The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	637806	646950	5139919	integrase,transposase,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_001201751.1|637806_638925_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125893.1|638921_640868_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|640997_641219_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|641542_641863_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|641893_644170_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|644382_644580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080108970.1|644741_645119_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_085983316.1|645694_646950_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	984948	1071684	5139919	portal,integrase,plate,tRNA,protease,lysis,holin,head,tail,terminase,capsid	Enterobacteria_phage(49.51%)	120	1032106:1032124	1069238:1069256
WP_001130518.1|984948_986160_+|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	99.5	1.6e-236
WP_071588019.1|986105_986351_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	56.7	9.1e-14
WP_080193300.1|987175_987526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001214770.1|987742_987913_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_080201601.1|987923_988217_-	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	95.9	5.2e-48
WP_080193847.1|988240_988624_-	hypothetical protein	NA	I6S1T0	Salmonella_phage	94.5	1.4e-64
WP_107280786.1|988623_989241_-	ERF family protein	NA	I6RSN3	Salmonella_phage	94.6	1.2e-102
WP_001749885.1|989370_989559_-	DUF5444 family protein	NA	A0A1R3Y5S5	Salmonella_virus	98.4	4.8e-31
WP_001539176.1|989539_989713_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
WP_080193852.1|989903_990134_-	hypothetical protein	NA	A0A1B0VMC0	Pseudomonas_phage	48.1	1.7e-09
WP_114050383.1|990133_990868_-	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	91.5	2.6e-32
WP_000213981.1|990951_991146_-	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
WP_100069257.1|991077_991263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129464611.1|991269_991476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023210740.1|991485_991821_-	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	87.9	1.7e-47
WP_017441421.1|992159_992810_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
WP_000276884.1|992890_993076_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_017441422.1|993182_993461_+	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	91.3	6.4e-40
WP_001125981.1|993495_993642_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_006789497.1|993634_994534_+	hypothetical protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
WP_080193825.1|994523_995960_+	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	98.7	6.3e-272
WP_080193824.1|996036_996477_+	recombination protein NinB	NA	K7PGZ3	Enterobacteria_phage	95.9	2.7e-77
WP_001573980.1|996473_997346_+	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
WP_080193823.1|997342_997516_+	protein ninD	NA	C6ZR56	Salmonella_phage	91.2	7.8e-28
WP_000113760.1|997482_997665_+	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
WP_001749912.1|997661_997838_+	hypothetical protein	NA	A0A0M4S6T3	Salmonella_phage	93.1	2.5e-26
WP_001750247.1|997800_998097_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	100.0	2.0e-47
WP_023206523.1|998093_998489_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	97.7	2.2e-70
WP_080178115.1|998485_999142_+	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.4	3.4e-39
WP_080201632.1|999138_999363_+	protein ninY	NA	I6R0N9	Salmonella_phage	97.3	2.0e-36
WP_000149882.1|999359_999563_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_023254272.1|999543_999723_+	hypothetical protein	NA	A0A0M4QWY9	Salmonella_phage	94.9	5.1e-22
WP_080193779.1|999719_1000493_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.2	2.6e-131
WP_080201384.1|1000917_1001244_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	99.1	1.9e-51
WP_023254271.1|1001227_1001665_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.2	4.1e-73
WP_042827540.1|1001661_1002132_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	84.1	1.5e-60
WP_020898878.1|1002250_1002595_+	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
WP_010835825.1|1002727_1003192_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_080193778.1|1003145_1004888_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	5.7e-142
WP_024142077.1|1004887_1006195_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.5	6.4e-215
WP_010835821.1|1007065_1008283_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
WP_080193777.1|1008326_1008515_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	60.6	2.6e-13
WP_001648719.1|1008514_1008841_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_020898872.1|1008850_1009189_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_010835820.1|1009185_1009635_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
WP_001648721.1|1009631_1009979_+	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
WP_000097142.1|1010035_1010740_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
WP_001129939.1|1010767_1011139_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
WP_024134502.1|1011162_1011441_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
WP_000404385.1|1011497_1011833_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
WP_080193776.1|1011879_1015194_+|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	95.3	0.0e+00
WP_024142074.1|1015564_1015819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010835817.1|1015981_1016575_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.5	1.9e-110
WP_023252582.1|1016574_1017159_+	hypothetical protein	NA	S4TND4	Salmonella_phage	97.9	1.1e-105
WP_010835815.1|1017165_1017564_+	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
WP_080067058.1|1017563_1020275_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	95.9	0.0e+00
WP_042827531.1|1020283_1021243_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.1	9.0e-182
WP_080193775.1|1021253_1022552_+|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	99.3	5.9e-245
WP_000394200.1|1022788_1023208_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
WP_000457671.1|1023210_1024479_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.9	2.1e-239
WP_001144215.1|1024810_1026739_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	7.2e-130
WP_001574431.1|1026742_1027285_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001124225.1|1027380_1027578_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1027628_1027985_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1028105_1028150_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018570.1|1028286_1029270_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672408.1|1029285_1031673_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229266.1|1031677_1031977_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1032106:1032124	attL	TGCGGCCTTTTTTCTTTCA	NA	NA	NA	NA
WP_000078916.1|1032385_1032526_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_021549238.1|1032716_1032977_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000346967.1|1033172_1033493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001756445.1|1033498_1036291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132826.1|1036501_1037611_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.2e-195
WP_000005400.1|1037768_1038953_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000290462.1|1038952_1039465_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|1039520_1039895_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|1039903_1040059_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_151091818.1|1040045_1042781_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.8	0.0e+00
WP_000979945.1|1042864_1043353_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|1043381_1043981_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_077899456.1|1044217_1044922_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	95.3	3.9e-126
WP_001164116.1|1044925_1045453_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.7	5.6e-93
WP_000972139.1|1045481_1046015_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	8.4e-97
WP_074526035.1|1046017_1048003_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	85.9	8.4e-174
WP_000071721.1|1048005_1048536_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	100.0	1.3e-94
WP_080193709.1|1048528_1049425_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.7	1.9e-157
WP_040072192.1|1049428_1049779_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	98.3	6.6e-58
WP_001271918.1|1049775_1050357_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.0e-100
WP_023151575.1|1050353_1050989_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_040072193.1|1050981_1051449_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	2.2e-85
WP_024132949.1|1051435_1051615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040072194.1|1051586_1051994_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	3.4e-66
WP_000072327.1|1051990_1052383_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1052379_1052703_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_074484523.1|1052705_1052906_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	8.7e-31
WP_040072195.1|1052905_1053400_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	1.0e-88
WP_000632345.1|1053501_1054302_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_074484524.1|1054347_1055400_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.9	2.5e-193
WP_001262688.1|1055423_1056260_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_074484525.1|1056414_1058166_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_063107930.1|1058165_1059212_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.6e-206
WP_001289966.1|1059702_1060293_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
WP_000211289.1|1060356_1060668_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|1060672_1061632_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000123488.1|1061708_1064531_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.7	0.0e+00
