The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	68239	138068	4593360	transposase,tRNA	Acinetobacter_phage(25.0%)	43	NA	NA
WP_000937573.1|68239_69427_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001260991.1|71039_71696_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586723.1|71998_72592_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_151106349.1|72588_73581_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234071.1|73704_74685_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000140890.1|74679_75216_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|75278_75503_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375966.1|75642_77298_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013771.1|77522_78866_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414573.1|79082_80006_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098548.1|80043_81684_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_094081542.1|83305_84534_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_094081541.1|84600_85757_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.0e-68
WP_023517637.1|86131_86281_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|86352_86526_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|86770_87301_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115920.1|88531_89971_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000139508.1|93360_97263_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048979.1|97463_98069_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_094081540.1|98831_99987_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	3.0e-67
WP_094081518.1|100860_102017_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_000431884.1|102073_103714_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_105322328.1|103729_104614_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177546.1|104624_105230_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000762218.1|108763_109753_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-70
WP_000900893.1|109960_112600_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|112596_112782_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_011069403.1|112786_113116_+	YdbL family protein	NA	NA	NA	NA	NA
WP_014532269.1|114397_114664_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628265.1|114937_118462_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295593.1|120098_120533_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000081423.1|120708_121644_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	3.2e-144
WP_000123730.1|121772_123140_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.2e-51
WP_000387377.1|123617_124601_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_011069405.1|126925_128380_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_000957853.1|128884_129073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587200.1|130444_131092_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000156575.1|131188_132004_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000945011.1|132547_133063_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000611911.1|133257_134010_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_001262123.1|134161_135112_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000124119.1|136515_136881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937573.1|136880_138068_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	145121	205499	4593360	tail,transposase,integrase,tRNA	Enterobacteria_phage(44.12%)	60	138253:138312	203324:203762
138253:138312	attL	CGATGAACCCCGAACACATGGCAGAGTGTGACCACAGGATAATGCGCTCTGAGTTTCCCG	NA	NA	NA	NA
WP_001189099.1|145121_145514_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.8	2.0e-31
WP_000976476.1|146591_146933_-	YebY family protein	NA	NA	NA	NA	NA
WP_000168747.1|147821_148196_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|148334_148565_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000944268.1|149346_150009_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	3.5e-07
WP_000936980.1|150005_152066_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024751.1|152275_152935_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_005047608.1|153261_153618_-	protein YebF	NA	NA	NA	NA	NA
WP_000173487.1|154108_155287_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|155342_155984_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069479.1|156020_157832_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301736.1|158066_159542_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056694.1|159878_160748_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000044417.1|160875_162318_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448385.1|162448_163420_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|163539_164862_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|164877_165810_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202992.1|165888_166644_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	3.8e-18
WP_000571470.1|166640_167426_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568525.1|167572_168583_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.2	2.8e-08
WP_000580324.1|168591_169203_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|169341_169407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|169476_170079_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000974712.1|170080_170602_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|170636_171377_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|171405_171858_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258670.1|171975_173748_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891627.1|174057_174312_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_005049126.1|174503_175700_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000530007.1|176155_176332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001210039.1|176428_176677_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	4.1e-38
WP_151106351.1|179780_181196_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	44.8	7.3e-47
WP_001230368.1|181259_181859_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	6.1e-104
WP_000515521.1|181926_185406_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_000090877.1|185466_186069_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_000194740.1|186005_186749_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_001152490.1|186753_187452_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000447264.1|187451_187781_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_000371983.1|187780_190822_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
WP_001161004.1|190793_191123_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_000478927.1|191131_191518_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_000211126.1|191576_192317_-	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.7	1.5e-128
WP_001079406.1|192327_192729_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	97.7	1.6e-71
WP_000677125.1|192725_193316_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.7	4.8e-77
WP_000753026.1|193302_193674_-|tail	tail attachment protein	tail	NA	NA	NA	NA
WP_001074423.1|193685_194087_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	66.2	3.3e-37
WP_005049126.1|194350_195547_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001064885.1|196732_197422_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.4	2.9e-57
WP_001215517.1|197418_197778_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.1	8.3e-40
WP_000248820.1|197777_197915_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	100.0	1.9e-16
WP_000755956.1|199635_200463_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	94.5	2.3e-125
WP_001099210.1|200506_201256_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	96.0	1.7e-135
WP_000586688.1|201252_201822_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	6.8e-28
WP_000457719.1|201945_202188_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	85.0	6.2e-31
WP_001030133.1|202191_202338_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	1.4e-22
WP_000528720.1|202346_202544_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.2	3.7e-26
WP_000747032.1|202518_203687_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000905997.1|203916_204267_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
203324:203762	attR	CGATGAACCCCGAACACATGGCAGAGTGTGACCACAGGATAATGCGCTCTGAGTTTCCCGATTATCGAGAACTGTTCAGGGAGTCTGACATCAAGAGCGCGGTAGCCTTTTTTAATATTTCATTCTCCATTTCAATGCGTTGTAGCTTTTTCCTGAGCTCACGGATTTCAATTTGTTCCGGGGTAATGGGGGAGGCTTTTGGTGTTTTGCCCTGACGCTCATCACGCAGTTGTTTGACCCATCTTGTCATTGTGGAAAGGCCAACATCCATAGCTTTGGCGGCATCTGCCACCGTGTATTTCTGGTCAACAACCAGTTGAGCGGATTCGCGTTTAAACTCTGCGCTAAAATTTCTTTTTTTCATTGGAGCACCTGTGTTGTTCTGAGGTGAGCATATCACCTCTGTTCAGGTGGCCAAATTCAGTGTGCCACTTCACCC	NA	NA	NA	NA
