The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	582847	640033	4963375	integrase,transposase	uncultured_Caudovirales_phage(21.74%)	54	573539:573553	644010:644024
573539:573553	attL	GCTGCTTTCGCCCAC	NA	NA	NA	NA
WP_006781417.1|582847_583849_-|integrase	site-specific integrase	integrase	M1TW19	Prochlorococcus_phage	21.4	4.9e-05
WP_006781415.1|583906_585550_-	Helicase/Zfx / Zfy transcription activation region domain protein	NA	NA	NA	NA	NA
WP_006781413.1|585616_587125_-	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	31.1	7.0e-48
WP_006781411.1|587253_587937_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	39.1	7.9e-31
WP_006781409.1|588045_588978_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_006781408.1|589083_590070_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.7	4.9e-50
WP_006781405.1|590151_590499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006781404.1|590566_591169_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_006781402.1|591244_591892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006781400.1|591976_592342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006781398.1|592855_593188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020899206.1|593762_594743_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
WP_004388336.1|595669_596104_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_006785898.1|596319_597720_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|597716_598397_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_000998778.1|598451_599381_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|599385_599766_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_020899208.1|599805_600702_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|600701_602519_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|602752_603202_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|603490_604228_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_000843497.1|604261_604459_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_129244003.1|604499_606971_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.1	2.2e-83
WP_002436620.1|607068_607509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000574021.1|607595_610742_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_001485328.1|610752_612045_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|612158_612512_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475503.1|612540_613926_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697968.1|614115_614796_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000555738.1|614788_616264_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.3	1.9e-26
WP_006785880.1|616513_616945_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_006785879.1|617093_617444_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	52.4	1.0e-18
WP_006785878.1|617610_618243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087464944.1|618306_619454_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.9	4.3e-146
WP_020899211.1|619858_620476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006786007.1|620544_621444_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_020899212.1|622375_623074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020899213.1|623134_623680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006786005.1|623832_624867_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.2	8.9e-111
WP_023202697.1|624916_626191_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.0	4.4e-144
WP_006786002.1|626232_626673_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_006786000.1|626866_627766_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020899215.1|627864_628392_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.1	7.2e-16
WP_006785998.1|628388_629621_+	MFS transporter	NA	NA	NA	NA	NA
WP_006785996.1|629669_630005_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023202699.1|630010_630724_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.7	1.2e-95
WP_006785993.1|630780_631209_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.2e-50
WP_006785992.1|631258_632542_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.1	2.9e-175
WP_006785991.1|632638_632992_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	2.2e-21
WP_006785990.1|633254_633713_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_101828536.1|634221_636423_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.4	1.9e-134
WP_006785988.1|636500_636800_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_006785987.1|636929_639056_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_023259011.1|639055_640033_-|integrase	site-specific integrase	integrase	A0A166YH27	Gordonia_phage	33.1	7.4e-06
644010:644024	attR	GCTGCTTTCGCCCAC	NA	NA	NA	NA
>prophage 2
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	786892	823532	4963375	transposase,terminase,head,portal,tRNA,protease,capsid,tail	uncultured_Caudovirales_phage(50.0%)	35	NA	NA
WP_115400697.1|786892_788147_+|transposase	IS3 family transposase	transposase	B6DZX3	Stx2-converting_phage	30.3	1.7e-18
WP_001076978.1|788164_788818_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
WP_000566824.1|789254_789551_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000928927.1|789624_789834_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_020899265.1|790091_790712_+	YqiJ family protein	NA	NA	NA	NA	NA
WP_020899266.1|790730_792410_+	flotillin family protein	NA	NA	NA	NA	NA
WP_106086611.1|792489_792708_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000867682.1|792867_794301_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
WP_000188315.1|794348_797192_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_020899267.1|797309_798611_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_001125341.1|798852_799467_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000708449.1|799529_800771_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
WP_001281933.1|800875_801697_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000355776.1|801794_802154_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272785.1|802260_802878_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_001264391.1|803101_804115_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|804342_804558_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|804793_806539_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|806688_808536_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|808659_809166_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_032422831.1|809463_809655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951286.1|809710_813118_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.6	2.1e-188
