The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	93331	100567	4856104		Morganella_phage(33.33%)	8	NA	NA
WP_024154644.1|93331_94762_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|94835_95531_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|95622_95922_-	membrane protein	NA	NA	NA	NA	NA
WP_001080668.1|96571_97750_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_024131109.1|98010_98199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|98209_98422_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457663.1|98876_100145_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000394197.1|100147_100567_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 2
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	216189	226695	4856104		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|216189_217503_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565903.1|217529_218609_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648784.1|218613_219387_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018227.1|219383_220376_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|220381_220933_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023194347.1|220933_221812_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|221859_222759_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|222758_223844_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|224220_225114_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_023209799.1|225291_226695_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.2	5.2e-21
>prophage 3
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	294074	303243	4856104	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_024154558.1|294074_296108_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	3.6e-55
WP_000703137.1|296347_296806_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|296977_297508_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
WP_000950413.1|297564_298032_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|298078_298798_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|298794_300480_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|300702_301434_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|301493_301601_+	protein YohO	NA	NA	NA	NA	NA
WP_023204661.1|302295_303243_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	3.8e-23
>prophage 4
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	378342	431018	4856104	protease,tail,transposase	Escherichia_phage(22.22%)	47	NA	NA
WP_024154554.1|378342_378786_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	2.4e-28
WP_001215679.1|379163_379691_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_001653202.1|381355_381559_+	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000281877.1|381750_382314_-	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001115498.1|383043_383691_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000828293.1|384773_385331_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_024154791.1|385327_387259_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001053607.1|387255_387735_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000074110.1|387731_387944_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_000266003.1|387940_388678_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000990037.1|388729_389389_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888542.1|389385_390003_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.1e-10
WP_000431778.1|390023_390626_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835182.1|390635_391085_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013529.1|391200_392070_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091679.1|392056_392752_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778097.1|392758_395245_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_001260058.1|395241_395505_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000228072.1|395494_395986_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000781589.1|396399_396894_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000421589.1|397102_398746_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.4	3.4e-11
WP_024154553.1|398821_399472_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_031624478.1|399474_400536_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	1.4e-18
WP_000784307.1|400616_401669_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_023204444.1|401783_402920_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	1.1e-114
WP_000083201.1|403648_406318_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061919.1|406334_406985_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_023204445.1|407087_409934_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	5.4e-41
WP_023204446.1|410051_412688_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	5.6e-93
WP_000705590.1|413090_414293_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.3	4.6e-58
WP_024154551.1|414307_415633_-	MFS transporter	NA	NA	NA	NA	NA
WP_077464446.1|415682_416567_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001091008.1|416649_417378_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001076494.1|417733_420019_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	1.3e-282
WP_000332026.1|420131_421262_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
WP_024154550.1|421261_421516_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	9.1e-25
WP_000660249.1|421517_422708_-	MFS transporter	NA	NA	NA	NA	NA
WP_000176719.1|422869_423748_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000858952.1|423863_424934_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_001067855.1|426110_426815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|427004_427820_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|427970_428675_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_104010271.1|428565_428817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|428803_429568_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_078207745.1|429539_429917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042881802.1|429999_430218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064145616.1|430325_431018_+	hypothetical protein	NA	B1B6L9	Salmonella_phage	39.1	1.3e-25
>prophage 5
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	435485	459544	4856104	integrase,transposase	Escherichia_phage(40.0%)	25	433554:433567	456184:456197
433554:433567	attL	ATGCACCACCACGG	NA	NA	NA	NA
WP_001067855.1|435485_436190_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|436269_436770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|436919_437561_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|437704_438409_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|438729_439287_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|439469_440330_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000214483.1|440555_440735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045893453.1|441178_442015_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_024261901.1|442014_442818_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_085959879.1|442924_444054_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_139779446.1|444118_444661_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	47.1	6.1e-26
