/Ea22-like family protein	NA	A0A2H4A316	Salmonella_phage	99.5	7.9e-104
WP_024152293.1|36689_36878_+	hypothetical protein	NA	A0A075B8E3	Enterobacteria_phage	100.0	2.7e-26
WP_000208022.1|36881_37835_+	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	100.0	1.9e-171
WP_001277764.1|37931_38111_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_000016640.1|38211_38847_+	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_000051900.1|39076_40240_+|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000893231.1|40445_41696_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|41707_42811_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|43093_44146_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_000174696.1|44196_44598_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189588.1|44655_45900_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001292018.1|45988_46447_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292977.1|46695_48153_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602086.1|48308_48923_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001226198.1|50270_51326_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001225658.1|51575_52316_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333387.1|52286_53054_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284051.1|53266_53845_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
WP_000973041.1|54084_56529_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000015789.1|56637_57405_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000788200.1|57775_58183_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_000787603.1|58513_59233_+	adhesin/invasin protein PagN	NA	NA	NA	NA	NA
WP_001575654.1|59236_59452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023173520.1|59568_60516_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001550229.1|60990_61251_-	transcriptional activator PerC	NA	NA	NA	NA	NA
WP_000119390.1|61330_62152_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000266939.1|62557_63028_-	pilin structural protein SafD	NA	NA	NA	NA	NA
WP_000669635.1|63049_65560_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001535430.1|65583_66321_-	pili assembly chaperone PapD	NA	NA	NA	NA	NA
WP_077905298.1|66404_66917_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_001738030.1|68423_68672_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_010988969.1|68773_69082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088131292.1|69164_69338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994224.1|69522_69798_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_000943619.1|69850_70288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935097.1|70850_71297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106746824.1|71290_72169_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	51.8	2.3e-27
WP_000932531.1|72223_72487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272656.1|72480_76575_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.5	2.3e-24
WP_000375832.1|76593_77040_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_000011534.1|77063_79253_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000968384.1|79649_80171_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_001596567.1|80194_80611_-	DUF2195 family protein	NA	NA	NA	NA	NA
WP_001254137.1|80607_81396_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_001168956.1|81395_85265_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000227044.1|85298_85730_-	Shiga toxin A subunit	NA	NA	NA	NA	NA
WP_000976553.1|85932_86706_-	membrane protein	NA	NA	NA	NA	NA
WP_000132483.1|86710_88015_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000118732.1|88011_89355_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007106.1|89358_89895_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119444.1|89961_90435_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379146.1|90577_90961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081550.1|90945_91431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312802.1|91735_92221_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_014344502.1|92474_92807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|93545_94754_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000996817.1|95976_96519_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000449778.1|96618_99258_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.1e-77
WP_000806681.1|99625_100528_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750535.1|100514_101339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108007.1|101335_101830_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371508.1|101845_103729_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145244.1|103725_104721_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367626.1|104731_105787_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|106318_107050_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|107113_107581_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|107577_108300_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052775.1|108334_109090_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|109161_110529_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
113017:113032	attR	TGACTGCTCATCAGCG	NA	NA	NA	NA
>prophage 2
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	114578	115382	4925831		Indivirus(100.0%)	1	NA	NA
WP_000154871.1|114578_115382_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.1e-38
>prophage 3
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	122398	123430	4925831		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594021.1|122398_123430_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 4
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	136503	142231	4925831	transposase	Saccharomonospora_phage(66.67%)	4	NA	NA
WP_000502119.1|136503_136962_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000055753.1|137156_138116_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294826.1|138128_141611_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569412.1|141634_142231_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
>prophage 5
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	151045	151804	4925831		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000947413.1|151045_151804_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 6
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	165239	166667	4925831	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753958.1|165239_166667_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
>prophage 7
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	170650	170995	4925831		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001278668.1|170650_170995_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 8
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	184385	185183	4925831		Planktothrix_phage(100.0%)	1	NA	NA
WP_001157204.1|184385_185183_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	2.7e-14
>prophage 9
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	190376	192851	4925831		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_072208425.1|190376_192851_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	1.6e-33
>prophage 10
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	195867	197286	4925831		unidentified_phage(100.0%)	1	NA	NA
WP_000174614.1|195867_197286_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.1e-26
>prophage 11
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	208051	217755	4925831		Anomala_cuprea_entomopoxvirus(25.0%)	9	NA	NA
WP_000150619.1|208051_208978_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
WP_000651591.1|209086_209749_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683342.1|209806_210343_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
WP_000829731.1|210548_212939_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000946047.1|213016_214627_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	59.8	3.0e-20
WP_000846613.1|214828_215176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829968.1|215282_216143_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000734276.1|216163_216958_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000678254.1|216987_217755_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
>prophage 12
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	228727	230152	4925831		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001519338.1|228727_230152_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 13
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	241193	241757	4925831		Sphingobium_phage(100.0%)	1	NA	NA
WP_000936329.1|241193_241757_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
>prophage 14
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	246014	247058	4925831		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217365.1|246014_247058_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	3.4e-102
>prophage 15
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	277372	278944	4925831		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000082819.1|277372_278944_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 16
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	286993	287701	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_000915965.1|286993_287701_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	8.2e-23
>prophage 17
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	295677	301109	4925831		Lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_000035723.1|295677_298029_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	2.5e-15
WP_001116976.1|298202_301109_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.9e-21
>prophage 18
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	308838	315152	4925831		Enterococcus_phage(33.33%)	5	NA	NA
WP_000257211.1|308838_309687_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	5.8e-07
WP_000624379.1|309792_310272_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
WP_000377155.1|310470_312333_-	glutathione-regulated potassium-efflux system protein KefC	NA	NA	NA	NA	NA
WP_000600709.1|312325_312856_-	glutathione-regulated potassium-efflux system oxidoreductase KefF	NA	NA	NA	NA	NA
WP_000066317.1|313262_315152_-	sulfatase	NA	A0A1V0SA98	Catovirus	24.7	5.0e-27
>prophage 19
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	322907	328547	4925831		Vibrio_phage(50.0%)	4	NA	NA
WP_000787073.1|322907_324425_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
WP_000347134.1|324459_325602_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001016212.1|325713_326931_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000355806.1|326993_328547_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.4	9.8e-29
>prophage 20
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	334082	335231	4925831		Halovirus(100.0%)	1	NA	NA
WP_000597287.1|334082_335231_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.0e-50
>prophage 21
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	354416	357251	4925831	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001670710.1|354416_357251_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	6.5e-79
>prophage 22
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	363749	364916	4925831		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000681340.1|363749_364916_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 23
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	369481	370975	4925831		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000831880.1|369481_370975_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	30.6	9.1e-32
>prophage 24
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	391139	404779	4925831	transposase	Plodia_interpunctella_granulovirus(16.67%)	12	NA	NA
WP_000235798.1|391139_393239_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	9.5e-35
WP_000860682.1|393619_394063_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001068132.1|394079_394613_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
WP_000026889.1|394673_395018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|395652_396861_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001119009.1|397709_398849_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
WP_000516125.1|398934_400851_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.1	1.2e-148
WP_001258094.1|401198_401603_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001103477.1|401638_402352_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528527.1|402501_403068_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_000380372.1|403124_403715_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130175.1|403825_404779_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
>prophage 25
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	423529	424954	4925831		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_001219526.1|423529_424954_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	7.9e-09
>prophage 26
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	428903	434067	4925831		Bacillus_phage(33.33%)	3	NA	NA
WP_000373268.1|428903_430841_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
WP_000046770.1|431049_432717_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
WP_000093829.1|432834_434067_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.5	6.7e-89
>prophage 27
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	446219	447542	4925831		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477838.1|446219_447542_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.8e-79
>prophage 28
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	453089	455988	4925831		Salmonella_phage(50.0%)	3	NA	NA
WP_000490276.1|453089_453251_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-10
WP_000178963.1|453379_453997_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175965.1|454398_455988_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
>prophage 29
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	459764	460829	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_000211207.1|459764_460829_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	4.2e-15
>prophage 30
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	465803	467083	4925831		Salmonella_phage(50.0%)	2	NA	NA
WP_000098578.1|465803_466343_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
WP_000799924.1|466345_467083_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.2e-64
>prophage 31
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	471337	472399	4925831		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_000075429.1|471337_472399_-	SIS domain-containing protein	NA	J3IZE6	Acanthamoeba_polyphaga_lentillevirus	23.8	2.7e-09
>prophage 32
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	478131	479793	4925831		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_079822921.1|478131_479793_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 33
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	485606	489116	4925831		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001043484.1|485606_489116_+	type I restriction-modification system endonuclease	NA	S0A182	Cellulophaga_phage	34.8	1.1e-06
>prophage 34
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	507412	508621	4925831	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|507412_508621_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 35
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	527948	529040	4925831		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001526178.1|527948_529040_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	27.3	1.8e-05
>prophage 36
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	540422	541442	4925831		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_079822907.1|540422_541442_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	8.7e-42
>prophage 37
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	549251	554198	4925831	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
WP_000397158.1|549251_550763_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
WP_000207090.1|550860_551343_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416329.1|551342_554198_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	3.5e-141
>prophage 38
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	566305	572854	4925831	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	7	NA	NA
WP_000013055.1|566305_567241_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
WP_000148570.1|567253_567715_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047544.1|567791_568178_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000252550.1|568252_568699_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738655.1|568814_571523_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.6	5.9e-45
WP_105789234.1|571663_571762_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181297.1|571906_572854_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
>prophage 39
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	576519	579763	4925831		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000187818.1|576519_578658_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	1.5e-266
WP_001268859.1|578778_579243_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.8	4.6e-51
WP_000220578.1|579246_579531_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	70.2	8.6e-32
WP_000212724.1|579520_579763_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
>prophage 40
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	614716	616472	4925831		Klosneuvirus(50.0%)	2	NA	NA
WP_000853764.1|614716_615715_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
WP_000055079.1|615941_616472_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
>prophage 41
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	651683	652847	4925831		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943933.1|651683_652847_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.0	2.0e-82
>prophage 42
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	657710	662117	4925831		Lactococcus_phage(50.0%)	3	NA	NA
WP_000076357.1|657710_660149_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	9.9e-68
WP_001177632.1|660186_660612_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527972.1|660818_662117_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	4.9e-66
>prophage 43
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	667662	670848	4925831		Wolbachia_phage(50.0%)	2	NA	NA
WP_001122537.1|667662_669519_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
WP_000640362.1|669528_670848_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
>prophage 44
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	675869	676415	4925831		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001271546.1|675869_676415_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 45
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	684139	685117	4925831		Tupanvirus(100.0%)	1	NA	NA
WP_000004794.1|684139_685117_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
>prophage 46
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	688844	689378	4925831		Morganella_phage(100.0%)	1	NA	NA
WP_001238396.1|688844_689378_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	9.4e-48
>prophage 47
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	694454	696438	4925831		Vibrio_phage(50.0%)	2	NA	NA
WP_000729126.1|694454_696101_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
WP_000027827.1|696144_696438_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 48
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	711337	711796	4925831	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502119.1|711337_711796_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 49
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	714827	719332	4925831		Escherichia_phage(100.0%)	4	NA	NA
WP_001112218.1|714827_715481_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	72.4	2.3e-80
WP_000544929.1|715496_716270_-	dimethyl sulfoxide reductase subunit C	NA	A0A077SK59	Escherichia_phage	79.8	4.6e-104
WP_000816143.1|716262_716889_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
WP_000403482.1|716902_719332_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	81.4	0.0e+00
>prophage 50
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	737502	745862	4925831		Bacillus_phage(25.0%)	8	NA	NA
WP_001212189.1|737502_738573_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
WP_000844399.1|738580_738670_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_000919710.1|738739_740242_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
WP_000056482.1|740709_741045_+	phnA family protein	NA	NA	NA	NA	NA
WP_001131299.1|741164_741608_+	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
WP_000602437.1|741729_742194_+	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_000457024.1|742451_743360_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	36.6	1.7e-33
WP_011233236.1|743714_745862_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.5	1.0e-31
>prophage 51
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	755539	757498	4925831		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000083882.1|755539_757498_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	2.2e-89
>prophage 52
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	763716	765066	4925831		Moraxella_phage(100.0%)	1	NA	NA
WP_000106907.1|763716_765066_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 53