WP_005048647.1|204319_204715_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|204755_205499_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 3
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	291674	355824	4593360	tail,transposase,holin,integrase	Stx2-converting_phage(23.33%)	50	283051:283064	358684:358697
283051:283064	attL	CTGACTGGTGGTTT	NA	NA	NA	NA
WP_094081536.1|291674_292822_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.5e-146
WP_111778310.1|293660_294889_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	9.8e-173
WP_000218218.1|296532_297384_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826714.1|297491_298850_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|298849_299521_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|299653_300067_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001240061.1|301180_301816_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007781.1|302073_302724_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000937511.1|303801_304071_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_000239881.1|304127_304796_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014532281.1|305111_306755_+	T3SS effector E3 ubiquitin-protein ligase IpaH4/H7	NA	NA	NA	NA	NA
WP_000594909.1|309159_309642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785377.1|309709_311659_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	98.2	0.0e+00
WP_001251340.1|311743_312079_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	97.2	9.8e-51
WP_001062338.1|312078_312435_-|tail	phage tail tube protein	tail	Q8W622	Enterobacteria_phage	98.3	5.3e-63
WP_000155743.1|312434_313931_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8W623	Enterobacteria_phage	97.2	3.8e-272
WP_000497744.1|313927_314089_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	76.6	9.2e-15
WP_094081529.1|314482_315639_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_005049241.1|317290_317641_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
WP_004967157.1|317637_318312_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000839572.1|318410_318626_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_005049343.1|319426_320110_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_000140020.1|320106_320472_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	7.1e-39
WP_001265248.1|320472_321531_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.6e-89
WP_011069426.1|321532_321811_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.0	4.5e-09
WP_000935258.1|321978_322191_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_005069274.1|322784_323201_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
WP_000533619.1|323367_324393_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001325918.1|324628_325426_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_094081534.1|327132_328301_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	8.9e-184
WP_094081533.1|328386_329542_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_001060217.1|329894_331349_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532920.1|331691_332408_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001010988.1|334784_335735_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011445.1|335836_336754_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986341.1|337212_338148_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001165576.1|338209_339289_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005049317.1|339300_340044_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000261572.1|340040_340550_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_094081532.1|340561_341718_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_001016348.1|343747_343930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|344030_344360_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_005088730.1|344531_344831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004967157.1|344900_345575_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_045177795.1|347227_348829_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	3.2e-147
WP_149617751.1|350143_351300_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.5e-66
WP_094081542.1|351664_352893_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_005049241.1|353884_354235_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
WP_004967157.1|354231_354906_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_001007949.1|354984_355824_-|integrase	integrase family protein	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.6	1.3e-160
358684:358697	attR	AAACCACCAGTCAG	NA	NA	NA	NA
>prophage 4
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	382847	389154	4593360		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100804.1|382847_383393_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
WP_000857518.1|383397_384276_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
WP_001023623.1|384334_385234_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	4.4e-29
WP_000699404.1|385233_386319_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_000183041.1|386691_387585_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_001116126.1|387759_389154_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.8e-18
>prophage 5
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	866988	874457	4593360	transposase	Escherichia_phage(66.67%)	7	NA	NA
WP_094081509.1|866988_868144_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_000017552.1|869504_869657_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|869674_869866_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_171768964.1|870176_870695_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755178.1|870710_871250_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138258.1|871344_872922_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|872990_874457_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 6
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	939382	1008089	4593360	tail,transposase,integrase,tRNA	Enterobacteria_phage(22.22%)	60	951977:951993	1016551:1016567
WP_061440257.1|939382_940672_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	42.6	6.4e-74
WP_000902877.1|940695_941241_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.1	2.5e-72
WP_011069472.1|941243_941762_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	53.0	3.5e-39
WP_148936977.1|941825_943053_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001181756.1|943951_944557_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.8	1.2e-30
WP_094085562.1|945320_946476_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_000054752.1|947831_948092_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000128776.1|948285_948366_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986029.1|948785_949166_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004969731.1|949165_949897_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399400.1|949908_950637_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020747.1|950648_951554_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|951550_952231_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
951977:951993	attL	CGCCAGTTCCGCCAGCG	NA	NA	NA	NA
WP_000002542.1|952502_953477_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|953492_955292_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589070.1|955489_955969_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|955965_956922_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168466.1|956921_957572_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|957604_958180_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|958176_958332_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001298974.1|960194_960932_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|961063_962398_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_005051239.1|962432_963314_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000187873.1|963416_964004_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627802.1|964059_964443_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262715.1|964747_965437_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	5.5e-56