WP_057951287.1|813131_814793_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	93.7	9.2e-312
WP_004857981.1|814776_815133_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	3.0e-50
WP_004857975.1|815407_815851_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	8.6e-79
WP_057951288.1|815850_816144_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	91.8	3.7e-46
WP_004857971.1|816140_816479_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	92.0	3.6e-53
WP_057951289.1|816475_817711_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	94.9	3.3e-229
WP_057951290.1|817712_818273_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	96.2	2.5e-99
WP_057951291.1|818324_819488_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	93.8	5.5e-202
WP_032422848.1|819722_819905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951292.1|820207_821959_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	51.8	5.0e-130
WP_001250274.1|821942_822161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001209042.1|822157_822352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077945482.1|822344_823532_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	42.5	2.6e-05
>prophage 3
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	952197	1006173	4963375	terminase,head,portal,tRNA,protease,capsid,tail	uncultured_Caudovirales_phage(66.67%)	55	NA	NA
WP_000366112.1|952197_952698_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
WP_000257298.1|952703_953342_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_077909715.1|953604_954357_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_000829815.1|954556_954949_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|954964_955393_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001191222.1|955694_956819_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001519074.1|957011_957410_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_020899295.1|957566_958934_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	3.5e-22
WP_000497705.1|959026_960097_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_077909693.1|960130_960829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020899297.1|960881_962183_-	oxalacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_020899298.1|962195_963965_-	oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_020899299.1|963980_964229_-	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_000162405.1|964385_965003_-	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_020899300.1|965002_965902_-	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_020899301.1|965934_967164_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	1.2e-56
WP_020899302.1|967374_968040_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000723776.1|968026_968656_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000861586.1|968775_969714_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257852.1|970128_970599_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695695.1|970963_971227_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_000853277.1|971330_971597_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001103887.1|971656_971929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510913.1|972100_974068_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000855134.1|974073_975006_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051840.1|975013_975217_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440300.1|975398_976328_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055940.1|976449_977895_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_020899303.1|978039_981840_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123188.1|981950_983420_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000210306.1|983409_984003_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000226619.1|984011_984503_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802538.1|984502_985555_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|985619_986663_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241381.1|986970_988911_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148246.1|989114_990089_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000723876.1|990201_991206_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_020899304.1|991206_991806_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_012219275.1|991873_992056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000354626.1|992198_992669_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884627.1|992679_994029_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000340016.1|994137_994380_+	YhdT family protein	NA	NA	NA	NA	NA
WP_020899305.1|994369_995821_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_001145849.1|995832_996714_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219664.1|997375_998341_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|998366_998663_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001547818.1|998820_999129_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_019077808.1|1000925_1001282_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.1	3.3e-57
WP_019077810.1|1001555_1001999_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.3	8.4e-50
WP_019077811.1|1001998_1002292_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	91.8	1.8e-45
WP_151092442.1|1002288_1002633_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	88.0	7.2e-49
WP_057951304.1|1002622_1003858_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.6	3.3e-237
WP_057951305.1|1003859_1004420_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.3	1.1e-99
WP_057951306.1|1004471_1005638_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.2	9.8e-215
WP_057951307.1|1005870_1006173_-	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	85.3	1.7e-41
>prophage 4
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	1666227	1681258	4963375	terminase,head,integrase,portal,protease,capsid,tail	uncultured_Caudovirales_phage(83.33%)	17	1660051:1660065	1675193:1675207
