The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	30662	86259	5492765	protease,transposase,tail,tRNA	Escherichia_phage(23.08%)	55	NA	NA
WP_001299679.1|30662_31919_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|32132_32756_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|32755_33607_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|33757_34705_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|34829_36509_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|36563_36842_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|37119_37704_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|37820_38912_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|41733_42804_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|42814_43447_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|43457_44876_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001366914.1|45188_45317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|45422_46880_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|46907_47108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|47215_48238_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|48237_49218_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|49214_49973_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000903990.1|49982_50627_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010917800.1|50571_50853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576838.1|50791_51646_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|51671_53642_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|53691_53946_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|54146_54743_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|54794_56007_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|56195_56807_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|56906_57821_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|57916_59653_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|60044_61115_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|61124_62423_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|62785_64318_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|64369_65089_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|65310_66852_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|66997_67528_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|67573_68842_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|68841_69261_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|69633_70545_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|70751_71213_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|71289_71949_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|72020_72314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|72554_72956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|73058_73427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|73946_74642_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|74665_75478_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|75481_75748_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000279979.1|76913_77534_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	4.0e-114
WP_151121002.1|77443_77635_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.9e-07
WP_085949317.1|77600_78814_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	9.3e-168
WP_000361110.1|79613_80198_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071781823.1|80375_80561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001201843.1|80695_81649_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|81835_83320_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|83622_85161_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|85210_85558_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|85554_85935_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|86010_86259_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
>prophage 2
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	89814	204175	5492765	portal,head,tRNA,terminase,lysis,tail,holin,capsid,integrase,protease	Enterobacteria_phage(32.73%)	147	189742:189762	210832:210852
WP_000885629.1|89814_90396_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|90395_93311_-	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|93375_93975_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|94041_97440_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|97500_98133_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_001152612.1|98817_99516_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|99515_99845_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|99841_102391_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|102383_102818_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|102799_103222_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|103237_103978_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|103985_104381_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|104377_104956_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|104967_105321_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|105332_105731_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|105772_106798_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|106853_107186_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|107195_108515_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|108495_110097_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|110093_110300_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|110296_112222_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|112196_112742_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|113130_113325_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|113489_113696_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|113981_114392_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|114683_114977_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|115067_115250_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|115466_115943_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|115929_116235_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|116556_117246_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|117242_117383_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|117379_117742_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|117738_118029_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|118021_118192_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|118191_118647_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_071525067.1|118837_119029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|119148_120675_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|120732_120855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|120919_121252_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|121319_121622_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|121618_122320_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|122316_123141_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|123244_123481_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|123470_124613_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|124726_125977_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|126148_126802_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|126811_127273_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|127326_128433_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|128468_129110_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|129113_130484_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|130652_131324_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|131323_132784_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001302829.1|133087_133336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133425.1|133640_133922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127893.1|133935_135597_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000113645.1|135580_135937_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|136060_136243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|136226_136667_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|136666_136963_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|136959_137298_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000171117.1|137294_138470_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	2.4e-184