WP_000599382.1|1064537_1064903_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000584687.1|1065044_1065290_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	90.1	1.7e-36
WP_000985159.1|1065286_1065490_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021668.1|1065576_1065690_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000514277.1|1065686_1065929_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158971.1|1065940_1066228_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000917811.1|1066238_1066577_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
WP_001151410.1|1066591_1066870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904672.1|1066966_1067275_+	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_001247211.1|1067363_1068302_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000668483.1|1068304_1068667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074484527.1|1068666_1069104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954982.1|1069311_1070292_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1069238:1069256	attR	TGCGGCCTTTTTTCTTTCA	NA	NA	NA	NA
WP_001181570.1|1070383_1070935_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000080616.1|1070934_1071684_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	3.5e-08
>prophage 3
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	1291565	1297644	5139919	transposase,capsid	Enterobacteria_phage(100.0%)	8	NA	NA
WP_000699010.1|1291565_1291808_+|capsid	phage capsid protein	capsid	Q9T0Q8	Enterobacteria_phage	63.0	2.1e-07
WP_114050379.1|1291854_1293105_+	attachment protein	NA	D0U161	Enterobacteria_phage	50.9	4.2e-06
WP_001130312.1|1293104_1293446_+	DUF5455 family protein	NA	D0U162	Enterobacteria_phage	36.1	2.3e-07
WP_114050378.1|1293446_1294541_+	hypothetical protein	NA	A7BJY0	Enterobacteria_phage	54.4	6.1e-110
WP_001734931.1|1294548_1295814_+	type II/III secretion system protein	NA	A7BJY1	Enterobacteria_phage	51.2	2.3e-108
WP_000378924.1|1295883_1296192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001159442.1|1296309_1296543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695466.1|1296720_1297644_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
>prophage 4
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	1587640	1680570	5139919	transposase,integrase,plate,tRNA,head,protease,lysis,holin,tail,terminase	Salmonella_phage(14.81%)	112	1582194:1582208	1683243:1683257
1582194:1582208	attL	GTGAGCGGCTGTAAA	NA	NA	NA	NA
WP_023220926.1|1587640_1588336_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|1588393_1590304_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|1590435_1590780_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|1590785_1590965_-	YoaH family protein	NA	NA	NA	NA	NA
WP_077909862.1|1591045_1592410_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	2.5e-44
WP_000381544.1|1592413_1592992_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624277.1|1593255_1594620_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001192519.1|1594757_1596359_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000421815.1|1596380_1597940_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150523.1|1598412_1599381_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406918.1|1599433_1600234_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|1600246_1601098_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156274.1|1601156_1601615_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|1602024_1602591_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010923.1|1602587_1603397_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730317.1|1603462_1605208_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|1605427_1605637_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|1605649_1605793_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|1606441_1606729_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714547.1|1606799_1606943_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236776.1|1607100_1607340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|1607551_1608343_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_023238504.1|1608518_1609892_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984498.1|1609939_1610821_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|1611013_1613062_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_079840614.1|1613081_1613768_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|1613865_1614450_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207293.1|1614491_1615775_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001521100.1|1615743_1618377_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001617930.1|1618454_1619894_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_000457836.1|1620356_1620548_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|1620566_1621217_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|1621440_1621605_-	membrane protein	NA	NA	NA	NA	NA
WP_080193649.1|1621889_1622612_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_080193648.1|1623295_1623691_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	5.4e-16
WP_000030949.1|1624019_1624496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080193647.1|1624883_1625303_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001525024.1|1625432_1625627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011233024.1|1625673_1625943_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	44.4	6.9e-07
WP_001576018.1|1626108_1626249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080193646.1|1626394_1627603_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.6	1.0e-44
WP_001525027.1|1627726_1628095_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	1.2e-17
WP_080193654.1|1628360_1628561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|1629178_1630093_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|1630225_1630384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080193645.1|1630393_1631008_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001668484.1|1631760_1632027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|1632155_1632281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520426.1|1632543_1632660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001751604.1|1632850_1633051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034748.1|1634500_1634689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1634753_1634921_+	lytic enzyme	NA	NA	NA	NA	NA
WP_000055326.1|1635177_1635711_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
WP_107280779.1|1635707_1635995_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.7	1.4e-37
WP_080193787.1|1637128_1638208_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	8.2e-99
WP_001536069.1|1639161_1639962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|1640441_1641164_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143174.1|1641359_1641935_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
WP_000772815.1|1641934_1643389_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	68.2	1.5e-39
WP_001181747.1|1643378_1643981_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_001293656.1|1643982_1645224_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	5.3e-102
WP_151091821.1|1645220_1645460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080193786.1|1645588_1646266_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.6e-31
WP_000122818.1|1646246_1647116_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000890115.1|1647112_1647415_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000010346.1|1647414_1648125_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	8.5e-28
WP_058215126.1|1648121_1650293_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000228831.1|1650276_1650459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101348.1|1650500_1650905_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000016414.1|1650904_1651351_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_080193785.1|1651351_1652836_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.4	7.6e-95
WP_000094504.1|1652816_1653362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001048641.1|1653346_1653712_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	2.3e-21
WP_024152561.1|1653708_1654293_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.1	2.1e-16
WP_001748492.1|1654286_1654742_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
WP_000829560.1|1654748_1655096_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
WP_001031915.1|1655099_1656128_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_046722443.1|1656127_1656610_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	2.4e-26
WP_047598854.1|1656611_1657958_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.9	1.0e-69
WP_000552017.1|1657954_1658644_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_000266187.1|1658684_1660205_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	2.4e-104
WP_024152560.1|1660204_1661626_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.4e-186
WP_001748497.1|1661591_1662344_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	73.3	5.3e-12
WP_001113128.1|1662414_1662597_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_031607001.1|1662822_1663287_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	82.9	2.7e-59
WP_000984588.1|1663304_1663757_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	3.0e-79
WP_001574216.1|1663740_1664070_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|1664345_1665032_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798706.1|1665392_1665842_+	lipoprotein	NA	NA	NA	NA	NA
WP_001748501.1|1666215_1666740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|1666836_1667526_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|1667655_1667883_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940756.1|1667879_1668479_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	3.6e-96