WP_001067855.1|444651_445356_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000344784.1|445709_446570_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001324342.1|448287_449811_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|449800_450583_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|450758_451259_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|451277_451457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|451386_452226_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|452219_452567_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|452772_453561_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|453691_454165_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000845048.1|454322_455336_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|455538_455889_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|456014_456575_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
456184:456197	attR	CCGTGGTGGTGCAT	NA	NA	NA	NA
WP_001138064.1|456577_459544_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
>prophage 6
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	488626	538168	4856104	integrase,transposase	Escherichia_phage(18.75%)	55	497903:497919	522461:522477
WP_001067858.1|488626_489331_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000555098.1|490606_490891_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000781558.1|490893_491250_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.9	1.6e-22
WP_000753551.1|491342_492902_+|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
WP_000155092.1|493545_494430_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|494485_495961_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|496359_497544_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|497592_497778_+	hypothetical protein	NA	NA	NA	NA	NA
497903:497919	attL	GCTTATTCGCACCTTCC	NA	NA	NA	NA
WP_077252464.1|497997_498279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|498259_499033_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|500431_501973_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|502377_503217_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|503210_503558_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|503721_504513_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845039.1|504658_505672_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001447826.1|505616_505940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001162012.1|505977_506535_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_151121496.1|506537_509510_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427623.1|509588_510593_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001166628.1|511027_511483_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|511554_511920_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|511935_512211_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|512238_512664_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|512702_514388_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|514405_514771_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|514767_515004_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|514987_515107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|515069_515282_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000080861.1|517654_518791_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|518841_519087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|519092_519284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|519765_520308_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|520320_521181_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000019445.1|521349_522330_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000027057.1|522562_523423_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
522461:522477	attR	GCTTATTCGCACCTTCC	NA	NA	NA	NA
WP_001235713.1|523605_524163_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_012512979.1|524308_524488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|524478_525183_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_151121497.1|525128_525644_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
WP_000833382.1|525894_527322_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|527536_528052_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|528054_528951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|529172_529406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|529451_529706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136338.1|529743_530031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|530067_530298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|530634_531096_+	hypothetical protein	NA	A0A2H4IBJ0	Erwinia_phage	37.9	7.7e-14
WP_000074418.1|531125_531533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|531583_531901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|532277_532628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|534492_534885_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|535022_535907_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|535938_537138_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|537216_537894_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|537925_538168_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	900792	997079	4856104	plate,head,terminase,lysis,tail,capsid,integrase,tRNA,portal	Salmonella_phage(76.47%)	88	911958:911973	997797:997812
WP_000083339.1|900792_901530_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|901659_902994_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_023204705.1|903011_903911_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188415.1|904013_904601_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|904662_905046_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|905364_906054_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|906169_907207_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|907410_907830_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183642.1|907902_908583_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082642.1|908636_911297_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023204706.1|911411_912767_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
911958:911973	attL	ATGTTTGACTGGGTGA	NA	NA	NA	NA
WP_001264473.1|912811_913135_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_058663591.1|913131_914433_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	9.1e-44