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	769951	772018	4925831		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000358566.1|769951_772018_-	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	6.3e-15
>prophage 54
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	794394	797998	4925831		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168322.1|794394_794925_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
WP_000357724.1|795172_797998_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
>prophage 55
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	802093	849021	4925831	tail,plate,tRNA	Burkholderia_phage(40.91%)	49	NA	NA
WP_001147297.1|802093_803173_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
WP_000918353.1|803204_804620_-	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235551.1|804684_805668_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891414.1|805842_806085_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_001182237.1|806252_807251_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|807338_808649_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|808895_809411_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|809509_809719_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|809740_809854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|809850_811176_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|811354_811963_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|812071_812440_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017369.1|812610_815031_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|815129_816002_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|816015_816513_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|816692_817610_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|817773_819132_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|819220_820330_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|820691_821882_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|822013_823558_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|823572_824463_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|824628_825039_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|825181_827278_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|827277_828015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742863.1|828011_828680_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|828713_828956_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|829399_831049_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|831393_832743_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|832875_833223_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|833798_834086_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|834088_834694_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|834706_835021_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|835180_835636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|835632_835830_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|835819_837247_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|837246_837771_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|837822_838140_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|838099_838228_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|838324_840679_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|840678_841632_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|841631_841841_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|841828_842872_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|842881_843604_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|843931_844294_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|844290_845220_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|845219_846767_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|846930_847290_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|847280_848396_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|848388_849021_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
>prophage 56
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	852565	853294	4925831		Escherichia_phage(100.0%)	1	NA	NA
WP_000587738.1|852565_853294_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 57
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	859189	862873	4925831		Dickeya_phage(100.0%)	1	NA	NA
WP_000095958.1|859189_862873_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 58
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	877056	878646	4925831		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187509.1|877056_878646_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	6.5e-68
>prophage 59
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	884126	885889	4925831		Bacillus_phage(50.0%)	3	NA	NA
WP_001044509.1|884126_884399_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
WP_000940092.1|884585_885176_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362359.1|885217_885889_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.1e-20
>prophage 60
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	896870	905199	4925831		Vibrio_phage(50.0%)	2	NA	NA
WP_000653965.1|896870_901094_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
WP_000263106.1|901170_905199_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 61
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	909319	912413	4925831		Tupanvirus(50.0%)	3	NA	NA
WP_000031748.1|909319_910504_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_001541267.1|911080_911254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023069.1|911462_912413_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	6.0e-29
>prophage 62
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	921150	922995	4925831		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591398.1|921150_922995_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
>prophage 63
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	944112	947287	4925831		Hokovirus(50.0%)	2	NA	NA
WP_001128495.1|944112_946614_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	3.6e-12
WP_000424866.1|946624_947287_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
>prophage 64
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	970082	1035302	4925831	protease,head,portal,capsid,tail,terminase,integrase,holin,plate,lysis	Escherichia_phage(40.0%)	77	999940:999986	1030677:1030723
WP_000208240.1|970082_970613_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|970622_971954_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139639.1|972020_972950_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|973042_973528_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|973749_973989_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|974387_975233_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136806.1|975253_976762_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250625.1|976873_977884_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796300.1|977980_978727_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155237.1|978833_979262_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|979362_979959_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|980071_980839_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088049.1|980930_981695_-	epimerase	NA	NA	NA	NA	NA
WP_001738619.1|981704_981995_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774147.1|982077_982953_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|982981_984004_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|984032_985034_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911134.1|985030_986074_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167250.1|986067_987603_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283048.1|987858_988818_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|988905_990498_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|990511_990862_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000621104.1|990951_991083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000061008.1|991098_991263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519915.1|991360_992083_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557889.1|992145_993186_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646499.1|993195_994155_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777317.1|994165_995500_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750761.1|995762_996518_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|996618_997608_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|997811_998774_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|998958_999861_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
999940:999986	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|1000097_1000316_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882949.1|1000397_1001561_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000978885.1|1001560_1002040_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_023223134.1|1002054_1004502_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.8	0.0e+00
WP_000785970.1|1004494_1004614_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1004646_1004922_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001286720.1|1005508_1006699_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
WP_010835363.1|1006758_1007352_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
WP_022631136.1|1008158_1008692_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_010835343.1|1008696_1009314_-|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_079936730.1|1009283_1010750_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	84.6	1.1e-143
WP_001285338.1|1010746_1011358_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_001121478.1|1011350_1012259_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_000127163.1|1012263_1012611_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093737.1|1012607_1013243_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
WP_001001780.1|1013309_1013762_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917188.1|1013754_1014222_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_001300730.1|1014184_1014358_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_058655748.1|1014329_1014755_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	98.6	1.5e-67
WP_058661106.1|1014742_1015168_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.2	1.9e-59
WP_001144101.1|1015182_1015680_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|1015679_1015961_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|1015964_1016168_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|1016167_1016677_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_023223104.1|1016776_1017520_-|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	98.0	3.1e-121
WP_001248558.1|1017523_1018597_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_001074420.1|1018655_1019510_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	99.6	2.2e-139
WP_000156844.1|1019683_1021456_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_006678249.1|1021455_1022490_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_023223105.1|1022830_1024663_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.5	4.1e-90
WP_023223106.1|1024779_1027062_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
WP_000027666.1|1027051_1027327_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_001113272.1|1027323_1027548_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
WP_001277964.1|1027547_1027850_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
WP_000288879.1|1027849_1028074_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_000217677.1|1028137_1028638_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001308179.1|1028807_1029080_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|1029216_1029510_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|1029579_1030560_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|1030745_1031246_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
1030677:1030723	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|1031396_1032095_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|1032091_1033465_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133444.1|1033515_1033911_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077951263.1|1033922_1034675_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122635.1|1034681_1035302_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	1.4e-63
>prophage 65
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1054031	1057082	4925831		Escherichia_phage(100.0%)	1	NA	NA
WP_010989087.1|1054031_1057082_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	2.7e-06
>prophage 66
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1065281	1068076	4925831		Escherichia_phage(50.0%)	3	NA	NA
WP_000059693.1|1065281_1066085_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
WP_001520529.1|1066118_1067015_-	sugar kinase	NA	NA	NA	NA	NA
WP_000268253.1|1067179_1068076_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
>prophage 67
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1079479	1080688	4925831	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|1079479_1080688_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 68
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1087853	1088903	4925831		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_000146194.1|1087853_1088903_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.5e-09
>prophage 69
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1094259	1097046	4925831		Enterococcus_phage(100.0%)	1	NA	NA
WP_000249972.1|1094259_1097046_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	1.3e-47
>prophage 70
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1109434	1110049	4925831		Streptococcus_phage(100.0%)	1	NA	NA
WP_000378902.1|1109434_1110049_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.5	1.8e-18
>prophage 71
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1120976	1124411	4925831		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000257554.1|1120976_1121756_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
WP_000459612.1|1121758_1122307_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000508972.1|1122310_1122565_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187559.1|1122770_1124411_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
>prophage 72
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1138662	1140492	4925831		Catovirus(100.0%)	1	NA	NA
WP_001526553.1|1138662_1140492_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	3.4e-81
>prophage 73
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1145364	1149281	4925831		Bacillus_phage(100.0%)	3	NA	NA
WP_000383441.1|1145364_1147527_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	3.5e-117
WP_001213560.1|1147662_1148379_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000132874.1|1148378_1149281_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	1.0e-25
>prophage 74
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1168274	1173778	4925831		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612078.1|1168274_1169405_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
WP_001145156.1|1169409_1170087_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676080.1|1170064_1170289_-	sugar nucleotidyltransferase	NA	I7I009	Enterobacteria_phage	52.2	2.0e-07
WP_000822145.1|1170321_1171389_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.8e-98
WP_000011227.1|1171388_1172651_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	9.2e-25
WP_000866685.1|1172647_1173778_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	2.3e-27
>prophage 75
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1177902	1183305	4925831		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|1177902_1178232_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047525.1|1178375_1179641_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
WP_001089447.1|1179759_1181241_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238842.1|1181280_1183305_-	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
>prophage 76
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1186743	1187085	4925831		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000560824.1|1186743_1187085_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	1.7e-05
>prophage 77
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1192447	1194094	4925831		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012570.1|1192447_1194094_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	1.2e-64
>prophage 78
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1209473	1213471	4925831		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000339359.1|1209473_1210979_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
WP_000715944.1|1210986_1211406_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102338.1|1211602_1213471_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
>prophage 79
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1216764	1217757	4925831		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845121.1|1216764_1217757_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	1.2e-48
>prophage 80
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1230640	1234029	4925831		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000934854.1|1230640_1232011_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	1.5e-36
WP_000334066.1|1232199_1234029_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	2.6e-129
>prophage 81
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1238438	1245330	4925831		Cyanophage(33.33%)	7	NA	NA
WP_000867130.1|1238438_1239479_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	36.2	4.1e-47
WP_000741630.1|1239614_1240574_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000212197.1|1240573_1241464_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063118.1|1241550_1242324_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
WP_000377800.1|1242338_1243064_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000078081.1|1243158_1243824_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001519317.1|1243992_1245330_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.4e-63
>prophage 82
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1256641	1266432	4925831		Staphylococcus_phage(25.0%)	9	NA	NA
WP_001307474.1|1256641_1256899_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239725.1|1256862_1257222_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|1257238_1257379_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000059093.1|1258039_1259440_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673478.1|1259444_1260545_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
WP_000060085.1|1260692_1261766_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072047.1|1261794_1264209_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
WP_001054589.1|1264227_1265124_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001687378.1|1265238_1266432_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.7	2.1e-47
>prophage 83
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1271281	1285092	4925831		Oenococcus_phage(20.0%)	10	NA	NA
WP_000704735.1|1271281_1272430_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	8.0e-52
WP_000253524.1|1272514_1273852_+	MFS transporter	NA	NA	NA	NA	NA
WP_000106953.1|1273877_1276613_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.2	1.4e-33
WP_001202030.1|1276692_1277733_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001562512.1|1277705_1278398_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
WP_001230254.1|1278527_1279712_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_000790665.1|1279701_1282254_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.7	1.1e-72
WP_000595421.1|1282246_1282879_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000724476.1|1283068_1284469_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_000888528.1|1284474_1285092_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	4.8e-11
>prophage 84
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1292735	1293687	4925831		Cyanophage(50.0%)	2	NA	NA
WP_001532742.1|1292735_1293149_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
WP_001246919.1|1293258_1293687_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
>prophage 85
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1302191	1307148	4925831		Salmonella_phage(50.0%)	5	NA	NA
WP_000828740.1|1302191_1303376_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.8	1.1e-11
WP_001526328.1|1303578_1304439_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000117642.1|1304531_1304621_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001541152.1|1305254_1305353_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168439.1|1305459_1307148_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	4.2e-57
>prophage 86
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1325738	1327121	4925831		Pandoravirus(100.0%)	1	NA	NA
WP_001270489.1|1325738_1327121_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.1	1.2e-41
>prophage 87
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1335484	1341520	4925831	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_000749540.1|1335484_1336426_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	4.7e-66
WP_001682335.1|1336468_1337371_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000131288.1|1338793_1341520_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.2e-34
>prophage 88