WP_000997396.1|965484_966522_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|966728_967148_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001343689.1|967216_967915_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082966.1|967946_970607_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_005051257.1|970720_972076_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005085125.1|972121_972445_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|972441_973740_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_000483772.1|979573_980920_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000197677.1|980970_981708_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079112.1|981842_982823_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040142.1|982819_983551_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_005051270.1|983680_986254_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
WP_000178456.1|987949_988291_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010723158.1|988394_988442_+	phe operon leader peptide	NA	NA	NA	NA	NA
WP_000200120.1|988540_989701_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225239.1|989743_990865_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000548559.1|990875_991946_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	2.6e-89
WP_005051282.1|992155_992521_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212392.1|992670_993189_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000589824.1|994419_994902_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|994978_995326_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|995367_996135_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|996165_996714_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|996732_996981_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460045.1|997117_998479_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005051300.1|998645_999437_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_001296310.1|1000802_1001396_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|1001518_1002397_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880917.1|1002482_1004144_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1004292_1004634_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000900741.1|1004695_1004986_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|1004975_1005452_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1005583_1006066_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000113817.1|1006847_1008089_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.3	9.4e-99
1016551:1016567	attR	CGCTGGCGGAACTGGCG	NA	NA	NA	NA
>prophage 7
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	1081722	1089525	4593360	transposase	Pseudomonas_phage(50.0%)	6	NA	NA
WP_005051483.1|1081722_1082490_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.8e-69
WP_094085512.1|1083875_1084986_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.9	8.0e-65
WP_094081518.1|1085048_1086204_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_001192434.1|1086447_1088544_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	48.7	1.2e-173
WP_001249841.1|1088545_1088797_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	53.0	1.1e-17
WP_001224024.1|1088961_1089525_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	55.8	1.1e-35
>prophage 8
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	1272344	1331241	4593360	protease,transposase,integrase,tRNA	Enterobacteria_phage(33.33%)	41	1279010:1279025	1324141:1324156
WP_005051759.1|1272344_1273103_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|1273308_1274229_-	agmatinase	NA	NA	NA	NA	NA
WP_005096955.1|1275608_1277585_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_005051767.1|1277593_1277725_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_011110620.1|1277860_1278076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|1278379_1279534_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
1279010:1279025	attL	ATTCTGCCCGCTGAAT	NA	NA	NA	NA
WP_001112298.1|1279970_1281365_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_005051770.1|1281441_1281939_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286517.1|1282033_1282741_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|1282820_1283552_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593267.1|1283564_1284515_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|1284623_1285187_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|1285186_1285603_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055626.1|1285778_1286759_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997800.1|1286776_1287481_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094817.1|1287498_1288065_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|1288061_1288352_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|1288359_1288953_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239924.1|1288945_1290082_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000577041.1|1291403_1291907_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_151106443.1|1292670_1293972_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745204.1|1294072_1295035_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394115.1|1295151_1296198_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984792.1|1296373_1297093_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107556.1|1297276_1297603_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|1297602_1298322_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004972828.1|1298482_1299535_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|1299562_1299838_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_005064048.1|1299902_1300982_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|1301183_1302440_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_005085661.1|1302488_1304624_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234511.1|1305021_1305729_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218804.1|1306106_1307369_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_000344102.1|1307821_1311337_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001034110.1|1313807_1317665_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_000291751.1|1317711_1318293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001045650.1|1321107_1325226_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
1324141:1324156	attR	ATTCTGCCCGCTGAAT	NA	NA	NA	NA
WP_001189111.1|1325953_1327462_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001013320.1|1329156_1329582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271035.1|1329578_1329962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747032.1|1330073_1331241_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
>prophage 9
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	3040139	3162783	4593360	protease,coat,terminase,portal,plate,transposase,tRNA	Escherichia_phage(20.0%)	102	NA	NA
WP_000742443.1|3040139_3041564_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	6.5e-27
WP_000272188.1|3042963_3043350_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186650.1|3043663_3044488_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094600.1|3044518_3047191_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|3047252_3048047_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246888.1|3048414_3049140_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|3049397_3050249_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|3050395_3051121_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|3051412_3051970_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811938.1|3052061_3053258_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|3053446_3054205_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|3054217_3055075_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005053372.1|3055086_3056439_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3056468_3058901_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3059022_3059508_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|3059511_3060537_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3060641_3061097_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3061100_3061889_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000132065.1|3061888_3063037_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569431.1|3063033_3063630_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.8e-26