WP_000985653.1|914536_914992_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235092.1|920854_923428_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992639.1|923557_924289_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|924285_925266_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|925397_926135_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|926406_926745_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|926848_926896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200077.1|926995_928156_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210990.1|928116_929025_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|929082_930204_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|930213_931284_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|931723_932242_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|932234_933455_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|933611_933959_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469813.1|933999_934767_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|934811_935360_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|935378_935627_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|935879_937241_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|937406_938198_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|938217_939504_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_024154431.1|939624_940230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|940264_940855_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|940978_941857_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|941942_943604_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|943751_944090_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|944255_944546_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|944535_945012_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|945161_945644_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_024154432.1|946259_957734_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_024154433.1|957798_959208_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_024154434.1|959204_961385_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.5	5.8e-19
WP_072102794.1|961392_962556_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|963107_963326_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_119822171.1|963394_964495_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.1	2.6e-193
WP_119822170.1|964484_964976_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.8	1.4e-69
WP_119822168.1|967770_967890_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	1.2e-14
WP_001280962.1|967904_968207_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_001207652.1|968261_968777_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_000046109.1|968786_969959_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001165558.1|970061_970619_-	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
WP_079801889.1|970588_971515_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	99.6	2.5e-160
WP_080088929.1|971517_972057_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	98.3	4.2e-96
WP_151121501.1|972646_974425_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	67.5	8.5e-202
WP_119822145.1|974421_975027_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.0	3.0e-114
WP_080088962.1|975019_975928_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	93.4	5.6e-149
WP_080088961.1|975914_976274_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	96.6	8.0e-59
WP_119822146.1|976270_976849_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	93.2	6.5e-103
WP_080088896.1|976926_977958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079801893.1|977963_978410_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	74.3	5.6e-54
WP_080088897.1|978402_978834_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	91.6	4.2e-70
WP_079801895.1|978796_979000_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	86.6	2.3e-26
WP_079801896.1|978929_979358_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	94.3	7.5e-64
WP_079801897.1|979354_979729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079801898.1|979730_980243_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	77.5	1.6e-73
WP_079801900.1|980441_980645_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	97.0	2.5e-33
WP_079801901.1|980644_981109_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	94.8	1.1e-81
WP_080088898.1|981202_981853_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.1	3.5e-113
WP_080088899.1|981856_982939_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	90.7	6.8e-178
WP_080088900.1|982955_983789_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.0	1.0e-125
WP_119822147.1|983931_985698_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
WP_080088906.1|985697_986738_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	99.4	3.0e-199
WP_001284991.1|986841_988506_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|988819_989497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151121502.1|989610_989844_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.4e-35
WP_001154433.1|989854_990043_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_125541528.1|990195_992625_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.6	0.0e+00
WP_000104124.1|992615_993476_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	79.4	2.2e-126
WP_000132370.1|993472_993700_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	6.2e-33
WP_001244237.1|993699_993933_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	97.4	1.9e-32
WP_000963477.1|994000_994342_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	86.7	2.6e-51
WP_000956170.1|994305_994506_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	7.4e-30
WP_000460858.1|994513_995023_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	100.0	1.6e-89
WP_000102102.1|995055_995298_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_000616879.1|995417_996050_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	99.5	5.6e-116
WP_001536726.1|996053_997079_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
997797:997812	attR	TCACCCAGTCAAACAT	NA	NA	NA	NA
>prophage 8
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	2303051	2397544	4856104	plate,head,terminase,protease,lysis,capsid,integrase,tail,holin,portal,tRNA	Escherichia_phage(42.0%)	107	2335117:2335163	2367637:2367683
WP_000560969.1|2303051_2303489_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000080770.1|2303485_2304475_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023203737.1|2304500_2305415_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	51.9	3.1e-06