WP_000504050.1|138506_139079_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|139118_140276_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|140567_140792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|140916_141189_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|141199_141610_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|141606_141858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|142228_144361_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|144357_144657_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|144662_144905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|144894_145086_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|145085_145271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|145263_145461_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|145486_146230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|146287_146476_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|146840_148070_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|148318_149440_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|149488_150715_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|150964_152101_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|152084_152948_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001303923.1|152978_153191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|153311_154673_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|154733_155009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|155088_155214_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301984.1|157317_160719_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_115801847.1|163676_163766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|163778_164015_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|163960_164698_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|164751_165630_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|165932_166043_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|166152_166407_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179478.1|166423_167122_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807950.1|167121_167463_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212899.1|167455_170698_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|170750_170960_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|171055_171430_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|171435_172152_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|172210_172555_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|172551_172998_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|172994_173345_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|173354_173681_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|173683_176263_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001063094.1|176208_176430_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|176474_178412_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001507810.1|178475_180137_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
WP_000958416.1|180133_180697_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|180986_181352_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|181393_181579_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|181708_181849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|182205_182430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|182494_182701_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|182928_183075_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|183074_183644_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|183914_184448_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|184498_184843_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|184847_185063_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|185138_185408_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|185445_185628_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|185775_187713_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|188027_188195_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|188791_189613_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|189609_189984_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
189742:189762	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|189996_191046_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|191047_191326_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|191493_191706_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|191894_191999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|192114_192702_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|192704_192896_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|192897_193335_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|193321_193639_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|193592_193910_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|193899_194202_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|194198_194516_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|194512_195229_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|195262_195685_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|195716_196754_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|196822_197248_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|197231_197555_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|197679_198156_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|198471_198624_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|198738_199254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|199386_199776_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|199837_200107_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|200075_201194_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|201360_202155_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|202151_203198_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|203353_204175_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
210832:210852	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 3
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	432965	439626	5492765		Stx_converting_phage(36.36%)	11	NA	NA
WP_001028088.1|432965_433460_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|433480_434809_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|434891_434999_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_024177246.1|435364_435571_-	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	100.0	1.3e-26
WP_000203859.1|435988_436618_+	phage antirepressor Ant	NA	A0A1I9LJV2	Stx_converting_phage	100.0	1.5e-113
WP_000763353.1|436665_436887_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|436883_437168_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000426668.1|438052_438448_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|438681_438894_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|439013_439358_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000971668.1|439437_439626_-	hypothetical protein	NA	A0A0P0ZAD9	Stx2-converting_phage	100.0	4.1e-30
>prophage 4
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	448355	583270	5492765	portal,bacteriocin,head,terminase,transposase,tail,holin,capsid,integrase,protease	Escherichia_phage(35.71%)	175	529818:529833	585034:585049
WP_000012450.1|448355_449621_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|449631_449883_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|449892_450339_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|450341_450998_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|451091_451493_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|451549_451690_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|451922_452657_-	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|452747_453365_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|453370_453649_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|453663_454932_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|454928_456554_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|456848_457037_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|457176_457446_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|457447_459385_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|459381_460032_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|460031_460595_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|460578_461040_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|461089_461479_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|461534_462749_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|462772_463780_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|463937_466082_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|466081_467788_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|467768_468575_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|468630_468834_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|468983_469277_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|469367_469553_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|469780_469927_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|469926_470496_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|470766_471300_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|471304_471520_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|471596_471869_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|471909_472089_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|472223_474161_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|474647_474917_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|474928_475888_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001304085.1|476270_476423_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_015967940.1|476437_476683_+	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	100.0	2.7e-34
WP_001507023.1|476671_477106_-	phage antitermination Q family protein	NA	A0A0P0ZCW9	Stx2-converting_phage	100.0	2.8e-82
WP_000144764.1|477098_477293_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|477289_477895_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004020.1|477894_478617_-	DNA-binding protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_000335902.1|478768_479818_-	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_000153280.1|479999_480527_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|480523_480970_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|480926_481163_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|481173_481389_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|481521_481800_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145931.1|481870_482161_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788928.1|482157_482859_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000185454.1|482855_483794_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438541.1|483826_484123_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|484261_484489_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|484567_485275_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|485335_485677_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|485744_486206_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|486199_487246_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198444.1|487901_488285_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|488343_488814_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065377.1|488964_489333_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198863.1|489405_489570_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000372941.1|489538_489682_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_015983550.1|489636_489789_+	hypothetical protein	NA	Q08J51	Stx2-converting_phage	100.0	1.2e-21