WP_001294740.1|3063666_3067149_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|3067161_3068121_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020991.1|3068219_3070361_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3070417_3070807_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176576.1|3070871_3072170_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3072218_3072479_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3072465_3072666_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|3072831_3073377_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635538.1|3073373_3073796_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239155.1|3073809_3074520_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_005053355.1|3074674_3075499_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|3075551_3077270_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094030.1|3077380_3078088_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202325.1|3078084_3078489_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|3078606_3079422_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294596.1|3079461_3080115_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593997.1|3080107_3081139_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|3081326_3081902_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997046.1|3087660_3088464_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	9.2e-39
WP_171768967.1|3088502_3089849_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000648578.1|3089898_3090813_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3091053_3091854_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211683.1|3091931_3092702_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644679.1|3092749_3094096_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	3.7e-08
WP_001052754.1|3094167_3094923_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005060310.1|3094956_3095679_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3095675_3096143_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|3096207_3096939_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000402248.1|3097278_3098325_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000371478.1|3098894_3100778_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001276640.1|3100793_3101288_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_094081497.1|3103068_3104341_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000343116.1|3104398_3104686_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
WP_094081496.1|3104763_3105931_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_014532150.1|3105925_3106981_+|terminase	terminase	terminase	I1TEI5	Salmonella_phage	99.7	1.2e-211
WP_151106401.1|3106981_3109147_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.0	0.0e+00
WP_000373012.1|3109160_3110072_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.0	2.0e-159
WP_001196950.1|3110071_3111367_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.4	1.5e-240
WP_005053303.1|3111411_3111642_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	69.3	1.2e-23
WP_001054834.1|3111619_3112120_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_001122382.1|3112119_3113538_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.7	1.2e-272
WP_000785540.1|3113537_3114386_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	98.6	2.1e-102
WP_000627639.1|3114385_3114841_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	8.8e-87
WP_000964877.1|3114843_3115536_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
WP_000246949.1|3115545_3116877_+	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	99.8	3.1e-217
WP_005053293.1|3116877_3118608_+	lytic transglycosylase domain-containing protein	NA	A0A088CQ71	Enterobacteria_phage	97.9	6.8e-281
WP_005053289.1|3119993_3120314_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_005053287.1|3120432_3121848_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_000792969.1|3121948_3122209_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_023517632.1|3122390_3122594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413677.1|3122671_3123766_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_001599861.1|3123789_3124002_-	DUF2754 domain-containing protein	NA	NA	NA	NA	NA
WP_000763148.1|3124261_3124570_+	DUF2755 family protein	NA	NA	NA	NA	NA
WP_000092054.1|3124628_3125723_-	surface-exposed outer membrane lipoprotein YaiW	NA	NA	NA	NA	NA
WP_001342332.1|3125735_3126956_-	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_000830735.1|3127307_3128465_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
WP_000953938.1|3128465_3128969_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094081495.1|3130689_3131846_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_094081542.1|3132622_3133851_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_001295337.1|3135611_3136586_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_151106403.1|3136691_3137543_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114607.1|3137539_3138367_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939367.1|3138363_3139131_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
WP_077696319.1|3140335_3140530_-	regulator	NA	NA	NA	NA	NA
WP_000003122.1|3141438_3142107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370403.1|3142349_3143045_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023933.1|3143037_3144465_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102097.1|3144475_3145195_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000667623.1|3146977_3147364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000011500.1|3147388_3149602_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_005053237.1|3150091_3150499_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000568701.1|3150495_3152784_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_005053234.1|3152780_3153770_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.7	6.5e-26
WP_128567422.1|3153869_3154073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343515.1|3154090_3154411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139559.1|3154818_3155589_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532697.1|3155742_3156216_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973114.1|3156258_3158703_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|3158942_3159521_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|3159726_3160494_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225676.1|3160464_3161205_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000006251.1|3162285_3162783_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	3525514	3627494	4593360	terminase,tail,holin,capsid,transposase,head,tRNA	Enterobacteria_phage(32.08%)	98	NA	NA
WP_001157892.1|3525514_3528097_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	1.4e-184
WP_001269672.1|3528111_3528693_+	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_000620544.1|3528692_3529724_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000838889.1|3529725_3530367_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_001241888.1|3530390_3531002_+	adenosylcobalamin/alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_001161664.1|3531261_3531579_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_000776104.1|3531582_3532050_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_000776197.1|3532080_3533982_+	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
WP_000131719.1|3533984_3535097_+	peptidoglycan glycosyltransferase MrdB	NA	NA	NA	NA	NA
WP_001231405.1|3535107_3536196_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092085.1|3536334_3537546_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.2	7.5e-101
WP_000850550.1|3537656_3537920_+	YbeD family protein	NA	NA	NA	NA	NA
WP_000284045.1|3538020_3538662_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_000378035.1|3538920_3539874_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000042632.1|3540082_3541048_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_000503931.1|3541148_3541352_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_005049482.1|3541480_3542269_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_000939741.1|3542361_3542745_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|3542798_3543008_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_005049488.1|3543182_3543743_-	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_000955063.1|3544331_3545717_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000833599.1|3546436_3546946_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_077696331.1|3547108_3547354_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	63.2	6.1e-18
WP_094081558.1|3549024_3550180_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_011069283.1|3550192_3550468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627468.1|3550464_3551406_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	85.6	2.3e-153
WP_005060669.1|3551550_3551907_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	87.4	4.7e-51
WP_000873153.1|3551910_3553131_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	85.6	2.5e-192
WP_000184977.1|3553134_3553878_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