WP_000911592.1|1668542_1668791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|1669042_1669198_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_000687975.1|1669401_1669674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000089421.1|1669670_1670066_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
WP_000140163.1|1670080_1670542_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_000729540.1|1670534_1671536_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	68.1	4.4e-123
WP_001574210.1|1671579_1672074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033909.1|1672060_1672315_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_080193784.1|1672411_1672837_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_000687579.1|1673252_1673519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000103933.1|1673867_1674143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1674146_1674353_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000799627.1|1674428_1674764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001748505.1|1674904_1677595_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	73.2	3.0e-118
WP_001126031.1|1677587_1678418_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
WP_000280163.1|1678464_1678650_+	DUF1187 family protein	NA	NA	NA	NA	NA
WP_001574207.1|1678940_1679177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001575998.1|1679237_1679516_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|1679490_1680570_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
1683243:1683257	attR	TTTACAGCCGCTCAC	NA	NA	NA	NA
>prophage 5
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	1788725	1796085	5139919		Morganella_phage(33.33%)	9	NA	NA
WP_057935457.1|1788725_1789922_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	6.1e-111
WP_024131109.1|1790179_1790368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|1790378_1790591_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_023224669.1|1791045_1792314_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	1.1e-227
WP_000394196.1|1792316_1792736_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|1792862_1793024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|1793504_1794302_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_052934630.1|1794673_1794964_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
WP_001219015.1|1795611_1796085_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 6
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	1953094	2023675	5139919	portal,integrase,plate,tRNA,head,tail,terminase,capsid	Cronobacter_phage(55.26%)	75	1954606:1954626	1983208:1983228
WP_001517981.1|1953094_1954456_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.4	2.3e-207
1954606:1954626	attL	CCCTTACGCAGGCTTATTTTT	NA	NA	NA	NA
WP_039520891.1|1954717_1955098_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_039520888.1|1955109_1955721_-	(Fe-S)-cluster assembly protein	NA	NA	NA	NA	NA
WP_139156586.1|1956825_1958526_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.7	1.7e-223
WP_080201481.1|1958528_1959074_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000267950.1|1959045_1959771_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	5.0e-68
WP_000642805.1|1959760_1960306_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	9.5e-88
WP_114050370.1|1960318_1962565_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	70.4	3.1e-169
WP_001001823.1|1962574_1963162_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_000136921.1|1963154_1964339_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|1964335_1964665_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811099.1|1964661_1966629_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_000411500.1|1966816_1967074_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_001747519.1|1967060_1967294_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
WP_109256488.1|1967220_1967553_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	68.2	2.8e-34
WP_000175558.1|1967552_1967894_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000166745.1|1968198_1968654_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_000220184.1|1968650_1969778_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
WP_000606933.1|1969774_1970479_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
WP_000080871.1|1970475_1970958_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_000491223.1|1970954_1971407_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_080201490.1|1971505_1972204_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	2.7e-63
WP_001176504.1|1972215_1973244_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	1.7e-133
WP_080201491.1|1973278_1974268_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	49.2	4.3e-46
WP_114050369.1|1974325_1976110_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.7	2.1e-245
WP_000746493.1|1976106_1977126_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.0e-135
WP_000088096.1|1977125_1977449_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_114050368.1|1977476_1980134_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.4	4.6e-244
WP_000922120.1|1980172_1980391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114050367.1|1980393_1980963_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.5e-43
WP_058673810.1|1980972_1981305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039519601.1|1981301_1981577_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	83.5	8.9e-42
WP_039519599.1|1981694_1981994_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	85.9	3.0e-43
WP_080201537.1|1982109_1983123_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	90.1	4.9e-178
WP_080201539.1|1983017_1983284_-	hypothetical protein	NA	NA	NA	NA	NA
1983208:1983228	attR	CCCTTACGCAGGCTTATTTTT	NA	NA	NA	NA
WP_080193535.1|1983509_1984556_+	type III secretion system effector arginine glycosyltransferase SseK2	NA	Q8HAB2	Salmonella_phage	76.4	2.4e-148
WP_001540404.1|1984591_1985008_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_001533113.1|1985129_1985465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273393.1|1986026_1986926_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_000129590.1|1986978_1988031_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_080193536.1|1988284_1989556_+	MFS transporter	NA	NA	NA	NA	NA
WP_000642794.1|1989552_1990557_+	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	22.1	8.4e-05
WP_001012664.1|1990553_1991519_+	sugar kinase	NA	NA	NA	NA	NA
WP_001728489.1|1991492_1992239_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001749141.1|1992274_1993075_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001182163.1|1993061_1993859_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_001531722.1|1993957_1994143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000837534.1|1994268_1994583_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000765280.1|1994844_1995852_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945363.1|1995867_1998357_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000698775.1|1998370_1999054_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001523541.1|1999109_1999640_-	fimbrial protein YehD	NA	NA	NA	NA	NA
WP_000760404.1|1999918_2000200_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005424.1|2000477_2001587_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000195334.1|2001751_2003785_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2004025_2004484_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2004655_2005186_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2005242_2005710_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2005756_2006476_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2006472_2008158_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2008380_2009112_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2009171_2009279_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2009259_2009991_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2009974_2010922_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_023243039.1|2010914_2012084_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000155876.1|2012087_2013005_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871555.1|2013185_2015483_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000095234.1|2015749_2017480_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_023248304.1|2017537_2018485_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001017056.1|2018650_2019238_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_000930540.1|2019369_2019966_+	DedA family protein	NA	NA	NA	NA	NA
WP_000169610.1|2020014_2020776_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001081457.1|2020841_2022278_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000698460.1|2022595_2022679_+	protein YohP	NA	NA	NA	NA	NA
WP_001264839.1|2022736_2023675_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	2129208	2175992	5139919	integrase,transposase,protease	Escherichia_phage(27.27%)	50	2142936:2142950	2175874:2175888
WP_000795949.1|2129208_2130384_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	27.4	2.9e-17
WP_001285422.1|2130553_2130766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|2131126_2132209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|2132374_2133874_-	kinase	NA	NA	NA	NA	NA
WP_000081059.1|2133899_2135537_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|2135536_2136577_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|2136661_2137300_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|2137299_2137941_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|2137963_2138602_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|2139064_2139532_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|2139549_2140758_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|2140768_2141725_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|2141724_2142804_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|2142805_2143579_-	hypothetical protein	NA	NA	NA	NA	NA
2142936:2142950	attL	ACTCCGCGTTCAGCC	NA	NA	NA	NA
