The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044163	Campylobacter coli strain AR-0418 chromosome, complete genome	1726506	442040	448127	1726506		Synechococcus_phage(28.57%)	7	NA	NA
WP_151036023.1|442040_442709_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	23.6	1.8e-08
WP_002836597.1|442696_443302_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	35.8	4.1e-15
WP_088567398.1|443289_444309_-	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	38.1	7.6e-54
WP_002836601.1|444312_445344_-	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	74.5	7.0e-148
WP_052781507.1|445340_446507_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES46	Bathycoccus_sp._RCC1105_virus	33.3	1.5e-45
WP_058001889.1|446507_447566_-	GDP-L-fucose synthase	NA	M1HVW2	Paramecium_bursaria_Chlorella_virus	41.8	2.4e-74
WP_052781505.1|447569_448127_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D7XFA9	Escherichia_phage	30.3	3.2e-14
>prophage 2
NZ_CP044163	Campylobacter coli strain AR-0418 chromosome, complete genome	1726506	992685	1061432	1726506	plate,protease,integrase,transposase,tRNA,tail	Campylobacter_phage(37.5%)	80	1020808:1020829	1055722:1055743
WP_002778039.1|992685_993909_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	4.0e-118
WP_002782475.1|993922_994963_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_151036082.1|994952_995702_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002782477.1|995696_996620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002837815.1|996867_998775_+	propionyl-CoA synthetase	NA	A0A2K9L3I8	Tupanvirus	19.9	1.6e-12
WP_002778052.1|998774_999650_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_151036083.1|999646_1000774_+	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_002794094.1|1000783_1002238_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_002791357.1|1002528_1002762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784646.1|1003017_1003647_+	S24 family peptidase	NA	A7YG70	Campylobacter_phage	98.2	4.8e-59
WP_002784648.1|1004056_1004251_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	96.9	1.1e-27
WP_002784651.1|1004330_1004618_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	97.9	1.6e-46
WP_002794206.1|1004645_1005461_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	94.5	2.2e-144
WP_002791365.1|1008430_1008736_+	hypothetical protein	NA	A7YG88	Campylobacter_phage	90.1	1.9e-32
WP_002791367.1|1008847_1009087_-|tail	phage tail assembly protein	tail	A7YG75	Campylobacter_phage	89.9	1.5e-08
WP_002794205.1|1009190_1009700_-|tail	tail protein	tail	A7YGZ4	Campylobacter_phage	99.4	5.6e-90
WP_002794204.1|1009723_1010917_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	98.7	1.4e-200
WP_002794203.1|1010927_1011941_-	hypothetical protein	NA	A7YGY4	Campylobacter_phage	95.8	1.2e-184
WP_002789987.1|1011937_1012324_-	DUF1353 domain-containing protein	NA	A7YGM3	Campylobacter_phage	88.4	9.2e-61
WP_002784666.1|1012316_1014074_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002784668.1|1014073_1014709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827111.1|1014718_1015753_-|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	88.8	2.6e-78
WP_057981097.1|1015752_1016373_-|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	90.6	6.0e-54
WP_057981096.1|1016461_1017628_-|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	24.3	6.7e-14
WP_057981095.1|1017624_1017915_-|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	37.8	1.8e-08
WP_002791385.1|1017911_1018124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002791387.1|1018123_1018621_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.8	1.5e-10
WP_002784492.1|1018620_1018935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784496.1|1019046_1019295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002854893.1|1019291_1019633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784499.1|1019643_1020033_-	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.3	1.1e-21
WP_002784501.1|1020180_1020615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002794192.1|1020616_1021432_+	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	47.6	6.5e-24
1020808:1020829	attL	AAAAAATGAAAAAGCACCCGCT	NA	NA	NA	NA
WP_151036084.1|1021434_1021962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784507.1|1021964_1022942_+	hypothetical protein	NA	R9TRN2	Rhizobium_phage	23.4	3.3e-06
WP_002784509.1|1023057_1023516_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_002809611.1|1025668_1027039_+	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.6	4.5e-17
WP_002793898.1|1028401_1028776_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002784520.1|1028768_1028960_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002795454.1|1028953_1029931_+|tail	tail protein	tail	A0A219Y9Y2	Aeromonas_phage	25.3	1.4e-12