WP_000995439.1|489757_490054_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|490059_490845_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|490841_491519_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|491518_491701_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|491673_491865_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|491875_492157_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|492255_492477_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_021497462.1|492473_493247_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	100.0	2.3e-143
WP_000797281.1|493398_493587_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|493588_493804_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|493805_494024_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|494025_494313_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|495288_495588_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|495673_495958_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|496010_497321_+|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|497317_497896_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|497916_498144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|498181_499423_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|501230_502151_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|502150_502456_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|502609_503209_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|503205_505752_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|505751_506924_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|507053_507746_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|507718_508747_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_000818441.1|511645_512719_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|512767_512902_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|512929_513160_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|513134_513323_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|513333_513546_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|513831_514044_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|514485_514791_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|514897_515542_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|515538_516285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000742329.1|516284_518381_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|518426_519566_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|519553_520000_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|520019_522200_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|522319_523624_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|523703_523796_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|523808_524945_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|524956_526501_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|526634_527492_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|527488_527887_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|527883_528471_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|528467_529175_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|529193_530987_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
529818:529833	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|530983_532102_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001303884.1|532719_532902_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001023352.1|534375_534645_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001230444.1|536024_536624_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|536691_540165_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|540298_540826_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_001303882.1|540856_541063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050546863.1|541016_541649_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|541594_542338_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|542348_543047_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|543046_543376_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082450.1|543372_545952_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533402.1|545932_546346_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|546372_546804_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|546817_547558_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|547539_547806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|547863_548211_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|548247_549753_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|549742_551335_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|551331_551538_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|551521_553450_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001301919.1|553421_553664_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|553713_555252_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|555301_555649_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|555645_556026_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|556101_556377_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|557127_557334_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|557296_557641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|557589_557862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|557794_557989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|558021_558555_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|558775_558889_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|559110_559296_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|559823_560138_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|561494_563345_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|563462_563666_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|564111_564825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|564919_565159_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|565445_566264_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|566415_566787_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|566776_567148_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|567160_568210_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|568211_568490_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|568657_568870_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|568914_569052_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001151233.1|570541_570955_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|570970_571741_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|571762_572509_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|572515_573607_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|573685_574141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|574347_574773_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|574756_575029_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|575137_575539_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|575566_575758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|575757_576045_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|576046_576265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|576322_576478_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|576619_577009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|577195_577381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|577382_577688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|577954_578143_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|578139_578331_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|578424_580896_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|580963_581206_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|581183_582203_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|582610_583270_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
585034:585049	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 5
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	871314	909408	5492765	portal,terminase,lysis,tail,holin,integrase,protease	Enterobacteria_phage(50.0%)	52	870899:870913	909482:909496