WP_001280115.1|2143571_2144714_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_000254137.1|2146101_2146683_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|2146682_2147840_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007449.1|2147862_2148318_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|2148340_2149381_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|2149429_2150008_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|2150076_2150652_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|2151079_2152321_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000374058.1|2152411_2152867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|2153107_2153299_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	57.4	4.7e-10
WP_001151572.1|2153390_2153732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|2154718_2154973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|2154975_2157015_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000211823.1|2157011_2157998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|2158918_2159311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695443.1|2159289_2159601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|2159969_2160626_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123906519.1|2160665_2160848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|2160828_2161326_+	membrane protein	NA	NA	NA	NA	NA
WP_012695445.1|2161330_2162719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|2163119_2163413_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|2163417_2164743_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|2164803_2165010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|2165110_2165521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001805097.1|2165533_2166058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|2166239_2167244_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|2167322_2167757_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000732292.1|2167976_2168252_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|2168287_2168710_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|2168761_2170456_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_114050357.1|2170473_2170836_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|2170832_2171069_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|2171065_2171773_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_151091830.1|2171811_2173527_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|2173529_2174390_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|2175287_2175992_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2175874:2175888	attR	ACTCCGCGTTCAGCC	NA	NA	NA	NA
>prophage 8
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	2192603	2338021	5139919	integrase,transposase	Escherichia_phage(38.1%)	159	2274986:2275045	2301406:2302225
WP_085949440.1|2192603_2193972_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000589001.1|2194147_2195488_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000219087.1|2195909_2197148_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001515348.1|2197623_2198196_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_000167917.1|2198395_2199319_+	cation transporter	NA	NA	NA	NA	NA
WP_100280317.1|2199362_2199557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2199581_2199821_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2199820_2200108_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_001447866.1|2200179_2200338_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000332796.1|2200946_2201267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015183.1|2201548_2201752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743059.1|2201798_2202149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695474.1|2202208_2202811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000778029.1|2202906_2203851_-	DUF5417 domain-containing protein	NA	NA	NA	NA	NA
WP_001272971.1|2204954_2206139_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	30.3	1.7e-17
WP_000708863.1|2206204_2206486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248818.1|2206800_2207502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856246.1|2207636_2207933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286108.1|2207977_2208415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000800251.1|2208482_2209019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537761.1|2209244_2209613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000442693.1|2210045_2210345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091367.1|2210701_2210986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114050403.1|2211051_2211405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338612.1|2211691_2212423_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000952985.1|2212424_2213606_-	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	33.3	3.6e-07
WP_000718549.1|2213616_2214279_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000343600.1|2214265_2215375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284073.1|2215374_2217459_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001011152.1|2217458_2220605_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_033487927.1|2220614_2221352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|2221348_2221834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004208.1|2222593_2223394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140952.1|2223395_2223908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196727.1|2224499_2225546_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001257292.1|2225535_2226951_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_000386160.1|2226959_2230910_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000654195.1|2231032_2231539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902297.1|2231548_2232610_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001371950.1|2232733_2233291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494968.1|2233373_2233913_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000720274.1|2234060_2234810_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000843243.1|2234834_2235227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001439466.1|2235422_2235683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000620988.1|2235742_2236354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031378.1|2236460_2237270_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000281824.1|2237315_2238575_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.5	1.5e-96
WP_000111290.1|2238558_2238993_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	I6S1S3	Salmonella_phage	58.2	5.0e-15
WP_100185530.1|2240303_2241218_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
WP_122966916.1|2241199_2241415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000900745.1|2241383_2241701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371904.1|2241751_2242159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|2242616_2243288_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001100610.1|2243332_2243638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|2243660_2243978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|2244191_2245595_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|2245623_2246256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695466.1|2246375_2247299_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_001567368.1|2247540_2248944_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|2248972_2249605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695466.1|2249724_2250648_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_000125668.1|2250867_2252271_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|2252303_2253008_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_114050406.1|2253094_2253415_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.3	2.0e-21
WP_151091833.1|2253460_2254750_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	3.8e-167
WP_000065802.1|2254762_2255188_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|2255247_2256075_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|2256093_2257572_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|2258063_2258339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|2258479_2258677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000443289.1|2258746_2259034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|2259071_2259326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371948.1|2259371_2259605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|2259663_2259921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|2259994_2260309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|2260356_2261253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464825.1|2261255_2261771_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833380.1|2261985_2263413_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000078513.1|2263663_2264983_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000121164.1|2264995_2265199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371952.1|2265262_2266468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193207.1|2266464_2267283_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000019951.1|2267748_2268021_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|2268143_2269259_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|2269516_2269951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248839.1|2270168_2271515_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_001572374.1|2271598_2272522_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
WP_001572373.1|2272710_2274330_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|2274406_2274883_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
2274986:2275045	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|2275048_2275753_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000057569.1|2276092_2276434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248792.1|2276448_2277240_-	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_000480968.1|2277420_2278257_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2278256_2279060_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000845048.1|2279217_2280231_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_072058701.1|2280199_2280451_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019304.1|2280833_2281403_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	NA	NA	NA	NA