WP_002791403.1|1029927_1030212_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_041016317.1|1030304_1030976_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_002793905.1|1030967_1031243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793907.1|1031289_1031739_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_002793908.1|1031735_1032428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151036140.1|1032427_1032664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002791413.1|1033753_1034140_-	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	56.4	2.7e-36
WP_002791414.1|1034136_1034409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793910.1|1034472_1034652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793911.1|1034648_1035134_-	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	33.3	3.5e-17
WP_002793912.1|1035134_1035332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793915.1|1035328_1035667_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_002784541.1|1035868_1036054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793918.1|1036050_1036242_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002793919.1|1036245_1037169_-	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	24.8	7.9e-10
WP_070234398.1|1037339_1039400_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002803714.1|1039401_1039602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002803715.1|1039753_1040401_+	LexA family transcriptional regulator	NA	M5A9D2	Nitratiruptor_phage	42.1	4.8e-22
WP_151036085.1|1040475_1041366_+	DMT family transporter	NA	NA	NA	NA	NA
WP_126656004.1|1041349_1042180_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_002782064.1|1045677_1046529_+	site-specific DNA-methyltransferase	NA	A0A1W6JJW1	Lactococcus_phage	32.2	1.8e-24
WP_002782066.1|1046525_1047047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002778064.1|1047046_1047469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002778066.1|1047465_1048452_-	transaldolase	NA	NA	NA	NA	NA
WP_002778068.1|1048453_1049077_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_002778071.1|1049076_1049598_-	purine-binding chemotaxis protein CheW	NA	Q56AR1	Bacillus_thuringiensis_phage	22.5	2.5e-05
WP_002794080.1|1049602_1051897_-	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	26.7	2.0e-14
WP_002778075.1|1051900_1052857_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.0	1.9e-38
WP_002778076.1|1052849_1053485_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
WP_002778078.1|1053617_1054103_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002778080.1|1054120_1055212_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_002783252.1|1055359_1056235_+	zinc transporter ZupT	NA	NA	NA	NA	NA
1055722:1055743	attR	AAAAAATGAAAAAGCACCCGCT	NA	NA	NA	NA
WP_151036141.1|1056288_1056801_-	cytolethal distending toxin subunit A	NA	NA	NA	NA	NA
WP_002788020.1|1057696_1058203_-	toxin	NA	A5LH52	Enterobacteria_phage	35.6	4.6e-20
WP_032685635.1|1058461_1058839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079749801.1|1058902_1059031_-	phosphoglycerate transporter	NA	NA	NA	NA	NA
WP_100219628.1|1059034_1059202_-	phosphoglycerate transporter	NA	NA	NA	NA	NA
WP_151036086.1|1059351_1059558_-	phosphoglycerate transporter	NA	NA	NA	NA	NA
WP_057980413.1|1059548_1059770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151036087.1|1060772_1061432_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	29.4	6.0e-12
>prophage 3
NZ_CP044163	Campylobacter coli strain AR-0418 chromosome, complete genome	1726506	1632813	1698765	1726506	plate,tRNA,terminase,tail	Campylobacter_phage(46.88%)	69	NA	NA
WP_002834674.1|1632813_1635135_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_052780323.1|1635131_1636124_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.9	2.9e-34
WP_002776987.1|1636244_1636610_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_038846940.1|1636648_1637218_-	4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein	NA	NA	NA	NA	NA
WP_144584306.1|1637462_1638206_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002776993.1|1638198_1638927_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	4.9e-31
WP_057043274.1|1638953_1640387_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_002779589.1|1640543_1641011_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002786429.1|1641013_1642003_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	25.7	5.3e-12
WP_151036131.1|1642002_1642980_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002779592.1|1643311_1643617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002779593.1|1643717_1644134_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_002779594.1|1644137_1644590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002779595.1|1644586_1645141_+	SCO family protein	NA	NA	NA	NA	NA
WP_002779596.1|1645146_1646046_-	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	51.3	2.3e-70