870899:870913	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|871314_872013_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_151121011.1|872079_872268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072127173.1|873292_873454_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|873950_874970_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|875003_875984_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|876160_876430_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|876431_877748_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|877807_878407_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|878477_881891_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|881951_882560_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|882496_883240_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|883245_883944_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|883953_884283_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|884282_887348_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|887319_887649_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|887657_888044_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|888104_888848_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|888858_889260_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|889256_889835_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|889846_890122_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|890114_890438_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|890524_892552_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_151121012.1|892496_892832_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	98.2	3.5e-56
WP_010904538.1|892953_894078_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|894005_894218_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|894214_896317_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|896316_896808_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|896797_897076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|897482_897635_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|897622_898090_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|898086_898584_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|898583_898799_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|898941_899340_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|899420_899579_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|899664_900408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|900591_901281_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|901295_901418_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|901754_902714_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|902925_903591_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|903587_904208_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|904200_904371_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|904367_904550_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|905247_905928_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|905924_906107_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|906079_906271_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|906281_906563_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|906661_906883_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|907093_907696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|907820_908006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|907938_908106_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|908145_908364_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|908526_909408_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
909482:909496	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	1452527	1504130	5492765	transposase,integrase,tail	Enterobacteria_phage(34.78%)	58	1445684:1445700	1501576:1501592
1445684:1445700	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000998048.1|1452527_1454066_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1454115_1454463_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1454459_1454840_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|1455103_1455367_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1455366_1455507_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|1455576_1455768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303810.1|1455829_1456120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|1456592_1457135_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|1457209_1457797_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|1457854_1458523_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|1458548_1461074_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265657.1|1461063_1462707_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|1462675_1463386_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|1463698_1464028_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|1464275_1464890_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000070685.1|1465307_1465997_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|1465993_1466950_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667043.1|1466946_1469145_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121321.1|1469154_1470111_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171064.1|1470289_1471417_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|1471558_1472617_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|1472862_1473765_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|1474467_1474746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|1474912_1475635_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|1475733_1476633_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|1477308_1478265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|1478397_1480731_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|1480744_1481068_-	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_001071227.1|1481067_1481289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|1481285_1481843_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|1481839_1482100_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|1483033_1483786_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|1483782_1484334_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|1484339_1484612_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_100068595.1|1484759_1484963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|1485021_1485588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695296.1|1485587_1485791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647286.1|1485787_1486177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001457442.1|1486353_1486839_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|1486831_1487290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|1487289_1487907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|1487879_1488296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|1488299_1489481_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000355475.1|1492009_1492783_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|1492840_1493395_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|1493424_1493835_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|1493855_1494299_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|1494270_1494864_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|1494863_1495658_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|1495657_1495969_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|1496920_1497214_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|1497332_1497533_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|1497633_1498347_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|1498474_1498864_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|1499103_1499349_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|1500418_1501672_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
1501576:1501592	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|1501683_1502787_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|1503074_1504130_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 7
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	1522916	1545614	5492765	transposase,plate	uncultured_Caudovirales_phage(50.0%)	18	NA	NA
WP_000027427.1|1522916_1524089_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|1524169_1524355_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|1524269_1524533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|1524734_1526495_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|1526497_1527634_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001303801.1|1527741_1528032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356493.1|1528379_1528925_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000103125.1|1533282_1535424_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|1535633_1536152_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|1536848_1537349_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|1537383_1537608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|1537658_1539050_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|1539140_1539554_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|1539557_1541408_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|1541371_1542454_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|1542478_1543759_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|1543755_1544280_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|1544282_1545614_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	3761564	3785011	5492765	holin,transposase,integrase,tail	Stx2-converting_phage(35.29%)	30	3753211:3753225	3785882:3785896