WP_000113500.1|3553768_3555235_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.0	9.6e-260
WP_005020049.1|3555234_3555468_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	65.8	6.2e-20
WP_005098291.1|3555455_3555995_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	61.4	6.6e-49
WP_134796765.1|3555979_3557208_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.5e-176
WP_000204761.1|3557283_3557967_-|terminase	PBSX family phage terminase large subunit	terminase	K4NXU1	Acinetobacter_phage	73.4	7.0e-96
WP_001108106.1|3557917_3558682_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	55.4	7.0e-12
WP_011069285.1|3558876_3559389_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_128567431.1|3559521_3559713_-	hypothetical protein	NA	Q76H62	Enterobacteria_phage	98.4	1.3e-28
WP_000747032.1|3559795_3560963_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000988183.1|3560992_3561871_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	95.6	3.0e-139
WP_000211324.1|3561867_3563259_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.7	3.6e-256
WP_001064799.1|3563255_3563513_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	93.8	1.1e-33
WP_000111769.1|3563607_3563808_+	protein ninH	NA	A0A088CC23	Shigella_phage	74.2	1.1e-20
WP_001204832.1|3563800_3564181_+	antitermination protein	NA	A0A088CD47	Shigella_phage	87.9	8.2e-62
WP_000839566.1|3564983_3565199_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
WP_005083349.1|3565202_3565832_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	57.6	4.7e-30
WP_001274722.1|3565897_3566431_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.6e-100
WP_128567432.1|3566647_3566842_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	100.0	2.5e-27
WP_094081529.1|3566893_3568049_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_000259004.1|3570282_3570486_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	57.4	8.6e-10
WP_001254019.1|3572065_3573571_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	4.3e-98
WP_000256794.1|3573607_3573955_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	8.3e-21
WP_000522647.1|3574012_3575041_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.8	1.8e-116
WP_000201488.1|3575092_3575479_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000677140.1|3575853_3576438_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	87.6	6.0e-88
WP_001079407.1|3576434_3576836_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	94.0	1.1e-69
WP_000211126.1|3576846_3577587_+	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.7	1.5e-128
WP_000478927.1|3577645_3578032_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_001161004.1|3578040_3578370_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_000371983.1|3578341_3581383_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
WP_000447264.1|3581382_3581712_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_001152490.1|3581711_3582410_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000194740.1|3582414_3583158_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_000090877.1|3583094_3583697_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_000515521.1|3583757_3587237_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_001230481.1|3587304_3587904_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	1.8e-103
WP_000551132.1|3589329_3589953_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
WP_000801162.1|3590132_3591896_-	invasion plasmid antigen	NA	NA	NA	NA	NA
WP_000767391.1|3592478_3592955_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_005048541.1|3593013_3594303_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000951226.1|3594389_3595430_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000118810.1|3595426_3596581_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246759.1|3596567_3597323_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000044878.1|3597315_3597993_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042516.1|3598571_3600593_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_005048534.1|3600784_3601693_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_005048531.1|3602089_3603079_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_000084630.1|3603100_3603613_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000080885.1|3603615_3604101_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000598624.1|3604093_3604339_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000852286.1|3604340_3604793_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000373626.1|3604929_3605634_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000446914.1|3605838_3606552_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000045466.1|3606587_3607544_-	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000650362.1|3607543_3608785_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_001113348.1|3608781_3609543_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000871982.1|3609675_3610086_+	YbhQ family protein	NA	NA	NA	NA	NA
WP_000469031.1|3610047_3611154_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070107.1|3611164_3612298_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000996107.1|3612290_3614027_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|3614019_3615015_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|3615017_3615689_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001145124.1|3617311_3617794_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	1.3e-35
WP_005048497.1|3617913_3620064_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.6	3.1e-41
WP_000386531.1|3620091_3621054_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443521.1|3621194_3622280_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000135439.1|3623032_3623299_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	4.0e-07
WP_000990151.1|3623372_3624050_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	3.4e-18
WP_014532194.1|3626147_3627494_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	3705094	3819388	4593360	transposase,protease,integrase,tRNA	Shigella_phage(12.2%)	80	3705084:3705143	3818149:3819479
3705084:3705143	attL	TGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGC	NA	NA	NA	NA
WP_088895425.1|3705094_3706323_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001298299.1|3706763_3707459_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|3708625_3710284_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_005067329.1|3710280_3711237_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000746446.1|3711387_3712503_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000410785.1|3714517_3714742_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|3715064_3715385_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934033.1|3715415_3717692_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	4.3e-166
WP_001040187.1|3718374_3718593_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|3718877_3719582_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202220.1|3719623_3721345_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043574.1|3721345_3723112_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	4.6e-22
WP_000537402.1|3723234_3724200_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	3.2e-62
WP_000077083.1|3725371_3729400_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|3729554_3730166_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067746.1|3730176_3731520_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	4.3e-81
WP_000886683.1|3731610_3732903_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000213098.1|3735596_3736214_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534651.1|3736215_3737007_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165870.1|3737042_3737669_-	hydrolase	NA	NA	NA	NA	NA
WP_000109301.1|3737983_3739132_+	MFS transporter	NA	NA	NA	NA	NA
WP_005051091.1|3739444_3740119_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	3.4e-10
WP_005048975.1|3740115_3740466_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_005083422.1|3740462_3742064_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	5.0e-145
WP_000747032.1|3742603_3743772_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000882657.1|3744054_3744267_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
WP_029716636.1|3744437_3745103_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_005048249.1|3745271_3745628_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_001118167.1|3745685_3746108_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
WP_000702036.1|3747730_3748153_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	3.8e-68