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1345433	1353053	4925831		Escherichia_phage(33.33%)	6	NA	NA
WP_001143053.1|1345433_1348301_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.1	3.3e-94
WP_000984806.1|1348375_1348993_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000774139.1|1350291_1351329_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.4	7.2e-68
WP_105789235.1|1351416_1351500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989082.1|1351515_1351866_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001541628.1|1351862_1353053_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	34.3	1.2e-10
>prophage 89
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1360418	1361810	4925831		environmental_Halophage(100.0%)	1	NA	NA
WP_000115428.1|1360418_1361810_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
>prophage 90
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1366879	1371905	4925831		Bordetella_phage(33.33%)	4	NA	NA
WP_000280481.1|1366879_1368991_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|1369009_1369285_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000046969.1|1369339_1369963_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
WP_001241834.1|1370219_1371905_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	21.5	4.8e-21
>prophage 91
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1377883	1382437	4925831		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000717792.1|1377883_1378339_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
WP_001541625.1|1378319_1379543_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.8	9.4e-43
WP_000380129.1|1379715_1380381_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_001519051.1|1380598_1380835_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|1380855_1381023_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114508.1|1381120_1381930_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.9	1.0e-24
WP_001171890.1|1381957_1382437_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.5e-28
>prophage 92
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1396812	1406514	4925831		Prochlorococcus_phage(16.67%)	9	NA	NA
WP_000587771.1|1396812_1397745_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
WP_001213790.1|1397947_1399144_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
WP_000645990.1|1399153_1400179_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000798206.1|1400672_1401707_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.1e-07
WP_001135518.1|1401693_1402656_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214132.1|1402659_1403943_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
WP_000116576.1|1403952_1405497_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156179.1|1405744_1406176_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001273795.1|1406262_1406514_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 93
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1430363	1432214	4925831		Tupanvirus(100.0%)	1	NA	NA
WP_000582394.1|1430363_1432214_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.3	6.5e-11
>prophage 94
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1458697	1459693	4925831		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182588.1|1458697_1459693_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.8e-13
>prophage 95
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1463555	1474078	4925831	transposase	Macacine_betaherpesvirus(20.0%)	12	NA	NA
WP_001541099.1|1463555_1463747_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.8	1.5e-19
WP_000702452.1|1463918_1464386_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000965886.1|1464563_1464851_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_058113803.1|1464838_1465297_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001352368.1|1465306_1466515_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000047149.1|1467033_1467573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014594.1|1467746_1467959_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_000455790.1|1468247_1468538_-	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000190524.1|1468976_1469687_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_000804674.1|1469736_1470711_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.1	5.4e-17
WP_000747548.1|1470929_1471592_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_000148453.1|1471744_1474078_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	9.8e-73
>prophage 96
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1477151	1477610	4925831	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502119.1|1477151_1477610_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 97
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1492785	1494779	4925831		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196509.1|1492785_1493769_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.3e-14
WP_000103563.1|1493765_1494779_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
>prophage 98
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1508869	1510078	4925831	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|1508869_1510078_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 99
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1524846	1525749	4925831		Burkholderia_virus(100.0%)	1	NA	NA
WP_000968867.1|1524846_1525749_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.5	3.4e-05
>prophage 100
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1540464	1542507	4925831		Indivirus(100.0%)	1	NA	NA
WP_000184178.1|1540464_1542507_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 101
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1550750	1553492	4925831		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000202926.1|1550750_1553492_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.6e-21
>prophage 102
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1558860	1570523	4925831		Dickeya_phage(28.57%)	12	NA	NA
WP_000187489.1|1558860_1559526_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	1.3e-57
WP_001541054.1|1559695_1559941_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_000789683.1|1559964_1561608_-	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.5e-14
WP_000106641.1|1561807_1564006_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.0	8.5e-111
WP_000964735.1|1564086_1564713_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
WP_000042853.1|1564854_1565226_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_001575094.1|1565247_1565520_-	DUF1145 family protein	NA	NA	NA	NA	NA
WP_000743277.1|1565506_1566103_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_001118686.1|1566228_1567704_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000617729.1|1567706_1568375_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
WP_001081707.1|1568367_1569423_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000159621.1|1569668_1570523_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
>prophage 103
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1576313	1578514	4925831		Anomala_cuprea_entomopoxvirus(33.33%)	4	NA	NA
WP_000082083.1|1576313_1577081_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	7.5e-14
WP_000416114.1|1577082_1577796_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.7	3.7e-15
WP_000481005.1|1577921_1578149_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001521773.1|1578145_1578514_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	1.9e-07
>prophage 104
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1581883	1583691	4925831		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907838.1|1581883_1582954_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
WP_000073548.1|1582950_1583691_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.4e-09
>prophage 105
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1605090	1607538	4925831		Dickeya_phage(100.0%)	1	NA	NA
WP_000993428.1|1605090_1607538_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 106
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1621772	1624888	4925831		Halovirus(50.0%)	2	NA	NA
WP_000013008.1|1621772_1623326_+	TROVE domain-containing protein	NA	R4TL80	Halovirus	25.5	3.4e-29
WP_001105522.1|1623673_1624888_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.3	4.7e-135
>prophage 107
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1629944	1632338	4925831		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000082246.1|1629944_1632338_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 108
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1638397	1639312	4925831	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000235945.1|1638397_1639312_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.5	3.7e-68
>prophage 109
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1645923	1649686	4925831		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|1645923_1646643_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253818.1|1646639_1647992_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
WP_001265689.1|1648066_1649686_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.2e-141
>prophage 110
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1666725	1667562	4925831		Vibrio_phage(100.0%)	1	NA	NA
WP_000742132.1|1666725_1667562_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 111
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1670633	1671092	4925831	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502119.1|1670633_1671092_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 112
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1685959	1689956	4925831		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000601880.1|1685959_1686523_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	3.2e-62
WP_000190023.1|1686608_1687826_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000269311.1|1687868_1689956_-	membrane protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
>prophage 113
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1694542	1696450	4925831		Tupanvirus(100.0%)	1	NA	NA
WP_000634766.1|1694542_1696450_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	6.5e-75
>prophage 114
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1702410	1707981	4925831		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001268010.1|1702410_1702797_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.8e-19
WP_000820704.1|1702796_1703153_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903400.1|1703160_1703448_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|1703573_1703948_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138042.1|1704043_1704514_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124693.1|1704610_1706725_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
WP_000031748.1|1706796_1707981_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 115
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1727874	1732194	4925831	tRNA	Prochlorococcus_phage(33.33%)	6	NA	NA
WP_001285165.1|1727874_1728822_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|1728837_1729347_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_000124529.1|1729478_1730603_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|1730574_1731048_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|1731074_1731617_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001063609.1|1731621_1732194_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
>prophage 116
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1746218	1749600	4925831		Bacillus_virus(50.0%)	3	NA	NA
WP_001145331.1|1746218_1748318_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
WP_000620015.1|1748468_1748633_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
WP_000642611.1|1748715_1749600_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
>prophage 117
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1761684	1762728	4925831		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1761684_1762728_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 118
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1781178	1782447	4925831		Oenococcus_phage(100.0%)	1	NA	NA
WP_064305572.1|1781178_1782447_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	32.8	2.4e-57
>prophage 119
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1789457	1790825	4925831	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000716693.1|1789457_1790825_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.5e-20
>prophage 120
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1795694	1799729	4925831	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_000366112.1|1795694_1796195_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
WP_000382926.1|1796303_1797095_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_001029667.1|1797229_1798123_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108071.1|1798238_1799729_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
>prophage 121
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1804520	1805624	4925831		Salmonella_phage(100.0%)	1	NA	NA
WP_000184315.1|1804520_1805624_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
>prophage 122
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1812390	1827296	4925831		Staphylococcus_phage(28.57%)	17	NA	NA
WP_001176887.1|1812390_1813320_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
WP_058664270.1|1813413_1815750_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	4.6e-38
WP_000719822.1|1815976_1816630_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000044652.1|1816626_1817355_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000602196.1|1817429_1818062_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216797.1|1818310_1818583_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243749.1|1818579_1819434_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_000609332.1|1819479_1819971_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176589.1|1820088_1820376_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_000809020.1|1820398_1821832_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224104.1|1821879_1822605_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
WP_000669770.1|1822611_1823166_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000047845.1|1823134_1823710_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030021.1|1823706_1824273_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	2.7e-53
WP_000018617.1|1824293_1825280_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
WP_000922736.1|1825293_1826271_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000531566.1|1826483_1827296_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
>prophage 123
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1831404	1832895	4925831		Vibrio_phage(50.0%)	2	NA	NA
WP_000444168.1|1831404_1831692_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
WP_001047354.1|1831923_1832895_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
>prophage 124
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1836241	1836700	4925831	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502119.1|1836241_1836700_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 125
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1840329	1843217	4925831	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107481.1|1840329_1842264_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
WP_000764711.1|1842368_1843217_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
>prophage 126
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1846687	1853344	4925831		Dickeya_phage(50.0%)	4	NA	NA
WP_000207654.1|1846687_1848031_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	3.1e-63
WP_000105461.1|1848658_1849111_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031038.1|1849138_1850641_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133064.1|1850665_1853344_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
>prophage 127
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1858879	1860769	4925831		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000807248.1|1858879_1860769_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	7.7e-52
>prophage 128
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1867905	1874554	4925831		Invertebrate_iridovirus(25.0%)	9	NA	NA
WP_000928379.1|1867905_1868223_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	8.4e-12
WP_000380404.1|1868260_1868704_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037599.1|1868683_1869202_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.2	9.0e-11
WP_001521094.1|1869332_1869968_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000643280.1|1870034_1870610_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000893481.1|1870619_1871210_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
WP_000057285.1|1871231_1871627_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249229.1|1871584_1873627_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000812288.1|1873690_1874554_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.3	9.6e-50
>prophage 129
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1890598	1891744	4925831		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706459.1|1890598_1891744_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	2.0e-47
>prophage 130
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1898227	1900522	4925831		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000867323.1|1898227_1900522_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	5.7e-158
>prophage 131
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1913707	1914676	4925831		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001098833.1|1913707_1914676_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
>prophage 132
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1920868	1937732	4925831	tRNA	Klosneuvirus(14.29%)	14	NA	NA
WP_122815345.1|1920868_1922299_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	3.0e-32
WP_000094651.1|1922677_1924198_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478472.1|1924585_1926151_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
WP_000983441.1|1926147_1926795_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|1927026_1927794_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000237776.1|1928074_1928581_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|1928704_1930552_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|1930701_1932447_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|1932682_1932898_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264394.1|1933125_1934139_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001272784.1|1934389_1935001_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000355776.1|1935107_1935467_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001281933.1|1935564_1936386_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000708443.1|1936490_1937732_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.7	5.5e-91
>prophage 133
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1942960	1944394	4925831		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000867682.1|1942960_1944394_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
>prophage 134
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1948448	1949102	4925831		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076978.1|1948448_1949102_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 135
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1954858	1956699	4925831		Ralstonia_phage(50.0%)	2	NA	NA
WP_000442833.1|1954858_1956022_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.4e-88
WP_000831528.1|1956027_1956699_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.9	5.7e-34
>prophage 136
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1961099	1962992	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_000195318.1|1961099_1962992_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	5.3e-93
>prophage 137
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1966307	1970007	4925831		Stx_converting_phage(50.0%)	3	NA	NA
WP_000731552.1|1966307_1966700_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
WP_000998789.1|1966771_1967638_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001281908.1|1967748_1970007_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.7	2.0e-86
>prophage 138
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1975844	1981548	4925831		Pseudomonas_phage(33.33%)	5	NA	NA
WP_001274458.1|1975844_1978016_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
WP_000525382.1|1978218_1978413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128242.1|1978570_1979026_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.4e-20
WP_000547731.1|1979070_1980555_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000013100.1|1980720_1981548_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
>prophage 139
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	1987488	1992629	4925831		Diadromus_pulchellus_ascovirus(50.0%)	6	NA	NA
WP_000019032.1|1987488_1988373_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
WP_000665657.1|1988496_1988901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936444.1|1988887_1989298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433046.1|1989389_1989905_+	RNA helicase	NA	NA	NA	NA	NA
WP_000439335.1|1990184_1990679_+	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_001238434.1|1990985_1992629_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
>prophage 140