3753211:3753225	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|3761564_3762770_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|3762771_3764085_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|3764081_3765713_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|3765713_3766112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3766209_3766623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150586.1|3767018_3768203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|3768278_3768581_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|3768616_3769372_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|3769719_3770286_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|3770260_3770872_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|3770868_3771534_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|3771530_3772154_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|3772406_3773150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|3773235_3773403_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143065.1|3773810_3775664_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|3775813_3776029_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|3776033_3776378_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|3776734_3777115_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3777111_3777459_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|3777508_3778153_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|3777959_3778850_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|3778846_3779173_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|3779390_3779660_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|3779820_3780243_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|3780372_3781431_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|3781509_3782160_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|3782342_3782933_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|3782919_3783039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|3783434_3783683_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|3784528_3785011_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3785882:3785896	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 9
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	4062626	4068013	5492765	integrase	Enterobacteria_phage(50.0%)	6	4051576:4051592	4070209:4070225
4051576:4051592	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001005794.1|4062626_4063157_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|4063156_4063624_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|4063610_4064291_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|4064300_4065437_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|4065611_4066769_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|4067080_4068013_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
4070209:4070225	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 10
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	4314945	4392503	5492765	portal,tRNA,terminase,transposase,tail,holin,integrase,protease	Enterobacteria_phage(63.1%)	96	4317420:4317440	4366608:4366628
WP_000569336.1|4314945_4315872_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|4315876_4316608_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4316588_4316696_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|4316755_4317457_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
4317420:4317440	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|4317477_4318764_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_149008366.1|4318797_4319040_-	hypothetical protein	NA	Q859D3	Escherichia_coli_phage	86.0	9.6e-16
WP_085948178.1|4318962_4320175_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000556583.1|4320384_4320519_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|4320522_4320765_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|4320852_4321215_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|4321211_4321568_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|4321644_4321932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|4321901_4322078_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|4322079_4323027_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|4323023_4323245_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|4323343_4323625_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|4323635_4323827_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|4323799_4323982_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|4323981_4324659_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|4324655_4325441_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|4325446_4325743_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_001478900.1|4325711_4325864_-	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	3.6e-21
WP_000372942.1|4325818_4325962_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|4325930_4326095_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|4326167_4326536_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|4326796_4327378_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|4327394_4327667_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|4328179_4328731_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|4328737_4329019_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|4329141_4329789_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|4329897_4330116_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|4330230_4330527_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000788906.1|4331487_4332189_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|4332185_4332476_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|4332546_4332825_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|4332957_4333173_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|4333183_4333420_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|4333376_4333823_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|4333819_4334347_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|4334343_4334520_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|4334522_4334924_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|4334883_4335093_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|4335085_4335691_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|4335687_4335882_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|4335874_4336309_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_015971135.1|4336297_4336543_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_000691354.1|4336815_4337763_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|4337772_4338042_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_042817377.1|4338102_4338435_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	99.1	2.1e-58
WP_000874257.1|4338552_4340499_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|4340636_4340816_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|4340856_4341102_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|4341179_4341395_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|4341399_4341933_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|4342203_4342773_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4342772_4342919_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|4343146_4343332_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|4343543_4343816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|4343848_4344325_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|4344321_4346445_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|4346441_4346654_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|4346653_4348156_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001356427.1|4348169_4349060_+|protease	Clp protease ClpP	protease	Q9EYD3	Enterobacteria_phage	100.0	5.8e-167
WP_085948178.1|4349062_4350276_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000502242.1|4350397_4351438_+	peptidase	NA	Q8VNN5	Enterobacteria_phage	99.7	5.9e-195
WP_001097065.1|4351525_4351852_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|4351844_4352126_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|4352128_4352752_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|4352764_4353163_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|4353170_4353923_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|4353936_4354359_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|4354385_4354694_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|4354737_4357383_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|4357379_4357709_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_115448574.1|4357708_4358407_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	98.7	2.8e-132
WP_000194798.1|4358417_4359161_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|4359106_4359736_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151121034.1|4359976_4363450_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_001228289.1|4363517_4364117_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268835.1|4364181_4365495_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|4365496_4365766_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|4366133_4366382_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|4366896_4368582_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
4366608:4366628	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|4368578_4369298_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4369344_4369815_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4369856_4370318_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_085953806.1|4370501_4371714_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	8.4e-169
WP_001302810.1|4373755_4374892_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|4374884_4375616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|4375634_4377164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|4377174_4378263_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|4379503_4379821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|4379882_4383512_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|4383521_4385063_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|4385226_4386507_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|4390469_4392503_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 11