WP_000912291.1|3748136_3748364_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787424.1|3748440_3748848_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_001091985.1|3749050_3749206_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.2e-07
WP_001005968.1|3749207_3749411_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	1.0e-10
WP_094081528.1|3749652_3750926_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
WP_000935590.1|3751428_3752277_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	57.0	9.7e-55
WP_094081554.1|3752790_3753919_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	3.5e-60
WP_094081550.1|3754932_3756089_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_005061679.1|3756154_3756772_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.7e-81
WP_001039888.1|3756771_3756951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005061694.1|3759266_3759398_+	hypothetical protein	NA	A0A0C4UR34	Shigella_phage	86.7	2.6e-07
WP_000815445.1|3759657_3760653_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_000723652.1|3761830_3762883_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_001036463.1|3762958_3764392_+	anion permease	NA	NA	NA	NA	NA
WP_000593940.1|3764574_3766755_+	hydratase	NA	NA	NA	NA	NA
WP_001091542.1|3766895_3768179_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_024219169.1|3768313_3769195_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_151106411.1|3769295_3770452_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	1.5e-66
WP_000111043.1|3770860_3771601_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292813.1|3771792_3774075_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	4.9e-162
WP_000642544.1|3774129_3774987_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_005051051.1|3775392_3777153_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000057149.1|3778107_3779196_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445222.1|3779266_3780550_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000483772.1|3780675_3782022_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001295345.1|3782157_3782922_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125013.1|3783094_3783778_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|3783888_3785562_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|3785721_3786006_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000551266.1|3788508_3790257_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570543.1|3790253_3791240_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056529.1|3791276_3792509_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|3792560_3792743_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011599.1|3792739_3793486_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|3793639_3794533_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899599.1|3794509_3795289_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_005047510.1|3795424_3796210_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|3796206_3797529_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_151106413.1|3797509_3798214_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572706.1|3798213_3802674_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_151106414.1|3804371_3806219_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|3806399_3806948_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|3806974_3807622_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462669.1|3807844_3809035_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977934.1|3809219_3810308_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|3810908_3812309_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|3812477_3813680_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193826.1|3813945_3816561_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090476.1|3816767_3817535_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	4.1e-28
WP_088895425.1|3818159_3819388_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
3818149:3819479	attR	TGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGCCGCAGATATTCCCGTGGCGAGCGATAACCCAGCGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCAAGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTGGGCATGATACTGATGTAGTCACGCTTTATCGTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCGGACTCCGCACCGCCGTGTTCTTCGGTTCAAGTCCCAACATCCGGGCGAACTGGCGTGTTTCATTAGCCCGGTAGCATGAACCATTATCCGTCAGCCACTCCACTGGAGACGACGGAAGATCGTTGCCGAAGCGGCGTTCCACCGCTCCCAGCATGACGTCCTGTACTGTTTCACTGTTGAAGCCGCCGGTAGTCACCGCCCAGTGCAGTGCCTCACGATCACAGCAGTCCAGCGCGAACGTGACACGCAGTCTCTCTCCGTTATCACAGCAGAACTCGAACCCGTCAGAGCACCATCGCTGATTGCTTTCTTTCACGGCTACTCTGCCTGTATGTGCCCGTTTCGATGGCGGTACAGCAGGTTTTCGCTCAAGCAACAGCGCATTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCGCAGGCATACCATCAAGTTCTGCCTGTCTGCGAAGCAGCGCCCATACCCGACGATAACCATACGTGGGCAGCTCTCCGATAACATGGTGTATACGGAGAAGCACATCCGTATCATCAGTGTGACGACTGCGGCGGCCATCCATCCAGTCATCGGTTCGTCTGAGAATGACGTGCAACTGCGCACGCGACACCCGGAGACAACGGCTGACTAAGCTTACTCCCCATCCCCGGGCAATAAGGGCGCGTGCGCTATCCACTTTTTTGCCCGTCCATATTCAACGGCTTCTTTGAGGAGTTCATTTTCCATCGTTTTCTTGCCGAGCAGGCGCTGGAGTTCTTTAATCTGCTTCATGGCGGCAGCAAGTTCAGAGGCAGGAACAACCTGTTCTCCGGCGGCCACAGCAGTAAGACTTCCTTCCTGGTATTGCTTACGCCAGAGAAATAACTGGCTGGCTGCTACACCATGTTGCCGGGCAACGAGGGAGACCGTCATCCCCGGTTCAAAGCTCTGCTGAACAATTGCGATCTTTTCCTGTGTGGTACGCCGTCTGCGTTTCTCCGGCCCTAAGACATCAATCATCTGTTCTCCAATGACTAGTCTAAAAACTAGTATTAAGACTATCACTTAAATAAGTGATACTGGTTGTCTGGAGATTCAGGGGGCCAGTCTA	NA	NA	NA	NA
>prophage 12
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	3856774	3918509	4593360	protease,transposase	Enterobacteria_phage(27.27%)	52	NA	NA
WP_000375134.1|3856774_3857434_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001058323.1|3858153_3859272_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|3859268_3861062_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186413.1|3861080_3861788_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003095.1|3861784_3862372_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063973.1|3862368_3862767_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004909.1|3862763_3863621_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|3863754_3865299_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460794.1|3865310_3866447_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|3866458_3866551_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_005047441.1|3866630_3867929_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000057872.1|3870229_3870676_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|3870663_3871803_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742319.1|3871848_3873945_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_151106418.1|3873944_3874685_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247604.1|3874681_3875326_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_005083611.1|3875432_3875738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087763.1|3876179_3876392_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_024259211.1|3877453_3877666_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	70.0	1.7e-21
WP_071524879.1|3877676_3877865_+	cold-shock protein	NA	NA	NA	NA	NA
WP_011069319.1|3877839_3878070_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019194.1|3878059_3878233_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818447.1|3878281_3879355_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001264948.1|3882250_3883279_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120136.1|3883251_3883944_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	1.0e-17
WP_005047427.1|3884030_3885203_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_000024560.1|3889208_3889514_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420619.1|3889513_3890434_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000535353.1|3890694_3891951_+	YccE family protein	NA	NA	NA	NA	NA
WP_001044290.1|3892243_3893485_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|3893522_3893750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151437.1|3893770_3894367_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001273654.1|3894739_3894847_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_005047413.1|3894928_3896257_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	3.4e-232
WP_001028096.1|3896277_3896772_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001001165.1|3896782_3897373_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_000777662.1|3897382_3898183_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126782.1|3898190_3898577_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_005047409.1|3898588_3899281_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_005047407.1|3899280_3900372_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191701.1|3900659_3901298_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_000937577.1|3901591_3902779_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124119.1|3902778_3903144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000154398.1|3903964_3905092_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199452.1|3905097_3906363_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_005047400.1|3906969_3907758_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	8.6e-90