1660051:1660065	attL	CCGCCGTCAGCCTGC	NA	NA	NA	NA
WP_004149996.1|1666227_1667448_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	63.0	3.5e-154
WP_019077825.1|1667447_1668098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019077824.1|1668678_1668963_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_025861177.1|1670064_1670268_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	41.4	3.7e-05
WP_032174324.1|1670681_1670876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019077819.1|1670872_1671079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019077818.1|1671068_1671323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057951308.1|1671319_1674010_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	54.1	1.5e-274
WP_057951307.1|1674364_1674667_+	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	85.3	1.7e-41
WP_057951306.1|1674899_1676066_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.2	9.8e-215
1675193:1675207	attR	GCAGGCTGACGGCGG	NA	NA	NA	NA
WP_057951305.1|1676117_1676678_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.3	1.1e-99
WP_057951304.1|1676679_1677915_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.6	3.3e-237
WP_019077812.1|1677911_1678250_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	88.4	2.6e-51
WP_019077811.1|1678246_1678540_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	91.8	1.8e-45
WP_019077810.1|1678539_1678983_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.3	8.4e-50
WP_019077808.1|1679256_1679613_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.1	3.3e-57
WP_019077807.1|1679596_1681258_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.1	0.0e+00
>prophage 5
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	1871885	1892905	4963375	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|1871885_1872614_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_024142925.1|1873192_1873609_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_023888617.1|1874440_1874995_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_020838432.1|1874999_1876745_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	6.4e-53
WP_020838433.1|1876747_1877380_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	2.5e-23
WP_057951300.1|1877372_1878488_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.2	1.3e-99
WP_001093501.1|1878478_1878838_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095010.1|1879001_1880549_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703634.1|1880548_1881478_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000593182.1|1881474_1881837_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_071786955.1|1881912_1882155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000679393.1|1882163_1882886_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_020838438.1|1882895_1883939_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|1883926_1884136_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_020838439.1|1884135_1885089_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_020838441.1|1885088_1887455_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.9	1.3e-69
WP_001185654.1|1887551_1887680_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003640.1|1887639_1887957_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|1888008_1888533_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_020838443.1|1888532_1889960_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	4.0e-194
WP_020838445.1|1889949_1890147_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_057951301.1|1890143_1890599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|1890758_1891073_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_020838446.1|1891085_1891691_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	9.3e-60
WP_001226439.1|1891693_1891981_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|1892557_1892905_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 6
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	1918747	1960303	4963375	terminase,head,portal,lysis,protease,capsid,tail	Salmonella_phage(58.82%)	70	NA	NA
WP_020838468.1|1918747_1919281_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	84.7	8.7e-86
WP_020838472.1|1919714_1919987_-	Pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	1.2e-38
WP_020838474.1|1920025_1920598_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.1	3.0e-92
WP_020838478.1|1921279_1921519_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	65.4	2.2e-20
WP_020838479.1|1921518_1922052_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	94.3	4.6e-95
WP_020838481.1|1922080_1922314_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	1.6e-12
WP_020838482.1|1922310_1922901_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	68.7	1.9e-65
WP_001214770.1|1922897_1923068_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_001111322.1|1923078_1923372_-	DUF2856 family protein	NA	I6R984	Salmonella_phage	96.9	2.7e-49
WP_001016189.1|1923387_1923936_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	98.9	6.6e-105
WP_000168281.1|1923944_1924451_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	100.0	1.0e-91
WP_039517890.1|1924451_1925159_-	recombinase	NA	E7C9Q0	Salmonella_phage	97.4	1.9e-136
WP_001552364.1|1925167_1925356_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
WP_000361564.1|1925352_1925466_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_020838488.1|1925458_1925620_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	4.9e-24
WP_020838489.1|1925833_1926334_-	endonuclease	NA	A5H1L2	Xanthomonas_virus	43.2	9.8e-31
WP_020838490.1|1926417_1926612_-	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	98.4	6.0e-29
WP_000216184.1|1926690_1927026_-	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	86.9	5.0e-47
WP_125866875.1|1927046_1927229_-	hypothetical protein	NA	A0A220NQW5	Salmonella_phage	96.7	6.3e-28
WP_000786967.1|1927605_1927815_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	1.2e-27
WP_000248005.1|1927850_1928774_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.3	1.6e-180
WP_000712404.1|1928862_1929552_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	100.0	2.9e-126
WP_000182204.1|1929662_1929878_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_017441422.1|1929985_1930264_+	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	91.3	6.4e-40