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2008057	2009530	4925831		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000437132.1|2008057_2009530_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	7.9e-44
>prophage 141
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2012929	2013808	4925831		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_001137806.1|2012929_2013808_+	carbon-nitrogen hydrolase family protein	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	27.9	6.0e-07
>prophage 142
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2032827	2048844	4925831	transposase	Escherichia_phage(38.46%)	24	NA	NA
WP_000004195.1|2032827_2034216_+	replicative DNA helicase	NA	O80281	Escherichia_phage	50.1	5.8e-113
WP_032353286.1|2034205_2035855_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_032353285.1|2035847_2036579_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	37.3	8.2e-18
WP_006859641.1|2036575_2037154_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_001696184.1|2037150_2037399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696186.1|2037578_2037791_+	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	82.2	1.7e-13
WP_001696187.1|2037787_2038009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032297182.1|2037995_2038595_+	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	64.8	1.4e-55
WP_001696189.1|2038596_2039112_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	99.4	5.4e-101
WP_001696190.1|2039108_2039507_+	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	62.6	1.4e-32
WP_000013837.1|2039508_2039730_+	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	74.6	4.5e-20
WP_000360280.1|2039731_2039929_+	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	86.2	1.3e-31
WP_001696191.1|2039939_2040353_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	77.8	1.5e-29
WP_001696193.1|2040401_2040617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696194.1|2040613_2040835_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	54.1	5.3e-13
WP_001696196.1|2041095_2042361_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060682059.1|2042360_2042939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696681.1|2043040_2043766_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001696682.1|2043782_2045801_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.5	4.7e-39
WP_073999724.1|2046104_2046323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001276982.1|2046491_2046956_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_001696685.1|2047055_2047259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696686.1|2047271_2047829_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	60.7	6.6e-52
WP_100245064.1|2047902_2048844_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	39.5	2.3e-41
>prophage 143
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2076557	2077298	4925831		Salmonella_phage(100.0%)	1	NA	NA
WP_001696707.1|2076557_2077298_-	hypothetical protein	NA	S4TQ39	Salmonella_phage	41.9	6.6e-23
>prophage 144
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2080341	2090424	4925831	integrase,transposase	Staphylococcus_phage(20.0%)	12	2083804:2083818	2096070:2096084
WP_001696714.1|2080341_2080680_+	hypothetical protein	NA	A0A220BZ01	Staphylococcus_phage	32.6	6.7e-07
WP_060682051.1|2080758_2081193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029490370.1|2081300_2082263_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_029490369.1|2082312_2082606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023154733.1|2082763_2082973_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	78.0	1.3e-13
WP_060682050.1|2083043_2084246_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
2083804:2083818	attL	ATCAGTGCAGCAGCG	NA	NA	NA	NA
WP_151113860.1|2084329_2085079_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_001352368.1|2085185_2086394_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_114042866.1|2087230_2088504_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	4.2e-171
WP_060682046.1|2088568_2088799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682045.1|2088932_2089214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060682044.1|2089254_2090424_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	38.8	1.0e-38
2096070:2096084	attR	ATCAGTGCAGCAGCG	NA	NA	NA	NA
>prophage 145
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2093847	2094324	4925831		Ralstonia_phage(100.0%)	1	NA	NA
WP_000871803.1|2093847_2094324_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	37.0	1.7e-08
>prophage 146
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2112494	2113580	4925831		Geobacillus_virus(100.0%)	1	NA	NA
WP_000976289.1|2112494_2113580_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 147
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2130886	2132041	4925831		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062140.1|2130886_2132041_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
>prophage 148
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2137886	2139359	4925831		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000379524.1|2137886_2139359_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.0	2.0e-47
>prophage 149
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2147375	2148032	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_000956930.1|2147375_2148032_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	9.6e-10
>prophage 150
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2159213	2160446	4925831		Catovirus(100.0%)	1	NA	NA
WP_001151627.1|2159213_2160446_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
>prophage 151
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2168714	2174418	4925831		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_000194975.1|2168714_2171588_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	2.4e-262
WP_001520239.1|2171813_2171960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819369.1|2172043_2172937_+	transporter	NA	NA	NA	NA	NA
WP_001230141.1|2172984_2174418_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	8.8e-32
>prophage 152
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2178403	2190623	4925831	transposase,tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000434302.1|2178403_2179300_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	1.4e-30
WP_000745625.1|2179323_2180037_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813394.1|2180042_2181776_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	8.1e-64
WP_010989230.1|2181880_2182978_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003339.1|2182988_2184506_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
WP_000133994.1|2184581_2185127_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000244329.1|2185391_2186150_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
WP_010989071.1|2186434_2187241_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_001540858.1|2187515_2187767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557549.1|2187943_2188171_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911336.1|2188170_2188569_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000502119.1|2188948_2189407_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001526599.1|2189856_2190042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038506.1|2190086_2190623_+	porin family protein	NA	A5LH44	Enterobacteria_phage	30.7	4.3e-16
>prophage 153
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2205437	2207971	4925831		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000602490.1|2205437_2206199_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	7.7e-19
WP_000253650.1|2206552_2207971_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.7	3.5e-25
>prophage 154
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2218801	2225756	4925831		Moraxella_phage(33.33%)	6	NA	NA
WP_000895635.1|2218801_2219515_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
WP_001274930.1|2219696_2220392_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564481.1|2221074_2221605_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957887.1|2221617_2223864_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	25.7	2.1e-11
WP_000204645.1|2224079_2224955_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816247.1|2224961_2225756_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	2.6e-118
>prophage 155
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2231238	2247817	4925831	tRNA	Klosneuvirus(16.67%)	10	NA	NA
WP_001138254.1|2231238_2234127_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.9	1.1e-62
WP_001000527.1|2234119_2237665_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.6	1.4e-09
WP_000155129.1|2237661_2239497_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.0	5.4e-18
WP_000588964.1|2239599_2240931_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000011919.1|2241163_2242417_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.9e-14
WP_000678626.1|2242916_2244014_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117748.1|2244123_2244930_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	6.5e-16
WP_014343890.1|2244981_2245869_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_000184198.1|2246168_2246612_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000991053.1|2246611_2247817_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	1.2e-71
>prophage 156
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2259359	2260175	4925831		Bacillus_phage(100.0%)	1	NA	NA
WP_000881444.1|2259359_2260175_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.2	9.2e-10
>prophage 157
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2265042	2265891	4925831		Vibrio_phage(100.0%)	1	NA	NA
WP_000100474.1|2265042_2265891_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 158
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2273309	2278605	4925831		Streptococcus_phage(33.33%)	3	NA	NA
WP_000706479.1|2273309_2274452_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.0	2.0e-47
WP_000186400.1|2274495_2277252_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.3	3.0e-52
WP_000046849.1|2277309_2278605_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	1.4e-36
>prophage 159
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2283388	2287214	4925831		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_000210863.1|2283388_2285026_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
WP_000036734.1|2285108_2286407_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
WP_001199961.1|2286542_2287214_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 160
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2308654	2310686	4925831		Hokovirus(50.0%)	2	NA	NA
WP_001092263.1|2308654_2310094_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.5	3.6e-33
WP_001173663.1|2310080_2310686_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.3e-29
>prophage 161
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2313796	2324223	4925831		Escherichia_phage(50.0%)	12	NA	NA
WP_001221538.1|2313796_2314558_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.8	1.4e-57
WP_000253545.1|2314551_2315178_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
WP_001272632.1|2315353_2316487_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_000081498.1|2316549_2317542_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000562964.1|2317586_2317823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863168.1|2317833_2319261_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_001237182.1|2319260_2319854_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000423344.1|2320024_2320429_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000613185.1|2320447_2321212_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
WP_000206958.1|2321408_2322332_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.4	1.7e-116
WP_000912488.1|2322325_2323588_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.8	1.7e-132
WP_000153636.1|2323584_2324223_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
>prophage 162
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2330189	2334265	4925831		Catovirus(50.0%)	3	NA	NA
WP_001005807.1|2330189_2332757_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.9e-29
WP_024159753.1|2332915_2333437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420452.1|2333608_2334265_-	Serine/threonine-protein phosphatase 2	NA	Q71TJ1	Escherichia_phage	47.9	7.8e-52
>prophage 163
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2339750	2341439	4925831		Vibrio_phage(100.0%)	1	NA	NA
WP_000848113.1|2339750_2341439_+	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	3.9e-15
>prophage 164
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2370389	2371598	4925831	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|2370389_2371598_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 165
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2376269	2377091	4925831		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000083153.1|2376269_2377091_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	3.1e-13
>prophage 166
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2401007	2401973	4925831		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001278212.1|2401007_2401973_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	3.0e-36
>prophage 167
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2407879	2413426	4925831	tRNA	Pseudomonas_phage(25.0%)	6	NA	NA
WP_000132239.1|2407879_2408377_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
WP_000963150.1|2408461_2409523_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
WP_001294863.1|2409639_2410140_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_001277278.1|2410136_2410343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000047228.1|2410375_2413006_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|2413240_2413426_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 168
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2427084	2432139	4925831		Bacillus_virus(25.0%)	4	NA	NA
WP_000985529.1|2427084_2428287_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
WP_000777906.1|2428641_2429601_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	5.2e-129
WP_000246617.1|2429611_2431756_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.7	3.8e-196
WP_001275409.1|2431728_2432139_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	2.5e-16
>prophage 169
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2438636	2442640	4925831		Clostridium_phage(50.0%)	4	NA	NA
WP_000522406.1|2438636_2439086_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
WP_000126152.1|2439107_2439785_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000531284.1|2439826_2441227_-	GABA permease	NA	NA	NA	NA	NA
WP_001095556.1|2441356_2442640_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	6.0e-32
>prophage 170
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2463011	2469398	4925831		Bacillus_phage(50.0%)	4	NA	NA
WP_001111830.1|2463011_2466668_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.0e-44
WP_001221110.1|2466748_2467864_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_151113867.1|2468447_2468669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190914.1|2468825_2469398_-	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
>prophage 171
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2473730	2475911	4925831		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000196142.1|2473730_2475911_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
>prophage 172
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2489475	2489958	4925831		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001518569.1|2489475_2489958_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
>prophage 173
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2501664	2504907	4925831		Pseudomonas_phage(50.0%)	3	NA	NA
WP_001030985.1|2501664_2502885_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|2502877_2503396_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|2503836_2504907_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
>prophage 174
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2511692	2514266	4925831		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235092.1|2511692_2514266_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
>prophage 175
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2521470	2523331	4925831		Synechococcus_phage(50.0%)	2	NA	NA
WP_000985651.1|2521470_2521926_+	DUF4385 domain-containing protein	NA	A0A222YVL1	Synechococcus_phage	47.0	1.5e-33
WP_000807819.1|2522029_2523331_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.5e-43
>prophage 176
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2528632	2534803	4925831	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098732.1|2528632_2529052_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|2529255_2530293_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|2530408_2531098_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|2531416_2531800_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|2531861_2532449_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001521114.1|2532551_2533451_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|2533468_2534803_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
>prophage 177
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2540642	2548488	4925831		Streptococcus_phage(25.0%)	9	NA	NA
WP_000790154.1|2540642_2542442_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|2542458_2543433_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|2543706_2544387_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|2544383_2545289_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399379.1|2545300_2546029_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|2546040_2546772_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986041.1|2546771_2547152_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|2547263_2547524_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001581956.1|2547576_2548488_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
>prophage 178
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2557071	2568385	4925831		Bacillus_phage(50.0%)	6	NA	NA
WP_000970047.1|2557071_2560959_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
WP_001676035.1|2562930_2564361_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.5e-15
WP_001054239.1|2564362_2565127_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_000625591.1|2565123_2566461_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_000717694.1|2566537_2566876_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000856793.1|2566924_2568385_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
>prophage 179
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2575599	2576853	4925831		Aeromonas_phage(100.0%)	1	NA	NA
WP_000919178.1|2575599_2576853_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 180
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2584272	2594417	4925831	tRNA	Heterosigma_akashiwo_virus(16.67%)	12	NA	NA
WP_000174944.1|2584272_2585151_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000553467.1|2585295_2586099_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000940032.1|2586217_2586949_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_001241346.1|2587108_2587603_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_000775263.1|2587783_2588998_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_000331704.1|2589025_2589412_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
WP_000028952.1|2589440_2589764_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
WP_000384396.1|2589959_2590475_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196668.1|2590487_2592338_+	Fe-S protein assembly chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	38.8	3.0e-101
WP_001124466.1|2592339_2592675_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523621.1|2592686_2592887_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133541.1|2593133_2594417_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
>prophage 181
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2605216	2610465	4925831		Escherichia_phage(66.67%)	5	NA	NA
WP_000508279.1|2605216_2607622_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.5	8.7e-141
WP_000077436.1|2607618_2608248_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	56.4	5.5e-63
WP_000544894.1|2608240_2609050_+	dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
WP_000247788.1|2609049_2609913_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000963846.1|2610033_2610465_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
>prophage 182
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2636763	2646054	4925831		Escherichia_phage(33.33%)	3	NA	NA
WP_071591489.1|2636763_2642916_+	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	24.8	2.6e-24
WP_000953165.1|2643077_2644427_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	4.4e-41
WP_000944174.1|2644587_2646054_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
>prophage 183
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2649103	2649295	4925831		Escherichia_phage(100.0%)	1	NA	NA
WP_000075924.1|2649103_2649295_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 184
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2655756	2664349	4925831	protease	Prochlorococcus_phage(20.0%)	10	NA	NA
WP_001028593.1|2655756_2656395_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	44.0	1.5e-31
WP_000130477.1|2656394_2657432_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.9e-69