WP_002008781.1|2281402_2281903_-	hypothetical protein	NA	A0A2L0UZT6	Agrobacterium_phage	28.6	2.0e-07
WP_000050481.1|2282168_2283710_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2284114_2284954_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_052238321.1|2284947_2285283_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|2285175_2285541_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|2285544_2286420_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012579084.1|2286605_2287262_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000050481.1|2287525_2289067_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001389365.1|2289529_2290294_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|2290381_2290495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|2290800_2291301_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|2291319_2291499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|2291428_2292268_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2292261_2292609_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012695487.1|2293918_2294350_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012695486.1|2294712_2295126_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_012695485.1|2295253_2296063_-	AAC(3)-II family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
WP_006473457.1|2296304_2297660_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_151091836.1|2298147_2298729_-	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
WP_000845048.1|2298891_2299905_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001550559.1|2300172_2300664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2300697_2301402_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011191340.1|2301660_2301909_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_001067855.1|2302351_2303056_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2301406:2302225	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGCAACAGCCATCACCAACACAACATCTTGTGCGCCGGCAGCTGATCGCGGCCACCATATCTAGTGTTTCAATTTTGGATTGCGCAATCCAAAATAGGCGTAAAAATAACGATGGTTTTCTTTACATGATTGGATTTGCTGGCCACTGTCATTTTCAGAAGACGACTGCACCAGACAACGCGGTTTGAAGGCTGTTGTGCAGTCGTCTATTGAACGAACAGTATCAGGAGTCCGCTGCACGAATGATGACCTCAAGCCGGTTCTGGTCGCGCTGGCGACCGATCAGCCCCTGGATGTGCGATACCGCGACCACGATCTTTCCGGCGATTGGGCGGGCTACCGCGAATGCTACATCAAGCCCGACCTGCTGCTGATCTACCGCAAGTCCGACGCCGACACCCTGCGACTGGCGCGGCTTGGCTCCCATAGCGAGCTGTTCGGCTGATGCCAGTCGCCTTGTCCGCCAAACGATCATTAGGCGGCCAAACCGGACGCCTGTCCGAAAACATCTTGCGCAACGGGATGACGGACAATAAGATAGGCGGACGGTATAACGGACAAATGGGCGGAAATGGCACTCATCGGCTATGCGCGGGTATCGACGGCGGAACAGGACACCGCCTTGCAGACGGATGCGCTGCGCAATGCAGGCTGCGAACGGGTTTTCGAGGACACGGCATCCGGGGCCAAGGCAGACCGGCCCGGCTTGGCCGATGCGCTGGCTTATCTGCGCGATGGCGATGTGCTGGTCGTCTGGCGGC	NA	NA	NA	NA
WP_001067855.1|2307542_2308247_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|2308390_2309032_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|2309181_2309682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2309761_2310466_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138070.1|2310586_2313553_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|2313631_2314636_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|2314817_2314994_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|2315323_2316139_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|2316225_2316528_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|2316421_2316673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058687411.1|2316703_2318197_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|2318407_2318632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|2318628_2319366_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001550559.1|2319472_2319964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2319997_2320702_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_114050400.1|2320692_2320896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645320.1|2321300_2321678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000069824.1|2321769_2322198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001290639.1|2322262_2322520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833775.1|2322675_2323284_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	38.5	4.4e-25
WP_000104393.1|2323454_2324705_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_000834113.1|2324999_2325320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000556022.1|2325562_2325889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001052325.1|2325954_2326212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774871.1|2326441_2327233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646497.1|2327283_2327484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646498.1|2327530_2328454_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
WP_000140246.1|2328570_2328900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|2330715_2330955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|2331017_2331329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159617.1|2331325_2331520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2332035_2332740_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|2334373_2335276_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_023148136.1|2335313_2335547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210513.1|2335537_2336299_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|2336319_2337180_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_071538079.1|2337143_2337326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2337316_2338021_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 9
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	3350906	3405855	5139919	portal,integrase,plate,tRNA,holin,head,tail,terminase,capsid	Cronobacter_phage(61.9%)	61	3368805:3368820	3410503:3410518
WP_000785626.1|3350906_3351305_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|3351307_3351613_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|3351654_3352023_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|3352167_3352551_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|3352554_3353217_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|3353666_3354911_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|3355165_3356134_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000617682.1|3356405_3357404_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|3357492_3358185_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|3358336_3358834_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019989.1|3358919_3360056_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_080193435.1|3360136_3362155_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_122815345.1|3362325_3363756_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	3.0e-32
WP_000094651.1|3364134_3365655_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478471.1|3366042_3367608_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000983434.1|3367604_3368252_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
3368805:3368820	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001145216.1|3369460_3370498_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	6.6e-122
WP_000568369.1|3370501_3371068_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	35.0	3.0e-20
WP_000102874.1|3371084_3371666_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	39.8	2.5e-33
WP_001247709.1|3371801_3372023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|3372053_3372557_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|3372566_3372794_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996838.1|3372783_3373209_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.4	7.6e-24
WP_000022786.1|3373208_3373610_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_071601531.1|3373755_3373932_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|3373922_3374519_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|3374515_3374845_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_024156707.1|3374834_3375695_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.4	8.4e-131
WP_031601742.1|3375691_3377713_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	3.8e-299
WP_000353142.1|3377832_3378039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|3378012_3378336_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038209.1|3378332_3379394_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_080193432.1|3379390_3381166_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.3	1.2e-288
WP_000018802.1|3381326_3382130_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
WP_000550496.1|3382191_3383214_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218537.1|3383217_3383919_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|3383979_3384468_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084221.1|3384464_3384971_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.5e-63
WP_080193431.1|3384967_3385675_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	1.5e-101
WP_023211088.1|3385671_3386799_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	3.3e-175
WP_000166743.1|3386795_3387251_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|3387260_3387554_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|3387550_3387892_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376372.1|3387891_3388224_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_001270303.1|3388195_3388384_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
WP_000411339.1|3388370_3388628_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_080193430.1|3388815_3390786_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.9	9.5e-271
WP_001002797.1|3390782_3391112_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_080193429.1|3391108_3392293_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	3.0e-179
WP_080193428.1|3392285_3392873_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.4e-89