WP_001125981.1|1930298_1930445_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001531205.1|1930437_1931271_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.9	4.6e-150
WP_057951302.1|1931267_1932644_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	99.6	2.2e-253
WP_000158322.1|1932640_1932919_+	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	96.6	8.7e-45
WP_001227831.1|1932992_1933187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000440794.1|1933186_1933477_+	hypothetical protein	NA	E7C9R6	Salmonella_phage	99.0	1.1e-50
WP_000049339.1|1933479_1933776_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	100.0	1.1e-48
WP_000811304.1|1933732_1934179_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	100.0	3.2e-81
WP_000679702.1|1934175_1934349_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_001659070.1|1934315_1934492_+	NinE family protein	NA	I6RSI9	Salmonella_phage	100.0	2.3e-27
WP_042948987.1|1934488_1934668_+	NinF family protein	NA	I6R994	Salmonella_phage	94.9	6.2e-28
WP_001531202.1|1934642_1935251_+	protein ninG	NA	I6S604	Salmonella_phage	95.0	6.4e-93
WP_000188966.1|1935247_1935451_+	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	100.0	1.6e-32
WP_042948986.1|1935431_1935611_+	hypothetical protein	NA	A0A2H4FS09	Salmonella_phage	98.3	1.6e-23
WP_023230822.1|1935607_1935850_+	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	100.0	1.6e-39
WP_023253536.1|1936007_1936619_+	hypothetical protein	NA	A0A1V0E5R2	Salmonella_phage	100.0	2.3e-114
WP_000947857.1|1936897_1937416_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
WP_000781414.1|1937639_1937912_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
WP_023216140.1|1937911_1938409_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	93.9	3.0e-88
WP_001674383.1|1938497_1938935_+|lysis	lysis protein	lysis	I6RSJ6	Salmonella_phage	99.3	1.3e-71
WP_020898878.1|1939053_1939398_+	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
WP_000919034.1|1939530_1939995_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_094445197.1|1939948_1941691_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.6	1.2e-139
WP_024147151.1|1941690_1942998_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	4.2e-214
WP_042827537.1|1943011_1943860_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.3e-131
WP_010835821.1|1943869_1945087_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
WP_001648718.1|1945130_1945328_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	4.9e-10
WP_001648719.1|1945327_1945654_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_020898872.1|1945663_1946002_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_010835820.1|1945998_1946448_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
WP_001648721.1|1946444_1946792_+	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
WP_000097142.1|1946848_1947553_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
WP_001129939.1|1947580_1947952_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
WP_024134502.1|1947975_1948254_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
WP_139774748.1|1948307_1948763_+	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	39.8	2.4e-07
WP_151092448.1|1948796_1952087_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	65.5	7.8e-310
WP_001552342.1|1952132_1952489_+	hypothetical protein	NA	S4TNM6	Salmonella_phage	100.0	1.1e-57
WP_088730722.1|1952456_1952678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057951278.1|1952840_1953434_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.9	1.2e-107
WP_151092451.1|1953433_1954018_+	hypothetical protein	NA	S4TND4	Salmonella_phage	97.9	8.3e-106
WP_000682267.1|1954024_1954423_+	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
WP_023252584.1|1954422_1957143_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	98.2	0.0e+00
WP_020898865.1|1957151_1958111_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	1.4e-182
WP_020838543.1|1958120_1959458_+	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	51.8	3.4e-110
WP_003840850.1|1959592_1959835_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_020838546.1|1959913_1960303_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	73.6	9.3e-53
>prophage 7
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	3357180	3364949	4963375	protease,transposase	Dickeya_phage(16.67%)	6	NA	NA
WP_020898591.1|3357180_3358299_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125894.1|3358295_3360242_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|3360371_3360593_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|3360916_3361237_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|3361267_3363544_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_115399553.1|3363693_3364949_-|transposase	IS3 family transposase	transposase	B6DZX3	Stx2-converting_phage	30.3	1.7e-18
>prophage 8
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	4270150	4351935	4963375	terminase,head,holin,integrase,portal,tRNA,protease,capsid,tail	Salmonella_phage(43.75%)	96	4300425:4300445	4345451:4345471
WP_072144994.1|4270150_4270510_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	46.1	1.5e-20
WP_000722368.1|4270872_4271226_-	YebY family protein	NA	NA	NA	NA	NA
WP_020898858.1|4271242_4272118_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168394.1|4272118_4272493_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|4272630_4272861_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_057951298.1|4272968_4273625_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_020898859.1|4273648_4274347_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
WP_000937000.1|4274383_4276435_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024707.1|4276647_4277307_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001042123.1|4277400_4277754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257723.1|4277821_4278112_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173430.1|4278242_4279421_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800494.1|4279520_4280162_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_020898860.1|4280199_4282011_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301711.1|4282245_4283721_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
WP_020898861.1|4284062_4284932_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091156.1|4285055_4286498_+	pyruvate kinase II	NA	NA	NA	NA	NA