WP_021000588.1|2657467_2657647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000706208.1|2657845_2658472_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198335.1|2658559_2659849_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	3.0e-63
WP_000100388.1|2659919_2660645_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000132648.1|2660671_2661031_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
WP_000489630.1|2661070_2662534_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000892056.1|2662741_2663809_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001520562.1|2663995_2664349_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.2	1.3e-13
>prophage 185
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2667687	2668401	4925831		Synechococcus_phage(100.0%)	1	NA	NA
WP_001171630.1|2667687_2668401_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 186
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2687024	2691174	4925831	transposase	Cyanophage(50.0%)	3	NA	NA
WP_001072448.1|2687024_2687975_-	transaldolase A	NA	A0A127KNC6	Cyanophage	30.3	8.2e-10
WP_000344297.1|2688246_2690526_+	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_000502119.1|2690715_2691174_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 187
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2709301	2718853	4925831		Paenibacillus_phage(20.0%)	11	NA	NA
WP_000102881.1|2709301_2710171_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
WP_014344511.1|2710272_2710809_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000842932.1|2710795_2711245_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838976.1|2711306_2711882_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084583.1|2711976_2712876_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
WP_000517460.1|2713113_2713905_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
WP_000290275.1|2714062_2715079_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000881745.1|2715078_2715912_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852705.1|2715911_2716787_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021076.1|2716776_2717874_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	32.7	2.1e-25
WP_001093886.1|2717941_2718853_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.8	1.7e-57
>prophage 188
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2723884	2733734	4925831		Hokovirus(25.0%)	9	NA	NA
WP_000623114.1|2723884_2725612_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_000487600.1|2725660_2725918_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000036904.1|2726301_2727273_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	7.4e-75
WP_000255006.1|2727436_2728198_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000983126.1|2728429_2729416_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000433266.1|2729487_2731503_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	1.5e-146
WP_001519708.1|2731504_2731723_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_000765569.1|2731719_2732718_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_001109831.1|2732807_2733734_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.0e-08
>prophage 189
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2754679	2756655	4925831	transposase	Saccharomonospora_phage(50.0%)	3	NA	NA
WP_000502119.1|2754679_2755138_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_010723117.1|2755260_2755332_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484423.1|2755734_2756655_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
>prophage 190
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2765467	2766409	4925831		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000377774.1|2765467_2766409_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	5.4e-147
>prophage 191
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2775589	2776675	4925831		Pandoravirus(100.0%)	1	NA	NA
WP_000918456.1|2775589_2776675_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
>prophage 192
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2783931	2784717	4925831		Campylobacter_virus(50.0%)	2	NA	NA
WP_000118256.1|2783931_2784300_-	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
WP_000433423.1|2784468_2784717_-	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	60.0	8.0e-18
>prophage 193
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2787723	2788860	4925831		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699178.1|2787723_2788860_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
>prophage 194
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2795361	2796879	4925831		Mollivirus(100.0%)	1	NA	NA
WP_000334204.1|2795361_2796879_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 195
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2808310	2809084	4925831		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293591.1|2808310_2809084_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 196
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2812812	2813832	4925831		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000026955.1|2812812_2813832_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.5e-20
>prophage 197
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2824639	2827911	4925831		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_014343872.1|2824639_2825317_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	4.2e-08
WP_001012861.1|2825393_2827220_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813882.1|2827311_2827911_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 198
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2849569	2850571	4925831		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000368558.1|2849569_2850571_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.9	1.4e-28
>prophage 199
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2863138	2868147	4925831		Tupanvirus(50.0%)	4	NA	NA
WP_000648776.1|2863138_2865121_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.4	1.0e-22
WP_000458893.1|2865117_2866101_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.7e-34
WP_001279284.1|2866103_2867243_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.3	2.0e-31
WP_000879248.1|2867541_2868147_+	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
>prophage 200
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2871794	2873000	4925831		Oenococcus_phage(100.0%)	1	NA	NA
WP_001521492.1|2871794_2873000_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	6.7e-25
>prophage 201
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2882613	2940421	4925831	holin,protease,tail,transposase	Salmonella_phage(19.05%)	49	NA	NA
WP_000858952.1|2882613_2883684_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000176719.1|2883799_2884678_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000660244.1|2884839_2886030_+	MFS transporter	NA	NA	NA	NA	NA
WP_000533921.1|2886031_2886286_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
WP_000332026.1|2886285_2887416_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
WP_001076487.1|2887528_2889814_-	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.1e-282
WP_001091009.1|2890169_2890898_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001352368.1|2890966_2892175_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000944714.1|2892318_2893203_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000098078.1|2893252_2894578_+	MFS transporter	NA	NA	NA	NA	NA
WP_000705579.1|2894592_2895795_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.3	3.5e-58
WP_038993193.1|2896204_2898841_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	7.4e-93
WP_000876078.1|2898958_2901805_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	4.1e-41
WP_001061919.1|2901907_2902558_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_000083201.1|2902574_2905244_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865526.1|2905972_2907109_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	6.6e-115
WP_000784307.1|2907223_2908276_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000975956.1|2908356_2909418_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	1.4e-18
WP_000884990.1|2909420_2910071_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_000421590.1|2910146_2911790_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.4	9.8e-11
WP_000781589.1|2911998_2912493_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|2912906_2913398_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|2913387_2913651_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|2913647_2916134_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|2916140_2916836_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|2916822_2917692_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|2917807_2918257_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|2918266_2918869_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|2918889_2919507_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|2919503_2920163_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|2920214_2920952_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|2920948_2921161_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|2921157_2921637_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|2921633_2923565_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|2923561_2924119_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|2924115_2925159_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|2925202_2925850_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|2926579_2927143_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|2927334_2927538_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|2927840_2928632_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|2928928_2929132_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001202279.1|2931994_2932984_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|2932998_2933367_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|2933395_2934727_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|2935023_2935353_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|2935945_2937187_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|2937189_2937717_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|2938094_2938538_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|2938591_2940421_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
>prophage 202
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2950453	2962081	4925831		Salmonella_phage(33.33%)	12	NA	NA
WP_000884778.1|2950453_2950744_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|2950771_2951275_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000256150.1|2951555_2953316_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001135904.1|2953347_2953575_-	YejL family protein	NA	NA	NA	NA	NA
WP_000050806.1|2953754_2954762_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_000033440.1|2954789_2955410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000494192.1|2955518_2955803_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578121.1|2955927_2957688_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_001234836.1|2957839_2958535_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213347.1|2958562_2959753_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001094639.1|2960143_2960488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203622.1|2960491_2962081_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
>prophage 203
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2965586	2969916	4925831	transposase	uncultured_marine_virus(50.0%)	3	NA	NA
WP_001352368.1|2965586_2966795_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000957746.1|2967461_2969018_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000241015.1|2969343_2969916_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 204
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2980056	2980914	4925831		Catovirus(100.0%)	1	NA	NA
WP_000873909.1|2980056_2980914_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
>prophage 205
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2985030	2986953	4925831		Acinetobacter_phage(100.0%)	1	NA	NA
WP_064305560.1|2985030_2986953_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.2	3.1e-08
>prophage 206
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2992392	2993061	4925831		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139611.1|2992392_2993061_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
>prophage 207
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	2997020	2998541	4925831		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000535907.1|2997020_2998541_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
>prophage 208
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3024595	3033766	4925831	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3024595_3025543_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|3025526_3026258_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3026238_3026346_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3026405_3027137_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|3027359_3029045_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|3029041_3029761_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3029807_3030275_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|3030331_3030862_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
WP_000703137.1|3031033_3031492_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3031732_3033766_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 209
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3050962	3053821	4925831		Salmonella_phage(50.0%)	2	NA	NA
WP_010989041.1|3050962_3052009_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	75.2	1.6e-147
WP_001517981.1|3052459_3053821_-	U32 family peptidase	NA	Q6DW11	Phage_TP	95.4	2.3e-207
>prophage 210
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3058245	3064856	4925831		Bacillus_phage(66.67%)	3	NA	NA
WP_000137854.1|3058245_3058968_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
WP_000870070.1|3058964_3060368_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	3.6e-30
WP_001210077.1|3061775_3064856_-	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	23.1	2.7e-62
>prophage 211
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3075304	3084604	4925831		Catovirus(25.0%)	7	NA	NA
WP_000132082.1|3075304_3075946_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
WP_001234783.1|3076036_3076618_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	9.3e-33
WP_001252270.1|3076656_3078513_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454713.1|3078598_3080179_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
WP_000978077.1|3080853_3081993_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482224.1|3081998_3082448_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000136405.1|3082444_3084604_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	3.2e-17
>prophage 212
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3089779	3096485	4925831		Acanthocystis_turfacea_Chlorella_virus(25.0%)	6	NA	NA
WP_000048160.1|3089779_3090901_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
WP_001041701.1|3090903_3091869_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
WP_001526160.1|3091871_3092345_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699632.1|3092341_3093565_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000605938.1|3093561_3095004_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	7.2e-50
WP_000164218.1|3095114_3096485_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.6	3.4e-33
>prophage 213
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3102073	3113506	4925831		Enterobacteria_phage(33.33%)	11	NA	NA
WP_001111841.1|3102073_3103477_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|3103654_3104548_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|3104924_3106010_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|3106009_3106909_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|3106956_3107835_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|3107835_3108387_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|3108392_3109385_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|3109381_3110155_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|3110159_3111239_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|3111265_3112579_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000143399.1|3112606_3113506_+	CDP-abequose synthase	NA	K7QJG5	Escherichia_phage	22.2	2.1e-07
>prophage 214
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3118212	3119652	4925831		Hokovirus(100.0%)	1	NA	NA
WP_000009017.1|3118212_3119652_+	mannose-1-phosphate guanylyltransferase RfbM	NA	A0A1V0SH58	Hokovirus	31.1	7.4e-55
>prophage 215
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3122737	3125547	4925831		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000043530.1|3122737_3124144_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.5e-36
WP_000704831.1|3124380_3125547_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.2	4.1e-112
>prophage 216
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3132990	3133890	4925831		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000886603.1|3132990_3133890_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 217
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3142553	3147480	4925831		Escherichia_phage(66.67%)	4	NA	NA
WP_000028228.1|3142553_3144830_+	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	27.1	2.9e-37
WP_001016236.1|3144844_3145423_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.2	3.9e-23
WP_001092559.1|3145419_3146184_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000925042.1|3146307_3147480_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.9	6.2e-201
>prophage 218
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3167183	3167978	4925831		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000023.1|3167183_3167978_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.2	1.2e-11
>prophage 219
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3181490	3182306	4925831		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000881551.1|3181490_3182306_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.6	1.2e-09
>prophage 220
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3197826	3213066	4925831		Morganella_phage(20.0%)	17	NA	NA
WP_001219021.1|3197826_3198351_-	peptidase	NA	G9L6C4	Escherichia_phage	76.9	5.6e-37
WP_001669246.1|3198998_3199289_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
WP_000598920.1|3199660_3200458_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001535277.1|3200938_3201100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|3201226_3201646_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457665.1|3201648_3202917_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|3203371_3203584_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|3203594_3203783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|3204043_3205240_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107435.1|3205889_3206201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377053.1|3206280_3206976_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	9.5e-08
WP_001157317.1|3207049_3208480_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000785978.1|3208460_3208931_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001212261.1|3208919_3209840_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000929127.1|3210015_3210927_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001178602.1|3210943_3211189_+	YodC family protein	NA	NA	NA	NA	NA
WP_001119820.1|3211353_3213066_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.9	1.2e-19
>prophage 221
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3240739	3241492	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_001273033.1|3240739_3241492_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.5	3.2e-25
>prophage 222
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3249753	3250419	4925831		Sphingomonas_phage(100.0%)	1	NA	NA
WP_000781526.1|3249753_3250419_+	YecA family protein	NA	H9NBT7	Sphingomonas_phage	62.1	1.5e-05
>prophage 223
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3265570	3269705	4925831		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
WP_000483278.1|3265570_3267232_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	2.2e-10
WP_000204362.1|3267385_3268252_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036392.1|3268248_3269298_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763861.1|3269315_3269705_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
>prophage 224
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3277656	3284216	4925831	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_001025366.1|3277656_3279390_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	3.7e-85
WP_000024797.1|3279626_3280196_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185771.1|3280215_3280962_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000569042.1|3281197_3282169_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019613.1|3282165_3282909_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	3.2e-25
WP_000252975.1|3282949_3283345_-	membrane protein	NA	NA	NA	NA	NA
WP_000639234.1|3283397_3284216_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	1.2e-57
>prophage 225