WP_057372175.1|3392882_3395117_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	73.5	1.6e-181
WP_080193427.1|3395129_3395684_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	97.2	7.9e-98
WP_000267950.1|3395673_3396399_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	5.0e-68
WP_000200795.1|3396370_3396916_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	2.5e-64
WP_001748638.1|3396918_3398619_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	4.4e-224
WP_071586451.1|3398776_3398956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|3399790_3400297_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|3400420_3402268_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|3402417_3404163_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|3404398_3404614_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264390.1|3404841_3405855_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
3410503:3410518	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
>prophage 10
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	3445530	3504727	5139919	integrase,transposase,protease	Escherichia_phage(18.18%)	58	3444428:3444487	3458546:3459313
3444428:3444487	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000427623.1|3445530_3446535_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|3446613_3447048_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|3447119_3447470_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|3447483_3447759_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|3447794_3448217_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|3448268_3449963_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|3449980_3450343_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|3450339_3450576_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|3450572_3451280_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|3451318_3452623_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|3452669_3453374_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|3454129_3454981_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|3455288_3456104_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3456164_3456968_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3456967_3457804_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_114050358.1|3457864_3458551_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.9e-133
WP_080193442.1|3459437_3461774_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	2.7e-38
3458546:3459313	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
WP_001176879.1|3461867_3462797_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
WP_080193443.1|3463468_3467929_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_000081635.1|3467938_3469357_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_023250359.1|3469563_3470667_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
WP_000076263.1|3470782_3472036_+	cytosine permease	NA	NA	NA	NA	NA
WP_001180691.1|3472022_3473303_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_000979905.1|3473385_3473853_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000208970.1|3473849_3474725_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054439.1|3474721_3475411_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108071.1|3475457_3476948_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
WP_001029667.1|3477063_3477957_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_080193444.1|3478091_3478883_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366112.1|3478991_3479492_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
WP_000257298.1|3479497_3480136_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000950539.1|3480398_3481151_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_001752154.1|3481150_3481351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829815.1|3481350_3481743_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|3481758_3482187_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001191222.1|3482489_3483614_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_107280761.1|3483806_3484205_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_000716690.1|3484361_3485729_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
WP_000497707.1|3485821_3486892_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_151091842.1|3486978_3487623_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_079902183.1|3487675_3488977_-	oxalacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_079902182.1|3488989_3490765_-	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_000180130.1|3490780_3491023_-	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_023238068.1|3491178_3491796_-	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000045349.1|3491795_3492695_-	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000433394.1|3492727_3493996_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	2.6e-59
WP_001171581.1|3494206_3494872_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000723776.1|3494858_3495488_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000861586.1|3495607_3496546_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257852.1|3496959_3497430_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695695.1|3497794_3498058_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_000853277.1|3498161_3498428_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001103887.1|3498487_3498760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510913.1|3498931_3500899_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000855134.1|3500904_3501837_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051840.1|3501844_3502048_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440300.1|3502229_3503159_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055940.1|3503281_3504727_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 11
NZ_CP044177	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 chromosome, complete genome	5139919	4382444	4426953	5139919	plate,tail,holin,tRNA	Burkholderia_phage(42.86%)	46	NA	NA
WP_114050394.1|4382444_4384190_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	5.5e-52
WP_000359500.1|4384192_4384825_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_080193701.1|4384817_4385933_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4385923_4386283_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_080192448.1|4386446_4387994_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.5e-48
WP_000703634.1|4387993_4388923_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000593184.1|4388919_4389282_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_012512893.1|4389357_4389597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064239905.1|4389605_4390328_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	5.1e-12
WP_023240324.1|4390337_4391381_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_001269716.1|4391368_4391578_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271431.1|4391577_4392531_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_080193702.1|4392530_4394882_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.7	2.4e-66
WP_001185654.1|4394978_4395107_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003638.1|4395066_4395384_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907495.1|4395435_4395960_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_080193703.1|4395959_4397387_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.7	4.0e-194
WP_000875314.1|4397376_4397574_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4397570_4398026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4398185_4398500_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270438.1|4398512_4399118_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_001226440.1|4399120_4399408_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_000615248.1|4399984_4400332_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_080111267.1|4400462_4401812_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790028.1|4402156_4403806_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001804148.1|4404249_4404492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139154705.1|4404525_4405194_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_058145349.1|4405190_4405928_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|4405927_4408024_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4408166_4408577_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4408742_4409633_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|4409647_4411192_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000179176.1|4412873_4413983_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_114050393.1|4414071_4415430_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4415593_4416511_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4416691_4417189_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4417202_4418075_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4418173_4420594_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4420764_4421133_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4421241_4421850_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128116.1|4422028_4423354_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|4423350_4423464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4423485_4423695_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416272.1|4423794_4424310_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039335.1|4424556_4425867_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001825318.1|4425954_4426953_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP044178	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1	44544	537	44230	44544	portal,plate,terminase,tail	Vibrio_phage(36.67%)	60	NA	NA
WP_151091885.1|537_2007_+|tail	phage tail sheath family protein	tail	A0A059WKP9	Vibrio_phage	54.3	2.0e-148
WP_001623391.1|2019_2541_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
WP_001623392.1|2550_2832_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_077909624.1|3538_5443_+|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	26.2	1.6e-41