WP_000448401.1|4286570_4287542_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184028.1|4287658_4288978_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
WP_000939597.1|4288993_4289938_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000203023.1|4290016_4290772_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
WP_000571508.1|4290768_4291554_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568504.1|4291632_4292643_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
WP_000580335.1|4292651_4293263_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010989032.1|4293682_4294579_+	DUF4034 domain-containing protein	NA	NA	NA	NA	NA
WP_000716753.1|4295205_4295805_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000022509.1|4295806_4296328_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_000907242.1|4296364_4297105_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000653693.1|4297134_4297587_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258633.1|4297689_4299462_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000916144.1|4299786_4300353_+	hydrolase	NA	NA	NA	NA	NA
4300425:4300445	attL	GCCCGCCACTTTAACTGCGTG	NA	NA	NA	NA
WP_057951297.1|4300675_4301347_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	3.4e-79
WP_020898863.1|4301339_4302608_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	98.3	2.2e-244
WP_000394200.1|4302610_4303030_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
WP_020898864.1|4303271_4304576_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	56.6	2.7e-128
WP_020898865.1|4304585_4305545_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	1.4e-182
WP_023252584.1|4305553_4308274_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	98.2	0.0e+00
WP_023252583.1|4308273_4308672_-	hypothetical protein	NA	S4TR39	Salmonella_phage	97.0	3.7e-73
WP_023252582.1|4308678_4309263_-	hypothetical protein	NA	S4TND4	Salmonella_phage	97.9	1.1e-105
WP_000729325.1|4309262_4309856_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	100.0	8.7e-111
WP_000064923.1|4310021_4310234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171561.1|4310272_4310584_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	80.2	1.7e-36
WP_079961837.1|4310629_4313920_-|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	67.6	0.0e+00
WP_020898867.1|4313983_4314583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020898868.1|4314650_4314947_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	2.9e-46
WP_020898869.1|4314958_4315330_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	90.1	4.8e-59
WP_020898870.1|4315357_4316062_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	75.2	1.2e-93
WP_020898871.1|4316119_4316467_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	77.9	8.3e-45
WP_000573486.1|4316463_4316913_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	95.3	2.1e-72
WP_020898872.1|4316909_4317248_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_001648719.1|4317257_4317584_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_151092457.1|4317554_4317992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010835821.1|4317896_4319114_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
WP_023194831.1|4319123_4319972_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	4.4e-132
WP_000002706.1|4319985_4321290_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.9	5.1e-220
WP_031234234.1|4321289_4323032_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.4	5.9e-139
WP_000919034.1|4322985_4323450_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_023252892.1|4323582_4323927_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	3.9e-47
WP_000495546.1|4323994_4324372_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	66.1	1.2e-41
WP_001050802.1|4324414_4324954_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	46.6	3.7e-07
WP_057951285.1|4324950_4325565_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	2.5e-108
WP_000226307.1|4325564_4325846_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294873.1|4325832_4326222_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_000658039.1|4326313_4326502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071786602.1|4326556_4326748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023195403.1|4327028_4327454_-	subtilase	NA	A0A0U2KD34	Escherichia_phage	36.8	2.9e-07
WP_023195404.1|4327586_4328312_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	66.2	5.2e-81
WP_023195405.1|4328510_4329089_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.8	3.2e-49
WP_024150042.1|4329103_4330093_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	4.1e-190
WP_023252182.1|4330100_4330961_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	3.5e-161
WP_023195408.1|4330977_4331367_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	86.8	4.2e-61
WP_023252183.1|4331363_4331684_-	hypothetical protein	NA	S5FXP5	Shigella_phage	56.6	4.4e-24
WP_023252184.1|4331680_4333411_-	DNA cytosine methylase	NA	H9C171	Pectobacterium_phage	57.6	4.1e-217
WP_023252185.1|4333403_4334282_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	87.4	7.8e-148
WP_023252186.1|4334281_4334764_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	4.6e-86
WP_000620702.1|4335720_4335945_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_038806766.1|4335941_4337084_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	97.4	8.1e-206
WP_023252951.1|4337080_4337635_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	4.5e-101
WP_001191666.1|4337663_4337888_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_023252952.1|4337985_4338681_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.1	1.7e-126
WP_000997190.1|4339494_4339866_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080410.1|4339923_4340751_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.9	1.1e-151
WP_000008351.1|4340887_4341427_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023253683.1|4341497_4342037_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	71.3	2.5e-64
WP_020898896.1|4342036_4342396_+	hypothetical protein	NA	A0A1L7N114	Ralstonia_phage	49.1	2.1e-22
WP_031617777.1|4342400_4343222_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	46.1	1.5e-60
WP_006669542.1|4343225_4343795_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	83.1	4.3e-91
WP_006669544.1|4343833_4344070_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	93.6	4.2e-40