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3288237	3288759	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_000022510.1|3288237_3288759_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 226
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3292861	3295488	4925831		Bacillus_phage(50.0%)	3	NA	NA
WP_000568508.1|3292861_3293872_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.4	2.4e-07
WP_000571508.1|3293950_3294736_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000203023.1|3294732_3295488_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
>prophage 227
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3301782	3303258	4925831		Cyanophage(100.0%)	1	NA	NA
WP_000301711.1|3301782_3303258_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
>prophage 228
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3311157	3312874	4925831		Klebsiella_phage(50.0%)	3	NA	NA
WP_000944282.1|3311157_3311856_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
WP_000100257.1|3311879_3312536_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000856224.1|3312643_3312874_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 229
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3315918	3318647	4925831		Escherichia_phage(25.0%)	6	NA	NA
WP_072101013.1|3315918_3316413_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	1.1e-21
WP_001013467.1|3316603_3316834_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|3316887_3317421_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|3317677_3317845_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001034750.1|3317909_3318101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348535.1|3318155_3318647_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.9	1.4e-42
>prophage 230
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3326595	3328920	4925831	integrase	Salmonella_phage(33.33%)	4	3323639:3323652	3338049:3338062
3323639:3323652	attL	AGCAATAATAATCA	NA	NA	NA	NA
WP_021000423.1|3326595_3326892_+	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	83.7	5.3e-16
WP_000684833.1|3327157_3327526_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_001576018.1|3328344_3328485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576019.1|3328650_3328920_-	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
3338049:3338062	attR	AGCAATAATAATCA	NA	NA	NA	NA
>prophage 231
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3337567	3340691	4925831		Enterobacteria_phage(50.0%)	5	NA	NA
WP_000422890.1|3337567_3337963_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	33.6	8.3e-17
WP_000182072.1|3338646_3339369_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|3339653_3339818_+	membrane protein	NA	NA	NA	NA	NA
WP_001574231.1|3339808_3340024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000986168.1|3340040_3340691_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	8.5e-59
>prophage 232
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3348197	3350246	4925831		Moraxella_phage(100.0%)	1	NA	NA
WP_001091237.1|3348197_3350246_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
>prophage 233
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3355623	3355833	4925831		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3355623_3355833_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 234
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3363319	3364879	4925831		Moraxella_phage(100.0%)	1	NA	NA
WP_000421820.1|3363319_3364879_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 235
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3368849	3376161	4925831	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_000978454.1|3368849_3370214_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
WP_000457328.1|3370294_3370474_+	YoaH family protein	NA	NA	NA	NA	NA
WP_000029548.1|3370479_3370824_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128807.1|3370954_3372865_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_001221014.1|3372922_3373618_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290594.1|3373689_3374271_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_000758418.1|3374475_3376161_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
>prophage 236
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3410862	3413620	4925831		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001037188.1|3410862_3412548_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.3e-23
WP_001518537.1|3412672_3413620_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 237
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3416967	3422625	4925831		Pseudomonas_phage(33.33%)	7	NA	NA
WP_000804703.1|3416967_3418050_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
WP_000347310.1|3418049_3418883_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000150667.1|3418879_3419269_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257065.1|3419272_3420082_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811046.1|3420119_3420974_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
WP_000148418.1|3421027_3422128_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001519701.1|3422394_3422625_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	41.3	1.1e-05
>prophage 238
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3432964	3434500	4925831		Escherichia_phage(100.0%)	1	NA	NA
WP_000702629.1|3432964_3434500_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 239
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3439348	3445756	4925831		Synechococcus_phage(33.33%)	7	NA	NA
WP_001191156.1|3439348_3440191_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
WP_001540172.1|3440241_3440700_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001230575.1|3440810_3441716_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193432.1|3441806_3442820_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000729450.1|3443022_3443931_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
WP_001287383.1|3444062_3444476_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068095.1|3445138_3445756_+	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
>prophage 240
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3454127	3457020	4925831		Planktothrix_phage(33.33%)	3	NA	NA
WP_079822901.1|3454127_3455135_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	1.7e-13
WP_000994698.1|3455131_3456136_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
WP_000059074.1|3456183_3457020_+	voltage-gated potassium channel	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
>prophage 241
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3468682	3471640	4925831		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001195301.1|3468682_3470041_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.0e-37
WP_000763481.1|3470044_3471640_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	5.0e-52
>prophage 242
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3476621	3481960	4925831	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559310.1|3476621_3477383_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
WP_000422082.1|3477620_3478667_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	1.6e-19
WP_000548616.1|3478708_3478960_-	YciN family protein	NA	NA	NA	NA	NA
WP_000513593.1|3479362_3481960_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	2.4e-88
>prophage 243
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3487052	3487643	4925831		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176284.1|3487052_3487643_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 244
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3495468	3497403	4925831		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000485050.1|3495468_3497403_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.5	6.5e-06
>prophage 245
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3502780	3503587	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_000230462.1|3502780_3503587_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 246
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3522072	3522942	4925831		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000456767.1|3522072_3522942_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	5.1e-51
>prophage 247
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3526491	3527349	4925831		Streptococcus_phage(100.0%)	1	NA	NA
WP_010989022.1|3526491_3527349_-	helix-turn-helix domain-containing protein	NA	A0A1B0RXG1	Streptococcus_phage	28.1	2.0e-07
>prophage 248
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3537566	3545614	4925831	tRNA	Streptococcus_phage(20.0%)	10	NA	NA
WP_000945036.1|3537566_3538082_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	2.3e-22
WP_001046799.1|3538339_3538903_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000945607.1|3539313_3540468_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	1.2e-10
WP_000387373.1|3540613_3541597_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001750081.1|3541872_3542055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123685.1|3542083_3543457_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156208.1|3543500_3544436_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	9.4e-144
WP_000089153.1|3544646_3544799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159242.1|3544791_3545130_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001082296.1|3545179_3545614_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 249
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3550726	3551716	4925831		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762206.1|3550726_3551716_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.2e-69
>prophage 250
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3556508	3561922	4925831		Klosneuvirus(50.0%)	3	NA	NA
WP_024133307.1|3556508_3560411_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	28.8	5.5e-52
WP_001098517.1|3560474_3561275_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000527273.1|3561391_3561922_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	7.0e-19
>prophage 251
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3565683	3566415	4925831		Planktothrix_phage(100.0%)	1	NA	NA
WP_001196340.1|3565683_3566415_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.4e-24
>prophage 252
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3572953	3584103	4925831	transposase	Synechococcus_phage(25.0%)	8	NA	NA
WP_000842141.1|3572953_3574072_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	1.5e-31
WP_000528480.1|3574240_3575866_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.5e-07
WP_000414259.1|3575926_3576850_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000024092.1|3577142_3578486_+	VOC family protein	NA	NA	NA	NA	NA
WP_000933978.1|3578534_3580043_+	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	38.3	7.1e-32
WP_001081954.1|3580262_3581918_+	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_001024311.1|3582113_3582689_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_001352368.1|3582894_3584103_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 253
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3597482	3599447	4925831		Phage_TP(100.0%)	1	NA	NA
WP_001249753.1|3597482_3599447_+	U32 family peptidase	NA	Q6DW11	Phage_TP	26.7	8.6e-22
>prophage 254
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3617052	3619173	4925831		Salmonella_phage(100.0%)	1	NA	NA
WP_000692042.1|3617052_3619173_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	3.7e-135
>prophage 255
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3627114	3628659	4925831		Escherichia_phage(100.0%)	1	NA	NA
WP_000702596.1|3627114_3628659_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	8.3e-20
>prophage 256
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3636822	3637911	4925831		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000769035.1|3636822_3637911_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	75.1	4.0e-154
>prophage 257
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3644279	3645290	4925831		Tupanvirus(100.0%)	1	NA	NA
WP_000642447.1|3644279_3645290_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 258
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3666234	3666519	4925831		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000221343.1|3666234_3666519_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	5.2e-21
>prophage 259
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3685550	3686669	4925831		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000758335.1|3685550_3686669_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 260
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3695606	3695990	4925831		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091194.1|3695606_3695990_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 261
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3705275	3724557	4925831		Escherichia_phage(44.44%)	19	NA	NA
WP_000989267.1|3705275_3705479_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
WP_001181258.1|3705545_3707012_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.0	5.6e-42
WP_000949152.1|3707155_3707554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742688.1|3707557_3708535_-	MFS transporter	NA	NA	NA	NA	NA
WP_000836487.1|3708588_3709608_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_079822923.1|3709618_3710833_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.7	2.6e-45
WP_000921389.1|3710954_3711281_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	2.2e-23
WP_001066440.1|3711433_3711775_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000199997.1|3711810_3712371_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000743122.1|3712411_3713122_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000975516.1|3713225_3713534_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001117604.1|3713690_3716129_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	7.3e-220
WP_000705294.1|3716227_3718663_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.2	6.0e-206
WP_000213064.1|3718673_3719291_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	7.3e-76
WP_000534700.1|3719292_3720150_+	dimethyl sulfoxide reductase subunit H	NA	NA	NA	NA	NA
WP_000206561.1|3720192_3720807_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.3	2.5e-28
WP_000557304.1|3721111_3721822_+	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
WP_001211193.1|3721850_3722753_+	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
WP_000593086.1|3723408_3724557_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
>prophage 262
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3742271	3746676	4925831		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000824309.1|3742271_3743405_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.9	2.3e-120
WP_000928682.1|3743557_3745264_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000732951.1|3745374_3746676_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	4.4e-14
>prophage 263
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3768320	3769595	4925831	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_000168626.1|3768320_3769595_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 264
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3776510	3777032	4925831		Salmonella_phage(100.0%)	1	NA	NA
WP_000826819.1|3776510_3777032_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	60.3	3.1e-51
>prophage 265
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3782106	3789529	4925831		Streptococcus_phage(20.0%)	8	NA	NA
WP_001081022.1|3782106_3782961_+	NlpC/P60 family protein	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
WP_000007299.1|3783087_3783669_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	6.9e-44
WP_000102277.1|3783751_3783841_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_000190993.1|3784136_3785162_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
WP_000269523.1|3785158_3786091_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182309.1|3786203_3787409_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098879.1|3787698_3788847_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	2.5e-85
WP_000493971.1|3788887_3789529_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	8.8e-24
>prophage 266
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3813481	3817820	4925831		Ectocarpus_siliculosus_virus(50.0%)	3	NA	NA
WP_001050769.1|3813481_3816244_+	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.8	7.1e-30
WP_000666335.1|3816274_3816913_+	two component system response regulator	NA	NA	NA	NA	NA
WP_000122323.1|3817091_3817820_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.9	2.4e-46
>prophage 267
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3835674	3838884	4925831		environmental_halophage(50.0%)	3	NA	NA
WP_000143859.1|3835674_3836895_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.8	1.7e-92
WP_000907925.1|3836891_3838163_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948902.1|3838137_3838884_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	3.4e-11
>prophage 268
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3861249	3880878	4925831	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000117497.1|3861249_3862890_+	medium-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-20
WP_000069340.1|3862931_3865310_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.5e-172
WP_000370992.1|3865646_3866480_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082196.1|3866635_3867682_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.6	9.7e-81
WP_000089115.1|3867838_3868030_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175669.1|3868064_3869507_-	YdiU family protein	NA	NA	NA	NA	NA
WP_000562005.1|3869568_3870282_-	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
WP_001213256.1|3870595_3871060_-	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
WP_000080607.1|3871136_3871886_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
WP_001181565.1|3871885_3872437_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000954984.1|3872528_3873509_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229266.1|3873711_3874011_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672402.1|3874015_3876403_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|3876418_3877402_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|3877538_3877583_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|3877703_3878060_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3878110_3878308_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001574431.1|3878403_3878946_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001144223.1|3878949_3880878_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	4.2e-130
>prophage 269
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3902132	3902960	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_000174981.1|3902132_3902960_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.0e-72
>prophage 270
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3909658	3910885	4925831		Klosneuvirus(100.0%)	1	NA	NA
WP_000059493.1|3909658_3910885_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.7	1.6e-26
>prophage 271
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3914472	3916422	4925831		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235865.1|3914472_3916422_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	1.4e-40
>prophage 272
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3921307	3921964	4925831		Tupanvirus(100.0%)	1	NA	NA
WP_000184708.1|3921307_3921964_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	7.3e-18
>prophage 273
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3931373	3934794	4925831		Bacillus_phage(100.0%)	2	NA	NA
WP_000219714.1|3931373_3932660_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
WP_001048646.1|3933300_3934794_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	2.0e-10
>prophage 274
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3949755	3950553	4925831		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000950207.1|3949755_3950553_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
>prophage 275
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3955101	3955632	4925831		Escherichia_phage(100.0%)	1	NA	NA
WP_000929982.1|3955101_3955632_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 276
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3960271	3963614	4925831		Enterobacterial_phage(50.0%)	5	NA	NA
WP_000789471.1|3960271_3960829_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|3961640_3961904_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|3962035_3962248_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|3962662_3963184_+	lipoprotein	NA	NA	NA	NA	NA
WP_000497451.1|3963374_3963614_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 277
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	3967501	4017006	4925831	protease,transposase,head,tRNA,capsid,tail,terminase,integrase,holin,plate	Salmonella_phage(57.89%)	65	3989641:3989655	4013522:4013536
WP_000502119.1|3967501_3967960_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001521673.1|3968155_3968368_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_000334550.1|3968621_3969293_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|3969285_3970554_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|3970556_3970976_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|3971312_3971525_-	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|3971649_3972783_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|3972820_3973033_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_094445164.1|3973022_3973628_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.1	1.4e-100