WP_151106420.1|3907867_3909024_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_005086346.1|3910280_3911231_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001411475.1|3911295_3912240_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_151106422.1|3912420_3913576_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.4e-67
WP_000625669.1|3915789_3917067_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085949416.1|3917346_3918509_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
>prophage 13
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	4030877	4044341	4593360	protease,tail,portal,integrase,terminase,head	uncultured_Caudovirales_phage(90.91%)	20	4021156:4021170	4040209:4040223
4021156:4021170	attL	ACTGAATAACCGCAT	NA	NA	NA	NA
WP_000085257.1|4030877_4032107_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953271.1|4032481_4032670_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_154074686.1|4032719_4033049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103622.1|4033173_4033353_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
WP_000226783.1|4033482_4033683_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001204964.1|4034107_4034341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770157.1|4034346_4034646_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761802.1|4034642_4036391_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.5	7.3e-89
WP_000557473.1|4036679_4036958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294167.1|4036954_4037260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126624.1|4037269_4037431_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132078.1|4037572_4037797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000504054.1|4039294_4039867_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_171768968.1|4039868_4041080_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.2	9.0e-187
4040209:4040223	attR	ATGCGGTTATTCAGT	NA	NA	NA	NA
WP_001020662.1|4041076_4041415_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134107.1|4041411_4041708_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.2	2.2e-30
WP_001145905.1|4041707_4042148_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|4042131_4042314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029716858.1|4042369_4042696_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	79.6	9.2e-46
WP_000127901.1|4042679_4044341_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	4.4e-277
>prophage 14
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	4239979	4267605	4593360	transposase,integrase	Escherichia_phage(65.0%)	27	4241178:4241192	4280087:4280101
WP_005084161.1|4239979_4241176_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
4241178:4241192	attL	ATGCTTGACAACTTA	NA	NA	NA	NA
WP_000981715.1|4241551_4242472_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000817713.1|4242609_4243092_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094189083.1|4243088_4244245_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.5e-66
WP_094105053.1|4244772_4246046_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
WP_000788996.1|4246839_4247586_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	89.2	2.1e-122
WP_001118168.1|4247600_4248023_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	75.9	1.1e-51
WP_005048249.1|4248080_4248437_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_151106435.1|4248529_4248748_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	62.5	1.7e-16
WP_001229297.1|4248749_4249115_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	98.3	2.1e-67
WP_000208062.1|4249111_4249777_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	6.1e-36
WP_000610655.1|4249776_4250142_+	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.7	6.1e-30
WP_000018421.1|4250539_4250752_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000940329.1|4252088_4252688_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.4e-108
WP_000228038.1|4252687_4252978_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000640143.1|4252974_4253529_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	3.7e-71
WP_005049799.1|4253669_4253855_+	hypothetical protein	NA	A0A291AWU3	Escherichia_phage	63.4	1.5e-05
WP_151106437.1|4253916_4255056_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.3e-66
WP_045178261.1|4255102_4255609_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	73.2	1.9e-42
WP_000615491.1|4256242_4257847_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011069357.1|4260116_4260485_+	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	55.4	2.6e-20
WP_000930141.1|4262294_4262918_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	78.6	5.8e-81
WP_000968134.1|4263118_4263976_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|4263972_4264830_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983722.1|4264826_4265654_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_000555620.1|4265653_4266568_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000443254.1|4266999_4267605_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	7.3e-113
4280087:4280101	attR	TAAGTTGTCAAGCAT	NA	NA	NA	NA
>prophage 15
NZ_CP044155	Shigella flexneri strain AR-0424 chromosome, complete genome	4593360	4437250	4495836	4593360	transposase,holin,integrase	Shigella_phage(25.0%)	59	4493425:4493441	4501223:4501239
WP_000372594.1|4437250_4437430_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	91.5	4.1e-24
WP_001323614.1|4437579_4437741_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_000874243.1|4437737_4437926_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000871291.1|4438185_4438521_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000762882.1|4439830_4440652_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000904111.1|4440666_4441023_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_001265249.1|4441035_4442085_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.2e-108
WP_000980987.1|4442431_4442683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|4442900_4443056_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|4443127_4443415_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|4443414_4443654_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_071818640.1|4443678_4443984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000527804.1|4446306_4447767_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_000214712.1|4447802_4448006_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|4448182_4448869_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_005050098.1|4448957_4449704_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_005068122.1|4449840_4451886_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024558.1|4451930_4452449_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000901367.1|4454418_4454514_-	protein MgtS	NA	NA	NA	NA	NA
WP_000212732.1|4454640_4455759_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087224.1|4456022_4456922_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803661.1|4456952_4457171_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|4457202_4457586_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|4457605_4458040_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|4458251_4458917_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210809.1|4458941_4460132_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000258546.1|4460281_4461397_-	putative protein YneK	NA	NA	NA	NA	NA
WP_005050114.1|4461476_4462412_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000257419.1|4462475_4463402_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191025.1|4463401_4463746_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000558037.1|4463899_4465318_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	1.1e-18