WP_151091888.1|5435_5654_+|tail	tail protein X	tail	A0A067ZJB1	Vibrio_phage	43.1	2.7e-09
WP_001623396.1|5643_6645_+	phage late control D	NA	A0A067ZG47	Vibrio_phage	42.8	3.3e-70
WP_001623397.1|6645_7266_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
WP_151091891.1|7262_7730_+|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	34.6	1.7e-13
WP_021000619.1|7726_8050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844514.1|8046_9171_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.7	9.4e-90
WP_023220967.1|9163_9745_+|tail	phage tail protein I	tail	R4JET8	Burkholderia_phage	36.5	2.3e-23
WP_151091894.1|11844_12378_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	81.5	4.6e-79
WP_151091897.1|12381_12999_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	87.2	4.0e-98
WP_151091900.1|12968_13961_-|tail	phage tail protein	tail	A0A1S6KZZ0	Salmonella_phage	90.9	5.5e-174
WP_063917224.1|13990_14578_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.9	1.4e-76
WP_057516469.1|14903_15737_+	RepA	NA	NA	NA	NA	NA
WP_139679659.1|16434_16683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151091903.1|16923_17274_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_057516472.1|17270_17570_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_151091906.1|17724_18105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080178177.1|18176_18449_+	helix-turn-helix domain-containing protein	NA	H2DE32	Erwinia_phage	42.3	5.4e-07
WP_151091909.1|19078_19723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151091912.1|19748_20897_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	61.9	9.8e-34
WP_151091915.1|20893_21085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516478.1|21585_21834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516479.1|21877_22528_-	P-loop NTPase	NA	A0A219YB79	Aeromonas_phage	34.5	5.8e-23
WP_057516480.1|22675_23056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516481.1|23150_23810_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057516482.1|23984_24479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516483.1|24475_24946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516484.1|24942_25179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516485.1|25175_25580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516486.1|25576_25909_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	40.7	8.5e-15
WP_057516487.1|25912_26290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516488.1|26286_26730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151091919.1|26854_27928_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_063917212.1|27999_29058_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	62.7	2.1e-123
WP_063917211.1|29068_29350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516491.1|29346_29553_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	54.8	7.9e-11
WP_057516492.1|29947_30238_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_057516493.1|30234_30480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151091923.1|30476_30902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151091925.1|30894_31158_+	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	93.1	5.0e-42
WP_057516496.1|31608_31824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149866149.1|31825_32026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516497.1|32250_32538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151091928.1|32540_33080_+	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	88.1	7.7e-90
WP_063917209.1|33069_33624_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	61.1	3.0e-44
WP_057516500.1|34444_35014_+	S-adenosylmethionine-binding protein	NA	A0A193GYV6	Enterobacter_phage	68.9	8.5e-71
WP_057516501.1|35127_35421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080178190.1|35678_35942_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.4	3.5e-19
WP_151091931.1|35995_36178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063917205.1|36171_36795_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	49.3	4.5e-33
WP_151091934.1|36794_38168_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_151091937.1|38178_38895_+	glycosyltransferase family 1 protein	NA	A0A1W6JTE1	Pseudomonas_phage	35.2	5.9e-29
WP_020844528.1|39419_40010_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	53.7	1.4e-36
WP_021000637.1|40009_40555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023220975.1|40560_42420_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	63.5	1.1e-231
WP_079956356.1|42431_42671_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	5.2e-14
WP_151091941.1|42667_44230_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	64.7	1.5e-189
>prophage 1
NZ_CP044179	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-2	35315	33	34971	35315	capsid,head,portal,holin,tail,plate	Escherichia_phage(97.14%)	35	NA	NA
WP_000076909.1|33_372_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	99.1	2.6e-51
WP_001217888.1|385_1342_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	1.7e-180
WP_001272821.1|1608_1893_+	alanine racemase	NA	A0A222YXW1	Escherichia_phage	83.0	4.0e-37
WP_000887293.1|1892_2699_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	100.0	7.7e-118
WP_151091944.1|2769_3228_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	98.7	2.7e-67
WP_000020025.1|3381_3840_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	100.0	2.1e-88
WP_000331486.1|3856_4249_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	99.2	1.5e-66
WP_151091946.1|4407_6105_+|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	99.8	0.0e+00
WP_001396841.1|6252_6531_+	Ig-like domain-containing protein	NA	A0A222YWH8	Escherichia_phage	100.0	3.1e-42
WP_001033852.1|6598_8257_+|tail	tail sheath protein	tail	A0A222YWC8	Escherichia_phage	100.0	1.2e-311
WP_000801017.1|8300_9035_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_001112721.1|9102_9675_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	99.5	1.8e-100
WP_000012433.1|9683_10175_+	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_032273868.1|10229_10781_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	99.5	4.6e-98
WP_000021876.1|10796_11504_+	hypothetical protein	NA	A0A222YY05	Escherichia_phage	99.6	1.4e-126
WP_000361425.1|11738_12599_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	83.7	6.2e-134
WP_151091949.1|12953_13775_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.3	2.2e-157
WP_151091952.1|13789_17572_+	transglycosylase	NA	A0A222YXR4	Escherichia_phage	98.3	0.0e+00
WP_000965099.1|17577_17952_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	99.2	1.6e-65
WP_000156304.1|17948_19379_+|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	99.4	2.0e-270
WP_001396839.1|20624_20774_+	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
WP_151091954.1|20776_23692_+|tail	tail fiber protein	tail	A0A222YWB9	Escherichia_phage	74.2	0.0e+00
WP_151091962.1|23695_24223_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	96.6	3.1e-91
WP_000972144.1|24251_24785_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	100.0	4.9e-97
WP_151091957.1|24787_26308_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	92.5	2.7e-281
WP_074525606.1|26355_26916_-	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	98.4	1.0e-97
WP_000457140.1|27022_27349_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_000526264.1|27348_27795_+	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_000066532.1|27784_28405_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	99.5	1.1e-79
WP_114447218.1|28397_30317_+|head	head protein	head	A0A222YWA3	Escherichia_phage	94.9	4.3e-308
WP_000156174.1|30316_30685_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	8.0e-38
WP_074525603.1|30779_32144_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	98.9	2.1e-245
WP_000094097.1|32269_32827_+	DUF4145 domain-containing protein	NA	A0A222YYQ2	Escherichia_phage	99.5	2.3e-97
WP_001244352.1|32871_33204_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	99.1	2.6e-56
WP_151091960.1|33738_34971_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	99.5	8.1e-236
>prophage 1
NZ_CP044180	Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-3, complete sequence	106569	0	106239	106569	tail,protease,terminase,portal,integrase	Salmonella_phage(91.74%)	130	25207:25224	77948:77965
WP_114050420.1|140_803_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.3	4.0e-80
WP_046622184.1|877_1759_-	hypothetical protein	NA	J9Q710	Salmonella_phage	91.5	1.9e-149
WP_059468739.1|1784_2681_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	90.9	1.2e-140
WP_059468740.1|2702_4277_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	95.0	5.2e-288
WP_046622192.1|4309_5566_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.1	1.4e-246
WP_046622195.1|5568_6210_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	96.2	3.5e-105
WP_046622198.1|6404_6671_-	hypothetical protein	NA	J9Q757	Salmonella_phage	97.7	4.3e-41
WP_114050421.1|6680_7580_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.6	3.2e-165
WP_001113021.1|7576_7831_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_016051719.1|7823_8462_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
WP_063133975.1|8458_9127_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	96.4	2.0e-111
WP_046622214.1|9126_9825_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	95.3	3.2e-120
WP_114050422.1|9889_11449_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	95.8	9.2e-285
WP_046622218.1|11451_11730_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	95.7	3.8e-40
WP_046622220.1|11792_12215_+	hypothetical protein	NA	J9Q806	Salmonella_phage	87.9	2.6e-64
WP_114050423.1|12219_12747_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	87.8	9.9e-74
WP_046622226.1|13068_13716_+	hypothetical protein	NA	J9Q754	Salmonella_phage	89.8	8.4e-99
WP_046622227.1|13766_13970_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	97.0	8.3e-29
WP_114050424.1|14614_15097_-	hypothetical protein	NA	J9Q805	Salmonella_phage	76.7	3.0e-69
WP_048665939.1|15320_15509_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	63.0	5.0e-12