WP_001159630.1|2305632_2305944_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|2305944_2306235_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|2306281_2307211_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829028.1|2307207_2307843_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|2307839_2308742_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|2308754_2311805_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_024154442.1|2311999_2312836_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710971.1|2313103_2314135_-	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_023203740.1|2314317_2315418_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527677.1|2315773_2316097_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|2316096_2316756_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|2316838_2317405_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|2317493_2317808_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009254.1|2317804_2318953_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179690.1|2319079_2319907_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211470.1|2320049_2321309_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143965.1|2321305_2322775_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|2323062_2323899_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|2324051_2324900_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063533.1|2324896_2325931_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|2326549_2327233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|2327391_2328699_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|2328691_2329207_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|2329225_2330209_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122632.1|2330537_2331158_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_077910343.1|2331164_2331917_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133442.1|2331928_2332324_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|2332374_2333748_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|2333744_2334443_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|2334593_2335094_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2335117:2335163	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|2335279_2336260_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|2336329_2336623_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|2336759_2337032_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|2337201_2337702_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|2337765_2337990_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|2337989_2338289_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|2338291_2338516_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|2338512_2338788_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001749228.1|2338777_2341075_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_001697730.1|2341161_2342184_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	59.0	5.5e-113
WP_058145365.1|2342213_2342894_-	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	31.7	9.9e-18
WP_000351260.1|2342895_2344038_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	42.9	1.6e-73
WP_000038188.1|2344411_2345446_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_000156861.1|2345445_2347218_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001074420.1|2347391_2348246_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	99.6	2.2e-139
WP_001248595.1|2348304_2349378_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.2	5.7e-201
WP_000203444.1|2349381_2350125_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.8	6.0e-125
WP_000988638.1|2350224_2350734_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000846409.1|2350733_2350937_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|2350940_2351222_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|2351221_2351719_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_001749230.1|2351733_2352159_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	91.5	6.8e-57
WP_001697717.1|2352146_2352572_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	5.2e-65
WP_001300730.1|2352543_2352717_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_001749231.1|2352679_2353147_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	3.3e-81
WP_001001786.1|2353139_2353592_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001093697.1|2353658_2354294_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.6e-110
WP_000127163.1|2354290_2354638_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121473.1|2354642_2355551_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_001285340.1|2355543_2356155_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_024140574.1|2356151_2357960_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	84.4	2.8e-216
WP_001747940.1|2357961_2358369_+|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678265.1|2358372_2358990_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_049813387.1|2358959_2360243_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	99.5	3.9e-241
WP_001749283.1|2360270_2360864_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	6.1e-104
WP_001286716.1|2360923_2362114_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|2362126_2362645_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2362700_2362976_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2363008_2363128_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001749285.1|2363120_2365568_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.4	0.0e+00
WP_000978897.1|2365582_2366062_+|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_001749286.1|2366061_2367225_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	9.1e-205
WP_000468308.1|2367306_2367525_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001077321.1|2367761_2368664_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2367637:2367683	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|2368848_2369811_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758714.1|2370014_2371004_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024154536.1|2371104_2371860_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_023204368.1|2372123_2373458_+	MFS transporter	NA	NA	NA	NA	NA
WP_023204369.1|2373468_2374428_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001621411.1|2374437_2375478_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001535809.1|2375540_2376263_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000060993.1|2376360_2376531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621104.1|2376546_2376678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173080.1|2376767_2377118_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|2377131_2378724_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283049.1|2378810_2379770_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000911133.1|2381553_2382597_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|2382593_2383595_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_024154537.1|2383623_2384646_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774147.1|2384674_2385550_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001543603.1|2385632_2385923_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088050.1|2385932_2386697_+	epimerase	NA	NA	NA	NA	NA