WP_023244258.1|3973597_3974851_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.6	4.6e-178
WP_023171039.1|3974837_3975425_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|3975427_3976507_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|3976499_3976913_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|3976917_3977451_-|plate	phage baseplate assembly protein V	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|3977450_3978509_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_023171041.1|3978505_3979846_-|tail	tail/DNA circulation protein	tail	A0A192Y5U9	Salmonella_phage	99.3	1.1e-249
WP_023171042.1|3979879_3981808_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|3981892_3982219_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|3982215_3982572_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|3982571_3984068_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|3984057_3984222_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|3984243_3984789_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|3984785_3985298_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|3985269_3985683_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|3985694_3986018_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023171045.1|3986017_3986242_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.5e-10
WP_023171046.1|3986285_3987503_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|3987512_3988361_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
3989641:3989655	attL	GCGCTTTTTATTCGC	NA	NA	NA	NA
WP_077909829.1|3989677_3991420_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|3991373_3991838_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|3991970_3992315_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|3992449_3992677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|3992773_3993151_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|3993193_3993733_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|3993729_3994344_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|3994343_3994625_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|3994611_3994998_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|3995148_3996072_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|3996178_3997009_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|3997039_3998029_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|3998036_3998897_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|3998913_3999303_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_079822952.1|3999299_4000193_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.6	5.6e-162
WP_023171062.1|4000192_4000675_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|4000676_4001636_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|4001632_4001857_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023244168.1|4001853_4002996_-	antirepressor	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|4002992_4003547_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|4003575_4003800_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071591199.1|4003738_4003924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020640.1|4003897_4004593_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|4005407_4005779_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023171064.1|4005836_4006664_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|4006800_4007340_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_100514545.1|4007467_4008142_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	94.3	5.4e-40
WP_023171066.1|4008141_4008615_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|4009375_4009612_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|4009601_4010744_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|4010857_4012108_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|4012279_4012945_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|4012941_4013271_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476067.1|4013282_4013744_+	NUDIX hydrolase	NA	NA	NA	NA	NA
4013522:4013536	attR	GCGCTTTTTATTCGC	NA	NA	NA	NA
WP_000004541.1|4013797_4014904_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001519653.1|4014990_4015632_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423763.1|4015635_4017006_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
>prophage 278
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4023326	4025310	4925831		Bacillus_virus(50.0%)	2	NA	NA
WP_000531607.1|4023326_4024463_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
WP_000799391.1|4024446_4025310_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
>prophage 279
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4028896	4032622	4925831		Vibrio_phage(50.0%)	4	NA	NA
WP_001191856.1|4028896_4029718_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
WP_000291338.1|4029736_4030648_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000168091.1|4030676_4031921_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033714.1|4031920_4032622_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
>prophage 280
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4038806	4039064	4925831		Erwinia_phage(100.0%)	1	NA	NA
WP_000800159.1|4038806_4039064_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
>prophage 281
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4052225	4052867	4925831		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000535399.1|4052225_4052867_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	3.2e-26
>prophage 282
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4056141	4057268	4925831		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|4056141_4056378_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_000007236.1|4056533_4057268_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.7e-15
>prophage 283
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4071087	4072038	4925831		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000578692.1|4071087_4072038_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.8	2.2e-10
>prophage 284
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4088050	4088296	4925831		Salmonella_phage(100.0%)	1	NA	NA
WP_001217763.1|4088050_4088296_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	4.1e-14
>prophage 285
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4092954	4093875	4925831		Morganella_phage(100.0%)	1	NA	NA
WP_000163973.1|4092954_4093875_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.5	8.1e-55
>prophage 286
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4102938	4103478	4925831		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_000203944.1|4102938_4103478_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.7	2.9e-28
>prophage 287
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4107631	4108465	4925831		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001137620.1|4107631_4108465_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 288
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4118553	4122176	4925831		Aeromonas_phage(33.33%)	3	NA	NA
WP_000628082.1|4118553_4120050_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	22.9	4.9e-17
WP_000433674.1|4120334_4121216_+	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	28.9	3.3e-05
WP_001617488.1|4121321_4122176_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	5.9e-92
>prophage 289
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4130120	4130288	4925831		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001273663.1|4130120_4130288_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 290
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4138450	4138813	4925831		Phage_258-320(100.0%)	1	NA	NA
WP_001537781.1|4138450_4138813_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	2.4e-23
>prophage 291
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4152173	4152854	4925831		Bacillus_phage(100.0%)	1	NA	NA
WP_000698205.1|4152173_4152854_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	2.2e-33
>prophage 292
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4158627	4249355	4925831	protease,portal,tRNA,integrase,tail,terminase,holin,lysis	Salmonella_phage(44.07%)	101	4184356:4184375	4256143:4256162
WP_010989012.1|4158627_4158948_-	membrane protein	NA	E5G6P3	Salmonella_phage	76.6	1.2e-08
WP_001123045.1|4159165_4160041_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
WP_000938191.1|4160262_4160943_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|4161563_4162223_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|4162309_4162639_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|4162635_4162917_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|4162965_4163745_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|4163770_4164319_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|4164533_4165745_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|4165802_4166120_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|4166164_4166581_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|4166751_4167414_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|4167508_4167967_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|4168002_4170057_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|4170180_4170627_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|4170645_4172799_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|4172785_4173391_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|4173607_4174117_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|4174473_4175526_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|4175597_4176050_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|4176235_4177996_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|4178064_4178583_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_058664447.1|4178682_4178850_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|4179105_4179669_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|4179665_4181306_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|4181310_4182564_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|4182578_4184486_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
4184356:4184375	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|4184498_4186607_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|4186705_4187815_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|4187811_4188354_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|4188519_4189530_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|4189737_4192350_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|4192776_4192968_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|4193238_4193925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|4193909_4194209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|4194277_4194904_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|4195551_4196520_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|4196995_4197577_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|4197576_4200015_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|4200068_4200311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031615525.1|4200349_4201273_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	76.9	5.6e-56
WP_001541992.1|4201251_4203699_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_000246065.1|4203770_4204475_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|4204372_4205110_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|4205119_4205815_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|4205904_4206438_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|4206554_4207052_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|4207150_4207483_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_077905305.1|4207479_4210467_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	4.8e-266
WP_010989009.1|4210546_4210876_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|4210872_4211271_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|4211316_4212066_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|4212077_4212479_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|4212475_4213042_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|4213022_4213322_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|4213314_4213638_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|4213728_4215810_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|4215733_4217251_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|4217277_4217484_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|4217480_4219619_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|4219575_4220109_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|4220316_4220796_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|4220813_4221266_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|4221249_4221579_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|4221854_4222541_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|4222901_4223351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|4223486_4223612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|4223785_4224103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|4224169_4224967_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|4224956_4225103_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|4225099_4225711_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|4225713_4225920_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|4225919_4226522_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|4226604_4226826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|4226937_4227171_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|4227462_4227753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|4227830_4228142_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|4228138_4228486_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|4228496_4229246_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|4229248_4230232_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|4230316_4230691_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|4230656_4230896_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|4231015_4231426_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_077905303.1|4231475_4231736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|4231728_4231887_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|4231908_4232208_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017134.1|4232334_4235220_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.4	0.0e+00
WP_001539618.1|4235182_4236340_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|4236382_4236622_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|4236662_4236911_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|4236955_4238248_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|4238442_4239645_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|4239722_4241159_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|4241403_4242618_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|4242704_4242938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|4242934_4243396_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|4243596_4244997_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|4245603_4246695_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|4246879_4248070_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|4248131_4248779_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|4248806_4249355_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
4256143:4256162	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 293
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4264292	4268856	4925831		Bacillus_phage(66.67%)	3	NA	NA
WP_000551246.1|4264292_4266041_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
WP_000705784.1|4266077_4268342_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
WP_000167332.1|4268571_4268856_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
>prophage 294
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4273912	4275001	4925831		Streptococcus_phage(100.0%)	1	NA	NA
WP_000079584.1|4273912_4275001_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	1.2e-78
>prophage 295
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4279097	4283788	4925831		Tetraselmis_virus(100.0%)	4	NA	NA
WP_001292799.1|4279097_4281380_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
WP_001145555.1|4281455_4282415_-	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
WP_010989001.1|4282545_4282872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012539861.1|4282963_4283788_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
>prophage 296
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4288082	4303128	4925831	tRNA	Escherichia_phage(28.57%)	9	NA	NA
WP_000213069.1|4288082_4288700_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
WP_058664385.1|4288710_4291155_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	1.1e-223
WP_000886697.1|4291391_4292684_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067785.1|4292942_4294286_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_001519746.1|4294295_4294907_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001542260.1|4295049_4299105_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_000228469.1|4299239_4299734_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537407.1|4300279_4301248_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.1e-62
WP_001044541.1|4301361_4303128_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
>prophage 297
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4309132	4317864	4925831	protease,transposase	Enterobacteria_phage(14.29%)	8	NA	NA
WP_085983316.1|4309132_4310387_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_119920232.1|4310402_4310678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|4310850_4311309_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|4311500_4313777_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|4313807_4314128_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|4314451_4314673_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|4314802_4316749_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|4316745_4317864_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 298
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4324649	4326368	4925831		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815313.1|4324649_4326368_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.7e-29
>prophage 299
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4329957	4332709	4925831		Roseobacter_phage(50.0%)	4	NA	NA
WP_000645852.1|4329957_4330788_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	1.3e-08
WP_001160725.1|4330784_4331108_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270724.1|4331235_4331751_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027186.1|4331980_4332709_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
>prophage 300
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4339508	4348678	4925831		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149781.1|4339508_4340639_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.7	1.7e-25
WP_000505788.1|4340681_4341155_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_001061629.1|4341228_4342074_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105452.1|4342070_4343024_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001000698.1|4343033_4344167_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	6.5e-30
WP_000125769.1|4344254_4345367_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000624814.1|4345715_4346192_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684361.1|4346288_4347191_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
WP_000075300.1|4347248_4347971_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001259137.1|4347954_4348245_-	YbjC family protein	NA	NA	NA	NA	NA
WP_000495513.1|4348414_4348678_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
>prophage 301
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4356249	4358255	4925831		Escherichia_phage(50.0%)	2	NA	NA
WP_000450103.1|4356249_4357008_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	5.2e-15
WP_000195709.1|4357052_4358255_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	1.8e-99
>prophage 302
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4373779	4375651	4925831		Planktothrix_phage(100.0%)	1	NA	NA
WP_001120598.1|4373779_4375651_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.5	1.3e-14
>prophage 303
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4379972	4382405	4925831		Citrobacter_phage(100.0%)	1	NA	NA
WP_000192673.1|4379972_4382405_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 304
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4387123	4388716	4925831		Tupanvirus(100.0%)	1	NA	NA
WP_000961479.1|4387123_4388716_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	2.1e-58
>prophage 305
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4393702	4399010	4925831		Enterobacteria_phage(33.33%)	6	NA	NA
WP_000716763.1|4393702_4394218_-	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.2	1.1e-16
WP_001119554.1|4394571_4395459_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100805.1|4395761_4396265_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
WP_000838671.1|4396741_4397488_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159076.1|4397631_4398291_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569093.1|4398287_4399010_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