WP_002779597.1|1646173_1646464_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	55.1	1.4e-16
WP_151036132.1|1646540_1648382_-	invasion protein CiaB	NA	NA	NA	NA	NA
WP_002781726.1|1648446_1648860_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002779600.1|1648905_1649103_-	KCU-star family selenoprotein	NA	NA	NA	NA	NA
WP_002784343.1|1649083_1651195_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_002779602.1|1651580_1652510_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	38.1	3.9e-49
WP_002779604.1|1653279_1654032_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002781720.1|1654033_1654813_-	bifunctional adhesin/ABC transporter aspartate/glutamate-binding protein PEB1a	NA	A0A1B1IT51	uncultured_Mediterranean_phage	25.2	7.9e-11
WP_139848263.1|1655727_1656516_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002779608.1|1656528_1657083_-	chemotaxis protein CheB	NA	NA	NA	NA	NA
WP_151036133.1|1657251_1657689_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_002779610.1|1657688_1658021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002779611.1|1658017_1658566_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	38.2	8.8e-25
WP_002779612.1|1658575_1659271_+	DedA family protein	NA	NA	NA	NA	NA
WP_002779616.1|1663209_1664784_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.8	4.2e-152
WP_151036134.1|1664792_1666586_-	biotin attachment protein	NA	NA	NA	NA	NA
WP_002778944.1|1666608_1667958_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_002785015.1|1669549_1669888_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_002778951.1|1670456_1670873_+	NTPase	NA	NA	NA	NA	NA
WP_002778955.1|1672420_1673296_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002778957.1|1673372_1673948_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_002778960.1|1673952_1674126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002781916.1|1674135_1674663_-	thermonuclease family protein	NA	A0A218ML12	uncultured_virus	35.3	5.5e-08
WP_002791357.1|1675724_1675958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784646.1|1676213_1676843_+	S24 family peptidase	NA	A7YG70	Campylobacter_phage	98.2	4.8e-59
WP_002784647.1|1676923_1677244_+	hypothetical protein	NA	A7YG71	Campylobacter_phage	97.2	1.6e-50
WP_002784648.1|1677253_1677448_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	96.9	1.1e-27
WP_002784651.1|1677527_1677815_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	97.9	1.6e-46
WP_002794206.1|1677842_1678658_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	94.5	2.2e-144
WP_002791360.1|1678762_1679251_-	virion morphogenesis protein	NA	A7YGZ0	Campylobacter_phage	90.7	8.6e-80
WP_002791362.1|1679254_1681588_-|tail	phage tail tape measure protein	tail	A7YGE8	Campylobacter_phage	89.8	0.0e+00
WP_002791365.1|1681629_1681935_+	hypothetical protein	NA	A7YG88	Campylobacter_phage	90.1	1.9e-32
WP_002791367.1|1682046_1682286_-|tail	phage tail assembly protein	tail	A7YG75	Campylobacter_phage	89.9	1.5e-08
WP_002794205.1|1682389_1682899_-|tail	tail protein	tail	A7YGZ4	Campylobacter_phage	99.4	5.6e-90
WP_002794204.1|1682922_1684116_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	98.7	1.4e-200
WP_002794203.1|1684126_1685140_-	hypothetical protein	NA	A7YGY4	Campylobacter_phage	95.8	1.2e-184
WP_002789987.1|1685136_1685523_-	DUF1353 domain-containing protein	NA	A7YGM3	Campylobacter_phage	88.4	9.2e-61
WP_002784666.1|1685515_1687273_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002784668.1|1687272_1687908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151036135.1|1687917_1688952_-|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	88.2	1.0e-77
WP_002794200.1|1688951_1689572_-|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	88.9	2.5e-52
WP_002794198.1|1689568_1690735_-|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	24.1	6.7e-14
WP_002794196.1|1690731_1691022_-|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	39.0	3.6e-09
WP_002791385.1|1691018_1691231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002791387.1|1691230_1691728_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.8	1.5e-10
WP_002784498.1|1692396_1692738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784499.1|1692748_1693138_-	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.3	1.1e-21
WP_002784501.1|1693285_1693720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002794192.1|1693721_1694537_+	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	47.6	6.5e-24
WP_151036084.1|1694539_1695067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784507.1|1695069_1696047_+	hypothetical protein	NA	R9TRN2	Rhizobium_phage	23.4	3.3e-06
WP_002784509.1|1696161_1696620_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_002784511.1|1696612_1697095_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_002794188.1|1697094_1698765_+|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	41.2	1.1e-91