WP_001216335.1|2386788_2387556_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802241.1|2387668_2388265_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|2388365_2388794_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796303.1|2388899_2389646_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250624.1|2389742_2390753_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_023204370.1|2390864_2392373_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|2392393_2393239_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|2393637_2393877_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|2394098_2394584_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|2394676_2395606_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|2395672_2397004_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|2397013_2397544_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 9
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	3881290	3888603	4856104	protease,integrase	Dickeya_phage(16.67%)	7	3870028:3870042	3889077:3889091
3870028:3870042	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_023202044.1|3881290_3882409_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_058663560.1|3882405_3884352_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|3884481_3884703_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|3885026_3885347_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|3885377_3887654_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|3887866_3888064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|3888225_3888603_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
3889077:3889091	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 10
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	4136966	4187515	4856104	head,protease,terminase,lysis,integrase,tail,capsid,holin,tRNA,portal	Enterobacteria_phage(38.64%)	62	4131264:4131278	4158128:4158142
4131264:4131278	attL	CGGCAAATGTCATTT	NA	NA	NA	NA
WP_000004541.1|4136966_4138073_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476067.1|4138126_4138588_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825956.1|4138599_4138929_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001249411.1|4138925_4139591_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444509.1|4139762_4141013_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_000741325.1|4141126_4142269_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000089141.1|4142258_4142495_-	excisionase	NA	NA	NA	NA	NA
WP_058663552.1|4142544_4143048_-	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
WP_000066252.1|4143044_4143377_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	80.3	3.0e-20
WP_001033921.1|4143369_4143690_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_001126032.1|4143725_4144556_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_058663551.1|4144548_4147239_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.3	1.4e-115
WP_058663550.1|4147379_4147715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613375.1|4147789_4148074_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_024135615.1|4148504_4148684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783769.1|4148628_4148817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574209.1|4149114_4149513_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001033911.1|4149611_4149866_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_151121518.1|4149852_4150347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001604746.1|4150393_4151401_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.0e-124
WP_000140163.1|4151393_4151855_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_058663549.1|4151868_4152264_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	2.9e-17
WP_058112744.1|4152549_4153680_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001237395.1|4154074_4156054_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_023233095.1|4156071_4156263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972673.1|4156685_4156991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750112.1|4157053_4157656_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001241016.1|4157655_4157862_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	98.5	4.6e-35
WP_001096547.1|4157864_4158476_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
4158128:4158142	attR	AAATGACATTTGCCG	NA	NA	NA	NA
WP_001617856.1|4158472_4158619_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047630.1|4158608_4159406_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001534733.1|4159804_4159930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|4160065_4160515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|4160874_4161561_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|4161836_4162166_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984583.1|4162149_4162602_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
WP_031607240.1|4162619_4163069_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	6.1e-64
WP_001252721.1|4163397_4163901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000669693.1|4164157_4164559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|4164844_4165390_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623092.1|4165361_4167293_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_058663548.1|4167276_4167480_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	72.3	5.6e-17
WP_000831821.1|4167476_4169057_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189498.1|4169046_4170543_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000011260.1|4170555_4170903_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|4170957_4171986_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|4172043_4172403_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083293.1|4172413_4172791_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000677089.1|4172777_4173356_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000033885.1|4173352_4173754_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|4173761_4174508_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|4174558_4174954_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|4174950_4175289_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_058663547.1|4175260_4178356_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.1e-276
WP_000447369.1|4178358_4178688_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|4178697_4179396_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|4179402_4180140_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_065314057.1|4180037_4180685_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	7.8e-89
WP_024154661.1|4180747_4184110_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.4	0.0e+00
WP_024154662.1|4184148_4184391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663545.1|4184444_4186940_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	77.7	2.6e-164
WP_024154534.1|4186939_4187515_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	92.0	2.8e-98
>prophage 11
NZ_CP044184	Salmonella enterica subsp. enterica strain AR-0403 chromosome, complete genome	4856104	4837635	4846866	4856104	integrase	Salmonella_phage(28.57%)	12	4841512:4841526	4852411:4852425
WP_077946594.1|4837635_4839690_-	shikimate transporter	NA	E5G6P0	Salmonella_phage	49.1	3.7e-76
WP_023204530.1|4840242_4840734_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	57.5	4.9e-43