>prophage 306
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4402478	4411794	4925831		Acinetobacter_phage(25.0%)	8	NA	NA
WP_000146330.1|4402478_4402745_+	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	2.2e-13
WP_000849089.1|4403029_4403290_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000386494.1|4403445_4404420_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218630.1|4404449_4406594_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.7	7.4e-43
WP_000007060.1|4406801_4408166_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	3.0e-53
WP_001025254.1|4408395_4409070_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000743436.1|4409069_4410065_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001287616.1|4410057_4411794_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	3.5e-19
>prophage 307
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4423510	4424419	4925831		Streptococcus_phage(100.0%)	1	NA	NA
WP_001246033.1|4423510_4424419_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.9	7.8e-26
>prophage 308
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4433667	4437096	4925831		Klosneuvirus(50.0%)	3	NA	NA
WP_000205518.1|4433667_4434957_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	7.7e-19
WP_000767419.1|4435014_4435491_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001095227.1|4435575_4437096_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.2e-81
>prophage 309
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4445553	4453171	4925831		Planktothrix_phage(33.33%)	8	NA	NA
WP_000891710.1|4445553_4446612_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
WP_000604026.1|4446614_4447304_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000951416.1|4447303_4448077_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891513.1|4448243_4448393_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_001147410.1|4448521_4449310_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096928.1|4449377_4450853_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
WP_000885513.1|4451023_4451932_+	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
WP_001265465.1|4452154_4453171_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
>prophage 310
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4457479	4458256	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_001214710.1|4457479_4458256_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	4.9e-13
>prophage 311
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4463934	4465203	4925831		Oenococcus_phage(100.0%)	1	NA	NA
WP_000074128.1|4463934_4465203_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	26.6	3.2e-33
>prophage 312
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4468928	4472452	4925831		Edwardsiella_phage(33.33%)	4	NA	NA
WP_001109234.1|4468928_4469981_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.1	3.7e-80
WP_000784380.1|4470300_4470687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951246.1|4470797_4471736_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	6.1e-26
WP_000345368.1|4471732_4472452_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.3	3.7e-23
>prophage 313
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4498881	4499673	4925831		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113970.1|4498881_4499673_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.7	6.8e-10
>prophage 314
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4504777	4511970	4925831	integrase	Staphylococcus_phage(33.33%)	8	4501260:4501274	4513210:4513224
4501260:4501274	attL	TCAGCATGAACATTG	NA	NA	NA	NA
WP_000702849.1|4504777_4505488_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	2.2e-07
WP_000998823.1|4505491_4506262_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000824901.1|4506390_4507524_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001524627.1|4507536_4508430_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001524621.1|4508429_4509581_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.9	2.8e-81
WP_001194239.1|4509866_4510607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010988980.1|4510608_4510944_-	membrane protein	NA	NA	NA	NA	NA
WP_000824704.1|4511403_4511970_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	54.4	4.3e-51
4513210:4513224	attR	CAATGTTCATGCTGA	NA	NA	NA	NA
>prophage 315
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4515878	4523311	4925831		Acinetobacter_phage(33.33%)	6	NA	NA
WP_001041123.1|4515878_4517360_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
WP_001142016.1|4517398_4518820_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.7	6.0e-57
WP_000401437.1|4518930_4519137_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001670793.1|4519473_4519563_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000730066.1|4519562_4521242_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000088022.1|4521262_4523311_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	1.9e-27
>prophage 316
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4526581	4527259	4925831		Bacillus_phage(100.0%)	1	NA	NA
WP_000186054.1|4526581_4527259_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	5.8e-26
>prophage 317
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4538342	4548340	4925831	tRNA	Lactobacillus_phage(25.0%)	7	NA	NA
WP_000228709.1|4538342_4539746_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
WP_000811134.1|4539732_4540872_+	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
WP_000057014.1|4540922_4542227_+	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
WP_000722261.1|4542275_4542608_-	lipoprotein	NA	NA	NA	NA	NA
WP_001258803.1|4542657_4544064_-	chitoporin	NA	NA	NA	NA	NA
WP_001287181.1|4544509_4546177_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
WP_001023068.1|4546387_4548340_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
>prophage 318
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4552993	4554658	4925831		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337041.1|4552993_4554658_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.2	9.4e-86
>prophage 319
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4559275	4560361	4925831		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000493272.1|4559275_4560361_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.6e-48
>prophage 320
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4566261	4571064	4925831		Planktothrix_phage(50.0%)	4	NA	NA
WP_000631369.1|4566261_4566987_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
WP_001207419.1|4567103_4568039_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000498891.1|4568070_4569309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000368034.1|4569384_4571064_+	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	36.2	6.2e-77
>prophage 321
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4581889	4584472	4925831	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157918.1|4581889_4584472_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.6e-185
>prophage 322
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4592699	4595196	4925831		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231300.1|4592699_4593845_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.9e-09
WP_000858711.1|4593984_4595196_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
>prophage 323
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4599152	4600682	4925831		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_000495780.1|4599152_4599941_-	deaminated glutathione amidase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	23.9	1.3e-05
WP_000939753.1|4600031_4600415_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
WP_000034826.1|4600472_4600682_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
>prophage 324
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4615795	4622342	4925831		Morganella_phage(33.33%)	6	NA	NA
WP_000278499.1|4615795_4616224_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
WP_000417097.1|4616291_4617059_-	hydrogenase	NA	NA	NA	NA	NA
WP_001250381.1|4617058_4617616_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000064328.1|4617612_4619892_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.5	1.0e-45
WP_000377438.1|4619884_4620445_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000887644.1|4620776_4622342_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
>prophage 325
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4625718	4627544	4925831		Streptococcus_phage(50.0%)	2	NA	NA
WP_000118144.1|4625718_4626954_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.9e-60
WP_001164756.1|4626926_4627544_+	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	51.3	3.0e-53
>prophage 326
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4642016	4648134	4925831		Klosneuvirus(50.0%)	3	NA	NA
WP_000140620.1|4642016_4642811_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.9	2.2e-08
WP_001139584.1|4642863_4644000_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000194139.1|4644249_4648134_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.5	3.8e-61
>prophage 327
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4671942	4678792	4925831		Salmonella_phage(75.0%)	6	NA	NA
WP_000195929.1|4671942_4673268_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.0e-103
WP_000339633.1|4673483_4674338_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000946038.1|4674676_4675006_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_000915523.1|4675873_4676236_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_000703614.1|4676232_4677159_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	97.7	3.8e-169
WP_010988978.1|4677139_4678792_+	membrane protein	NA	B9UDL6	Salmonella_phage	37.9	6.7e-84
>prophage 328
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4690027	4694461	4925831	tRNA	Enterococcus_phage(50.0%)	6	NA	NA
WP_000729165.1|4690027_4690894_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
WP_000190278.1|4690895_4691108_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143507.1|4691235_4691781_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001038573.1|4691773_4692211_+	STM0539 family protein	NA	NA	NA	NA	NA
WP_000819114.1|4692207_4693032_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_000912376.1|4693075_4694461_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
>prophage 329
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4705746	4706895	4925831		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706331.1|4705746_4706895_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	39.0	9.1e-48
>prophage 330
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4714345	4716127	4925831		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001096872.1|4714345_4716127_-	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.3	1.1e-39
>prophage 331
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4720598	4721615	4925831		Planktothrix_phage(100.0%)	1	NA	NA
WP_000569660.1|4720598_4721615_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
>prophage 332
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4726468	4727155	4925831		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110598.1|4726468_4727155_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.1e-31
>prophage 333
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4730430	4735648	4925831		Bacillus_virus(50.0%)	5	NA	NA
WP_000140195.1|4730430_4731108_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	3.0e-22
WP_000906146.1|4731254_4732172_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000561177.1|4732168_4732621_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001026760.1|4732621_4733038_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
WP_000083899.1|4733146_4735648_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.4	6.1e-113
>prophage 334
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4744748	4753351	4925831		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801786.1|4744748_4745720_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	6.6e-15
WP_001250078.1|4745716_4746679_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220237.1|4746907_4747552_-	adenylate kinase	NA	NA	NA	NA	NA
WP_001520210.1|4747792_4749667_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	7.5e-116
WP_001195023.1|4749777_4750383_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|4750382_4750712_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000121962.1|4750757_4752686_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
WP_000127350.1|4752799_4753351_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
>prophage 335
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4773280	4776827	4925831		Bacillus_phage(100.0%)	2	NA	NA
WP_001256070.1|4773280_4775062_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	5.4e-39
WP_001235572.1|4775054_4776827_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	6.1e-51
>prophage 336
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4781227	4781923	4925831		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817201.1|4781227_4781923_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
>prophage 337
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4785216	4790384	4925831	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043544.1|4785216_4785489_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
WP_001067735.1|4785697_4788052_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	3.6e-224
WP_000130314.1|4788237_4789509_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
WP_000122257.1|4789760_4790384_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 338
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4811458	4812568	4925831		Bacillus_virus(100.0%)	1	NA	NA
WP_000928801.1|4811458_4812568_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.8	2.8e-25
>prophage 339
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4822084	4823747	4925831		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001021372.1|4822084_4822555_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	1.0e-29
WP_001150216.1|4822643_4823747_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.5e-50
>prophage 340
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4828430	4832770	4925831	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000046629.1|4828430_4829402_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
WP_000934811.1|4829412_4831260_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007628.1|4831287_4831620_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
WP_000667305.1|4831642_4832770_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
>prophage 341
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4840741	4850661	4925831		Bacillus_phage(50.0%)	6	NA	NA
WP_000893645.1|4840741_4842037_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	2.0e-27
WP_000113921.1|4842106_4842796_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_001526312.1|4844208_4847349_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	3.4e-12
WP_000755620.1|4847521_4848694_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219277.1|4848715_4849624_-	fructokinase	NA	NA	NA	NA	NA
WP_000964305.1|4849749_4850661_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	7.1e-104
>prophage 342
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4854348	4855461	4925831		Bacillus_phage(100.0%)	1	NA	NA
WP_000484086.1|4854348_4855461_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.1	7.3e-18
>prophage 343
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4870016	4871903	4925831		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010229.1|4870016_4871903_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	1.2e-52
>prophage 344
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4885319	4895031	4925831		Escherichia_phage(33.33%)	6	NA	NA
WP_001651666.1|4885319_4888292_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.2	3.5e-83
WP_000910371.1|4888301_4890260_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	32.2	1.3e-81
WP_000288496.1|4890448_4891702_-	MFS transporter	NA	NA	NA	NA	NA
WP_001159470.1|4891994_4892189_-	gold resistance metallochaperone GolB	NA	NA	NA	NA	NA
WP_001020583.1|4892266_4892731_-	Au(I) sensor transcriptional regulator GolS	NA	NA	NA	NA	NA
WP_000083318.1|4892742_4895031_-	gold/copper-translocating P-type ATPase GolT	NA	E4ZFI9	Streptococcus_phage	33.3	7.1e-92
>prophage 345
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4902678	4903203	4925831		Escherichia_phage(100.0%)	1	NA	NA
WP_000830237.1|4902678_4903203_-	outer membrane protein	NA	B0FEG7	Escherichia_phage	29.2	1.3e-09
>prophage 346
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4915747	4916020	4925831		Salmonella_phage(100.0%)	1	NA	NA
WP_001675688.1|4915747_4916020_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
>prophage 347
NZ_CP044188	Salmonella enterica subsp. enterica strain AR-0401 chromosome, complete genome	4925831	4925055	4925418	4925831		Salmonella_phage(100.0%)	1	NA	NA
WP_000915528.1|4925055_4925418_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
>prophage 1
NZ_CP044189	Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-1, complete sequence	90935	34339	70846	90935	transposase	Escherichia_phage(27.27%)	57	NA	NA
WP_000844627.1|34339_34582_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|34613_35291_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|35369_36569_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|36835_37141_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214119.1|37168_38383_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001447541.1|38599_39484_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|39514_41008_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|41218_41443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|41439_42177_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001550559.1|42283_42775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|42808_43513_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|44063_44768_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000062185.1|44928_45426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286591.1|45428_45890_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
WP_001326176.1|46007_46349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281821.1|46363_46834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516916.1|46826_47198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343597.1|47208_47403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000333619.1|47402_47654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001061574.1|47743_48292_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000270043.1|48454_48805_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_000124640.1|48809_49112_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001239997.1|49138_49432_-	chromosome segregation protein ParM	NA	NA	NA	NA	NA
WP_001043047.1|49519_49792_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
WP_001236377.1|49849_50377_-	thermonuclease family protein	NA	O64020	Bacillus_phage	37.0	1.3e-09
WP_001270411.1|50393_50582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167032.1|50607_51465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972663.1|51451_51682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210756.1|51681_52200_-	nitrite reductase	NA	NA	NA	NA	NA
WP_000919345.1|52196_52643_-	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000422768.1|52642_53002_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000591074.1|53058_53487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139698.1|53520_54381_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001326179.1|54396_55374_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
WP_000539392.1|55355_56210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902149.1|56214_56529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326180.1|56518_56962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099257002.1|57342_57462_-	invasion protein	NA	NA	NA	NA	NA
WP_000019163.1|57455_57728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198533.1|57708_58917_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000393785.1|59325_59847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000849071.1|59851_60460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946102.1|60728_61844_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
WP_000883925.1|61861_62296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337766.1|62499_62685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326182.1|62705_62987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350011.1|63332_64433_-	plasmid replication protein	NA	NA	NA	NA	NA
WP_000127321.1|64417_64705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375812.1|64709_65276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077458.1|65747_66731_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
WP_000919078.1|66747_67041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|67042_67462_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001020646.1|67521_68073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891157.1|68069_68678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000790610.1|68688_69222_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_079822954.1|69221_69479_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	40.5	2.3e-07
WP_000198533.1|69637_70846_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