WP_114050425.1|15536_15818_-	ABC transporter	NA	J9Q753	Salmonella_phage	86.0	5.3e-42
WP_114050426.1|15945_16338_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	77.7	1.6e-49
WP_046622236.1|16468_16780_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	73.8	6.3e-36
WP_114050427.1|16920_17142_-	hypothetical protein	NA	J9Q804	Salmonella_phage	88.9	1.5e-31
WP_114050428.1|17152_17371_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	87.5	2.6e-28
WP_088263041.1|17513_17759_+	hypothetical protein	NA	J9Q751	Salmonella_phage	86.2	7.9e-34
WP_072206342.1|19179_19365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058662213.1|19409_19727_-	hypothetical protein	NA	J9Q750	Salmonella_phage	78.1	8.4e-44
WP_058662212.1|19720_19963_-	DUF1380 family protein	NA	J9Q7H8	Salmonella_phage	88.5	6.4e-36
WP_058662278.1|20047_20314_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	73.6	1.8e-31
WP_058662277.1|20444_20630_-	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	86.0	4.0e-22
WP_058662276.1|20629_20848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058662282.1|20844_21381_-	hypothetical protein	NA	J9Q748	Salmonella_phage	79.5	2.3e-78
WP_046622254.1|21377_22019_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	92.0	6.3e-107
WP_058662275.1|22111_22483_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	62.6	3.1e-37
WP_058662274.1|22485_22767_-	hypothetical protein	NA	J9Q801	Salmonella_phage	75.3	1.3e-35
WP_058662273.1|22763_23453_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	79.5	1.4e-96
WP_114050429.1|23510_25214_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	93.6	0.0e+00
25207:25224	attL	TTAAACAAATTGTTTTCT	NA	NA	NA	NA
WP_058662271.1|25335_25905_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	62.1	2.0e-59
WP_114050436.1|26012_26771_-	Rha family transcriptional regulator	NA	J9Q7T3	Salmonella_phage	88.5	1.9e-118
WP_065189858.1|26851_27025_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_058662270.1|27024_27450_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	69.5	2.6e-48
WP_058662269.1|27515_27704_-	hypothetical protein	NA	J9Q800	Salmonella_phage	71.0	1.4e-17
WP_058662268.1|27700_27955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046622287.1|28353_28962_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	95.0	6.8e-111
WP_058662267.1|29550_29781_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	81.3	2.9e-30
WP_058662266.1|29980_30574_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	91.9	1.4e-105
WP_114050430.1|30758_31601_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	65.4	5.3e-77
WP_058662264.1|31725_32283_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	87.4	9.4e-91
WP_046622296.1|32292_32712_-	hypothetical protein	NA	J9Q743	Salmonella_phage	81.3	2.3e-57
WP_058662263.1|32775_33420_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	83.6	4.4e-100
WP_046622299.1|33419_33896_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	84.8	1.0e-77
WP_046622303.1|33892_34306_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	92.0	1.1e-67
WP_114050431.1|34307_35423_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	91.0	9.7e-204
WP_058662261.1|35595_36471_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	88.2	1.4e-144
WP_058662260.1|36552_37695_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	4.4e-212
WP_058662259.1|37824_40140_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	93.0	0.0e+00
WP_058662258.1|40217_40787_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	96.8	5.1e-100
WP_114050437.1|40797_41511_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	63.7	1.1e-78
WP_058662256.1|41536_43453_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	82.4	3.1e-282
WP_046622040.1|43449_43686_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	77.8	2.1e-23
WP_058662255.1|43682_44768_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	93.6	3.5e-198
WP_058662254.1|44939_45434_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	91.4	5.4e-82
WP_058662253.1|45509_46154_-	hypothetical protein	NA	J9Q739	Salmonella_phage	94.9	2.1e-118
WP_058662252.1|46896_47952_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	90.1	5.6e-169
WP_058662251.1|48517_48730_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	91.4	1.1e-31
WP_114050432.1|48729_49044_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	77.9	2.1e-39
WP_046622060.1|49061_49241_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	1.9e-16
WP_058662249.1|49281_49557_-	hypothetical protein	NA	J9Q738	Salmonella_phage	76.9	7.8e-38
WP_046622065.1|49624_50035_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	91.9	3.2e-72
WP_046622069.1|50469_51300_-|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	95.7	7.4e-124
WP_046622071.1|51299_51503_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	67.7	2.9e-13
WP_046622073.1|51595_52669_-	recombinase	NA	J9Q736	Salmonella_phage	96.9	9.0e-199
WP_058662247.1|52671_52938_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	88.6	1.8e-36
WP_058662246.1|52937_53882_-	exonuclease	NA	J9Q7S6	Salmonella_phage	95.5	1.8e-174
WP_058662245.1|53942_54965_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	95.3	1.6e-157
WP_058662244.1|55084_55516_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	2.5e-67
WP_058662243.1|55617_56061_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	94.3	4.4e-67
WP_114050407.1|56057_59576_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	96.2	0.0e+00
WP_114050408.1|59550_59754_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	89.6	1.1e-28
WP_114050409.1|59756_60992_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	94.4	5.7e-229
WP_114050410.1|61088_63413_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	83.3	2.8e-293
WP_114050433.1|63527_63740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114050411.1|64002_64383_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_114050412.1|64374_65481_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.1	4.3e-26
WP_080396464.1|65744_66125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058662242.1|66570_66816_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	46.8	3.5e-13
WP_006812571.1|66815_67181_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
WP_080396462.1|67196_67427_-	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	51.6	1.8e-08
WP_072206346.1|67410_68244_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	2.9e-88
WP_139156587.1|68426_69623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058662238.1|69823_70435_-	hypothetical protein	NA	S4TP42	Salmonella_phage	48.0	6.8e-42
WP_058662237.1|71718_72024_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	64.4	1.1e-29
WP_046622125.1|72169_72385_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	75.7	1.4e-23
WP_114050434.1|72371_72545_-	hypothetical protein	NA	J9Q729	Salmonella_phage	71.4	2.3e-16
WP_058662236.1|72544_73867_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	92.3	2.4e-241
WP_046622318.1|73901_74150_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	75.3	4.4e-24
WP_072206355.1|74045_74399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058662235.1|74450_75245_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	73.9	6.4e-109
WP_058662234.1|75323_76439_-	hypothetical protein	NA	J9Q720	Salmonella_phage	93.0	1.0e-208
WP_058662233.1|76589_77930_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	98.7	9.4e-246
WP_058662232.1|77990_78716_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	93.4	2.8e-135
77948:77965	attR	TTAAACAAATTGTTTTCT	NA	NA	NA	NA
WP_058662231.1|78905_79316_-	hypothetical protein	NA	J9Q6F2	Salmonella_phage	67.6	4.0e-46
WP_058662230.1|79302_79950_-	hypothetical protein	NA	J9Q719	Salmonella_phage	68.2	1.4e-69
WP_058662229.1|79951_80311_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	8.6e-45
WP_058662228.1|80310_80976_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	93.7	4.0e-112
WP_058662227.1|81171_81921_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.6	4.2e-17
WP_058662226.1|81905_82289_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.0e-11
WP_058662225.1|82679_82931_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.5e-27
WP_058662224.1|82932_83625_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.0	5.6e-125
WP_046622152.1|83636_83960_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	3.7e-47
WP_072206343.1|84050_84875_-	hypothetical protein	NA	A0A2K9VBP2	Citrobacter_phage	53.9	2.2e-27
WP_058662279.1|85160_85391_-	lipoprotein	NA	J9Q714	Salmonella_phage	78.9	1.1e-29
WP_080396463.1|85402_85969_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	91.5	4.4e-96
WP_058662220.1|86010_86265_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	79.8	1.5e-35
WP_058662219.1|86308_86866_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	57.3	5.1e-52
WP_114050435.1|86865_89550_-|tail	tail fiber domain-containing protein	tail	J9Q6E3	Salmonella_phage	48.2	3.6e-212
WP_114050414.1|91152_95430_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	93.3	0.0e+00
WP_046622159.1|95446_96037_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	96.4	3.8e-106
WP_114050415.1|96024_96822_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	92.1	1.8e-151
WP_114050416.1|96814_97546_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	98.3	7.4e-136
WP_063133979.1|97602_97938_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.4	2.5e-54
WP_114050417.1|97978_102559_-	tape measure protein	NA	J9Q712	Salmonella_phage	83.8	0.0e+00
WP_113772462.1|102566_102836_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
WP_000163862.1|102916_103234_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_059468733.1|103294_104041_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	88.7	3.9e-116
WP_046622172.1|104114_104498_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.4e-56
WP_114050418.1|104499_104973_-	hypothetical protein	NA	J9Q711	Salmonella_phage	91.7	2.1e-75
WP_046622175.1|104963_105308_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	91.2	7.4e-54
WP_114050419.1|105405_106239_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	88.8	1.2e-137