WP_000854633.1|4465544_4466996_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000947175.1|4467292_4468492_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957853.1|4468501_4468690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005050130.1|4468890_4469805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286595.1|4469808_4470567_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558531.1|4470605_4470896_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001191842.1|4470919_4471690_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000113157.1|4473132_4474035_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000154339.1|4474113_4475067_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194865.1|4475315_4476851_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000911160.1|4476844_4477873_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|4477872_4478865_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_094081542.1|4480114_4481342_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_085949497.1|4481392_4482540_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_005050183.1|4482616_4483831_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	2.4e-46
WP_001295395.1|4484036_4484363_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_151106441.1|4484497_4484854_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001321287.1|4485435_4486146_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_005050191.1|4486253_4486559_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_005084471.1|4486757_4487078_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
WP_000207512.1|4488901_4489891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971490.1|4489975_4490467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024194789.1|4490577_4490775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199921.1|4490787_4491288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091024.1|4491277_4491793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113584.1|4492223_4492592_-	hypothetical protein	NA	NA	NA	NA	NA
4493425:4493441	attL	GTTACAATGTCACGTTT	NA	NA	NA	NA
WP_000747032.1|4493560_4494729_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_005050206.1|4494798_4495836_-|integrase	integrase	integrase	NA	NA	NA	NA
4501223:4501239	attR	GTTACAATGTCACGTTT	NA	NA	NA	NA
>prophage 1
NZ_CP044157	Shigella flexneri strain AR-0424 plasmid pAR-0424-2, complete sequence	226601	3733	93551	226601	transposase,protease,tRNA	Escherichia_phage(26.67%)	53	NA	NA
WP_004998488.1|3733_4765_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_047201489.1|7108_7297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701108.1|15342_16797_+	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_000019158.1|18433_18706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010921625.1|18977_19280_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000405245.1|19270_19753_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151106460.1|21647_23339_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_005085088.1|23674_24871_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000957712.1|26018_26285_-	type 3 secretion system effector OspE2	NA	NA	NA	NA	NA
WP_005116773.1|27296_28085_+	AraC family invasion system transcriptional regulator VirF	NA	NA	NA	NA	NA
WP_072075159.1|28026_28449_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	98.1	7.7e-53
WP_000947175.1|29374_30574_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957853.1|30583_30772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072075197.1|33190_34369_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.4	2.6e-29
WP_000431558.1|35398_36379_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	58.2	5.0e-95
WP_000200287.1|36378_37578_-	AAA family ATPase	NA	Q71TL9	Escherichia_phage	75.1	2.0e-175
WP_011114728.1|38304_39087_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	8.5e-138
WP_005064872.1|39519_40713_+|transposase	IS4-like element ISSfl1 family transposase	transposase	S5FM71	Shigella_phage	62.5	2.0e-138
WP_000901798.1|43283_43850_-	type III secretion effector IpgB2	NA	NA	NA	NA	NA
WP_011114726.1|44131_44446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026470.1|44957_45635_-	type 3 secretion system effector OspD1	NA	NA	NA	NA	NA
WP_000622998.1|48524_48872_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	74.8	9.8e-46
WP_011587243.1|49315_50662_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000338649.1|51119_51305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868563.1|52626_53205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121867.1|54236_54956_+	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_005061014.1|55387_57097_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_000261567.1|58436_58787_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.0	2.8e-08
WP_000850662.1|61420_62161_-	PAP2 family phosphatase PhoN2	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.4	7.5e-11
WP_001046939.1|62489_63356_-	type 3 secretion system effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	32.7	9.4e-29
WP_005061047.1|64902_65850_-|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
WP_011378983.1|66811_66949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148936977.1|68358_69587_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001189111.1|70060_71569_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_011114782.1|73946_74099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957716.1|74746_75013_+	type 3 secretion system effector OspE1	NA	NA	NA	NA	NA
WP_000597731.1|75402_77130_+	T3SS effector E3 ubiquitin-protein ligase IpaH1.4	NA	NA	NA	NA	NA
WP_000957853.1|77460_77649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094081575.1|77658_78853_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000829592.1|79083_79275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130973.1|79975_80833_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|80825_80900_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083819.1|81123_81384_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766818.1|81623_82214_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001299729.1|82252_82462_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_094081574.1|82796_83952_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_004971339.1|84479_84692_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139368.1|84822_85383_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205722.1|85437_86184_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	32.0	5.4e-09
WP_171721158.1|91051_91456_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_000450531.1|91537_91765_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911311.1|91764_92163_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_094081572.1|92395_93551_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
>prophage 2
NZ_CP044157	Shigella flexneri strain AR-0424 plasmid pAR-0424-2, complete sequence	226601	103858	143630	226601	transposase,protease	Stx2-converting_phage(55.56%)	26	NA	NA
WP_064753708.1|103858_105178_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000705601.1|105863_106454_-	type III secretion system effector protein kinase OspG	NA	NA	NA	NA	NA
WP_000936806.1|107182_108820_-	T3SS effector E3 ubiquitin-protein ligase IpaH9.8	NA	NA	NA	NA	NA
WP_023592908.1|109081_109189_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001159860.1|109212_109518_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813626.1|109519_109738_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000421262.1|112205_112481_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011114774.1|112480_112765_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011069533.1|114200_115802_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	7.8e-146
WP_000631708.1|115821_116169_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	9.2e-44
WP_004967157.1|116165_116840_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000607008.1|118433_119072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001088287.1|119899_120574_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_005048975.1|120570_120921_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_094081569.1|121526_122682_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_001104887.1|126112_126334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086135.1|126334_127018_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	2.3e-30
WP_011114770.1|127081_127393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015683198.1|127389_128292_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921952.1|128731_129691_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	40.9	1.4e-62
WP_000445929.1|129690_130086_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_005015412.1|130268_130649_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_094081568.1|130694_131538_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	2.2e-22
WP_000828661.1|131708_132458_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000612525.1|134754_136407_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001195004.1|142427_143630_+|protease	alpha-tubulin-specific protease	protease	NA	NA	NA	NA