WP_006669545.1|4344128_4345442_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	87.4	2.3e-228
WP_049827788.1|4345420_4346194_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.2e-57
4345451:4345471	attR	GCCCGCCACTTTAACTGCGTG	NA	NA	NA	NA
WP_000252975.1|4346246_4346642_+	membrane protein	NA	NA	NA	NA	NA
WP_000019607.1|4346682_4347426_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	4.1e-25
WP_020898899.1|4347422_4348394_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001185772.1|4348629_4349376_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000024796.1|4349395_4349965_-	VOC family protein	NA	NA	NA	NA	NA
WP_020898900.1|4350201_4351935_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.9e-85
>prophage 9
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	4546261	4555122	4963375		Bacillus_phage(33.33%)	8	NA	NA
WP_020898973.1|4546261_4547635_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	5.8e-33
WP_020898974.1|4547638_4549087_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.7	3.2e-58
WP_020898975.1|4549079_4549580_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_024142980.1|4549582_4550548_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
WP_020898977.1|4550550_4551669_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	5.3e-133
WP_023888509.1|4551716_4552841_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_057951311.1|4552877_4553897_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	1.6e-83
WP_000981469.1|4554228_4555122_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
>prophage 10
NZ_CP044186	Salmonella enterica subsp. enterica strain AR-0402 chromosome, complete genome	4963375	4636293	4645464	4963375	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195343.1|4636293_4638327_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000703137.1|4638567_4639026_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|4639197_4639728_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
WP_000950413.1|4639784_4640252_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|4640298_4641018_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|4641014_4642700_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|4642922_4643654_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|4643713_4643821_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|4643801_4644533_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|4644516_4645464_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 1
NZ_CP044187	Salmonella enterica subsp. enterica strain AR-0402 plasmid pAR-0402	62424	568	42260	62424	integrase,transposase	Escherichia_phage(25.0%)	43	21998:22057	42264:42873
WP_001749988.1|568_1138_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_015344971.1|1277_1562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|1530_2544_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|2699_3173_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|3393_3660_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|3802_4567_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024139167.1|4608_4821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098817.1|4827_6042_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|6075_7509_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|7890_8097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|8101_8590_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|8798_9110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|9145_9460_-	KikA protein	NA	NA	NA	NA	NA
WP_001749964.1|9456_9801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024129965.1|9816_10167_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749963.1|10230_10965_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000440698.1|10973_11255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|11264_11558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|11607_11925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749961.1|11924_14525_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_001749960.1|14542_15256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749959.1|15263_15491_+	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749958.1|15506_16547_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001257173.1|16629_16776_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_000646594.1|16765_17464_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_019706045.1|17537_18359_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_000101710.1|18358_19519_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000128596.1|19560_20556_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000792636.1|20555_21089_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
21998:22057	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_004152397.1|25106_26426_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|26675_27557_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|27943_28723_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|28719_29745_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|29851_32881_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|32990_34706_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001217881.1|35820_36378_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|36560_37421_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|37630_38170_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|38141_38978_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|38977_39781_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|39841_40657_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|40986_41163_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001067855.1|41555_42260_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
42264:42873	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCAGTCCACGCCTCAGAACTTGTGGGCTCGCTTTTAAAAAGTTCCCGTCCGTCAGGGCTGGCGCAGGCGATTATGGAGGTGGGACGGGTCAACAAGACGCTGTACCTCCTCAACTACATTGATGATGAAGAATATCGTCGCAGGATACTGACTCAGCTTAACCGGGGAGAAGGCCGTCACGCCGTGGCAAGGGCGATCTGTTACGGCCAACGTGGTGAGATTAGAAAACGTTACCGTGAGGGGCAGGAGGATCAACTGGGTGCGCTGGGGCTTGTCACTAACGCAGTTGTATTGTGGAACACGCTTTATATGCAGGAAGCGCTATCACATTTGCGCAGCGCTGGTGAGATCCCGGAAGACGAGCATATCTCACGCCTGTCGCCACTGATGTACGGTCATATCAACATGCTGGGACATTATACGTTCACGCTGCCGGAAAATATTCTGAAGGGAGAGTTGAGGCCATTAAATTTCAATTCAAACAATGAATTATTGCCTTAACGTGGTTTTTTACACGATTGAACCTCGAACCCCTATATCGGCTAAAGCAC	NA	NA	NA	NA