WP_031608154.1|4840785_4840977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|4841041_4841209_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|4841465_4841999_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
4841512:4841526	attL	CGTTCACACGTCATT	NA	NA	NA	NA
WP_001013467.1|4842052_4842283_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_024147594.1|4843149_4843419_+	hypothetical protein	NA	Q9QF34	Lambdoid_phage	83.5	5.3e-31
WP_038803962.1|4843415_4844495_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.2	3.3e-100
WP_023204512.1|4844877_4845231_-	YebY family protein	NA	NA	NA	NA	NA
WP_000979694.1|4845247_4846123_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|4846123_4846498_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|4846635_4846866_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
4852411:4852425	attR	CGTTCACACGTCATT	NA	NA	NA	NA
>prophage 1
NZ_CP044185	Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403	49153	15	48608	49153	head,capsid,terminase,portal,tail,transposase	Klebsiella_phage(43.1%)	65	NA	NA
WP_079970162.1|15_1230_-|transposase	transposase	transposase	A0A1I9KF42	Aeromonas_phage	59.0	1.5e-125
WP_079970163.1|1196_1424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023197247.1|1420_1585_-	host cell division inhibitor Icd-like protein	NA	Q7Y3Y4	Yersinia_phage	83.0	1.1e-18
WP_023197248.1|1962_3132_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	84.1	4.0e-192
WP_079970165.1|3128_4310_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	60.2	3.0e-126
WP_079970166.1|4436_4748_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	57.1	2.7e-26
WP_151121528.1|4750_4993_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	57.0	9.9e-21
WP_151121529.1|5286_5985_+|tail	phage tail protein	tail	A0A1C9II89	Salmonella_phage	53.0	5.4e-59
WP_151121523.1|5987_6521_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	75.8	5.5e-72
WP_151121524.1|6524_7043_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.8e-44
WP_151121525.1|7057_9757_-	shikimate transporter	NA	A0A192Y7M1	Salmonella_phage	60.8	9.1e-131
WP_023197193.1|13257_13905_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	79.1	4.2e-90
WP_079970136.1|13802_14540_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.7	5.2e-129
WP_139764134.1|14597_15122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020843858.1|15206_15902_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	77.5	3.2e-104
WP_020843857.1|15911_16244_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.1	1.4e-38
WP_079970134.1|16247_19583_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	65.0	0.0e+00
WP_071786191.1|19582_19813_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	64.5	5.0e-22
WP_020843855.1|19833_20196_-	hypothetical protein	NA	Q6UAW8	Klebsiella_phage	56.8	7.4e-28
WP_079945162.1|20265_20739_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	79.3	4.9e-64
WP_020843853.1|20771_21173_-|capsid	phage capsid protein	capsid	Q6UAX1	Klebsiella_phage	87.2	1.3e-57
WP_020843852.1|21169_21559_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	73.8	8.1e-49
WP_023228903.1|21539_21884_-	hypothetical protein	NA	Q6UAX3	Klebsiella_phage	63.6	1.8e-36
WP_023259870.1|21880_22204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q7Y407	Yersinia_phage	66.0	4.0e-33
WP_079970133.1|22184_22556_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	72.9	3.7e-19
WP_020843848.1|22611_23898_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.6	4.4e-208
WP_023228900.1|23972_24890_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	76.6	3.2e-128
WP_023228899.1|24873_25224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061375585.1|25256_26516_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.7	2.3e-222
WP_024145686.1|26515_26695_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	63.2	4.3e-13
WP_079970132.1|26688_28398_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	87.5	2.8e-303
WP_077910438.1|28433_28757_-|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	90.7	3.6e-50
WP_151121530.1|28999_29200_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	45.5	3.9e-07
WP_023197212.1|29199_29562_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	89.8	8.1e-59
WP_151121526.1|29615_30653_-	DNA cytosine methyltransferase	NA	O64366	Escherichia_phage	62.4	3.0e-122
WP_023228891.1|30732_31041_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	91.8	8.4e-49
WP_079892392.1|31037_31304_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	40.0	6.6e-10
WP_139764133.1|31414_31609_-	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	80.7	4.8e-18
WP_023197216.1|31556_32021_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	84.4	3.7e-64
WP_023259862.1|32037_32529_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	91.9	8.3e-83
WP_023197218.1|32525_32834_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	84.0	8.4e-41
WP_079970129.1|32891_33953_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	87.3	8.7e-162
WP_023228887.1|34213_34447_-	hypothetical protein	NA	O64359	Escherichia_phage	50.0	5.6e-13
WP_023197221.1|34496_34718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228886.1|34888_35200_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	79.8	3.6e-39
WP_023228885.1|35196_35478_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	66.7	5.5e-31
WP_023228884.1|35503_35752_-	hypothetical protein	NA	Q7Y3V8	Yersinia_phage	48.0	3.0e-12
WP_023197225.1|35789_36026_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	55.8	4.1e-19
WP_079970128.1|36113_36737_-	hypothetical protein	NA	Q7Y3W0	Yersinia_phage	63.9	1.1e-79
WP_079945151.1|37658_38138_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	43.8	1.6e-30
WP_023259856.1|38134_38323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079945150.1|38319_38550_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	85.3	7.2e-29
WP_079945149.1|38555_38804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151121527.1|38743_39418_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	61.5	1.5e-66
WP_079945147.1|39420_39621_-	hypothetical protein	NA	Q7Y3W8	Yersinia_phage	56.1	9.0e-12
WP_023228876.1|39620_40559_-	recombination associate protein	NA	Q7Y3W9	Yersinia_phage	46.8	3.1e-70
WP_139764132.1|40562_40784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024148377.1|40821_41127_-	hypothetical protein	NA	Q7Y3X1	Yersinia_phage	56.8	1.7e-25
WP_023228875.1|41083_41749_-	antitermination protein Q	NA	Q7Y3X2	Yersinia_phage	40.5	7.4e-42
WP_080074957.1|41735_42338_-	hypothetical protein	NA	Q7Y3X3	Yersinia_phage	65.0	6.0e-67
WP_079892400.1|42357_42564_-	Cro/Cl family transcriptional regulator	NA	Q7Y3X4	Yersinia_phage	55.9	2.6e-14
WP_031618727.1|42666_43311_+	XRE family transcriptional regulator	NA	Q7Y3X6	Yersinia_phage	62.1	2.2e-67
WP_079970125.1|43577_47552_+	hypothetical protein	NA	Q7Y3X9	Yersinia_phage	70.1	0.0e+00
WP_079970124.1|47562_47889_+	hypothetical protein	NA	O64345	Escherichia_phage	67.3	3.5e-37
WP_079785767.1|48275_48608_+	hypothetical protein	NA	Q6UAV0	Klebsiella_phage	89.1	3.2e-54