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	4519459	4593171	5492765	head,portal,terminase,transposase,tail,holin,integrase	Escherichia_phage(35.42%)	73	4546219:4546278	4570323:4571633
WP_085952406.1|4519459_4520673_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
WP_000966626.1|4521044_4523192_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071525094.1|4523298_4523481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|4524639_4526178_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4526227_4526575_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4526571_4526952_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|4527313_4527859_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|4527855_4528599_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|4528610_4529690_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|4529751_4530687_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|4531143_4532061_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|4532162_4533113_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|4535499_4536216_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|4536558_4538013_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|4538114_4539431_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|4539744_4540797_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
4546219:4546278	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|4546272_4547485_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001302302.1|4550843_4551641_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|4551876_4552899_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|4552898_4553102_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|4553160_4555632_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|4555727_4555916_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|4555912_4556101_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|4556581_4556734_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|4557008_4557653_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|4557750_4557978_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|4557974_4558400_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|4558468_4559506_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|4559537_4559960_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|4559994_4560693_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|4560714_4560939_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|4560935_4561292_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|4561324_4561477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|4561473_4561785_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|4561911_4562475_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|4562584_4562689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|4562875_4563088_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|4563129_4563315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|4563255_4563534_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|4563535_4564585_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|4564597_4564957_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|4564953_4565643_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|4565673_4565796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|4566276_4566705_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|4567182_4569033_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|4569114_4570328_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|4570647_4570854_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|4570858_4571203_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|4571253_4571787_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
4570323:4571633	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCATACTGGCTAAGAAGGATAGTTGGGTTTCACATGATACTTATATCTGGCAGTACATTTTCTGACAGACAGTGATGGGTGTTGTCAAGATATTGTGTCATTTATAACCTGAATCAGGGGGGGGAGCCGGAATGTTATCTGGCATTTTTAGCAGAGCCTGAATGCCATAATCACGGCTCCCGGCGTTGGCCGTCAGTGGGCGACACTGGCGGCTTTTTGTTTTCCTTTACTTTCATTTTCTGTCGGCGGTGACGGAGACATACATCAGATGGAAAAAATCACAACAGGTGTGTCATACACCACGTCAGCGGTGGGGACGGGATACTGGTTACTGCAGCTGCTGGACAAAGTCTCTCCGTCCCAGTGGGTGGCAATCGGTGTGCTGGGGAGTCTGCTGTTTGGCCTGCTGACGTATCTGACTAACCTGTATTTCAAAATCAGAGAGGACCGTCGTAAGGCGGCGCGGGGGGAGTAAAGCGATGAAGAAAAAATACGAACTGGGTGTTAAAGGGATAAATAATTACCCGGATAAGATTACTGTTACTGTGGCACCGGAAATTGGTGGGTATCCGTCACTGTTGTTGCCAGATGTGGCGATTAGTCTTGACCGTACTGAAGGTGCCACGCTGGAGTTTTACGAAGCTGAGGCGAAAAAGCAGGCGAAGCAGTTTTTCATGGATGTTGCTGCCGGGTTATGTGAAGGGGATGGTCCGTTGCCGGAAAAGCGCCCCGTAATTTTAGAGGCGCAGGATGTGTTGATAACCTACAGAGGAAAACTACCGGGAATAATTACGGGTTCTCTGAAGACTCCACCGCTGGCCTGAAGACTTAACATATCCAGGGATTTGAAATCGATAAACCCTGATAAATATCCATGAACGCAAAAATCAGATACGGCCTGTCGGCTGCCGTTCTGGCGCTGATTGGTGCAGGGGCGTCTGCGCCTGAAATCCTCGACCAGTTTCTTGACGAAAAAGAAGGTAACCACACCACGGCATACCGTGATGGTGCGGGTATCTGGACCATCTGCCGCGGTGCCATCCTGGTGGATGGTAAACCTGTCGTTCCGGGCATGAAGTTGTCGAAGGAAAAATGCGACCAGGTTAACGCCATTGAACGTGATAAGGCGCTGGAGTGGGTGGAGCGCAATATTAAAGTACCGCTGACCGAACCCCAGAAAGCGGGGATCGCGTCATTCTGTCCGTACAACATTGGTCCCGGTAAGTGTTTCCCGTCGACGTTTTACAGACGAAT	NA	NA	NA	NA
WP_001303555.1|4571942_4572125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|4572137_4572269_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|4572496_4572682_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|4573208_4573523_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|4573604_4573829_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|4574223_4574733_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|4574704_4576633_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|4576616_4576823_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|4576819_4578412_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|4578401_4579907_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|4579943_4580291_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|4580348_4580615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|4580596_4581337_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|4581350_4581782_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|4581808_4582222_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_151121036.1|4582202_4584782_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000847298.1|4584778_4585108_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_115448574.1|4585107_4585806_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	98.7	2.8e-132
WP_000194798.1|4585816_4586560_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|4586505_4587135_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_149888716.1|4587375_4590855_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230508.1|4590922_4591522_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_070479928.1|4591586_4592900_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|4592901_4593171_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 12
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	4970152	5084405	5492765	portal,head,terminase,transposase,tail,holin,capsid,protease	Escherichia_phage(28.18%)	143	NA	NA
WP_001260835.1|4970152_4970974_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4971073_4971157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|4971249_4971585_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|4971981_4973235_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|4973341_4974235_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4974369_4975590_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|4975714_4976410_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|4976362_4977655_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|4977812_4978427_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|4978469_4979324_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4979325_4979943_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|4979953_4982377_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|4982437_4984864_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|4985062_4985368_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|4985475_4986186_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|4986188_4986749_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|4986783_4987125_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|4987259_4987586_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|4987758_4987884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|4988574_4988811_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|4988898_4991370_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|4991462_4991654_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4991650_4991839_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4992239_4992404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|4992407_4992626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|4992697_4992997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|4993349_4993628_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|4993629_4993821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|4993841_4994213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|4994310_4994613_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|4994609_4995035_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|4995057_4996020_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|4996026_4996767_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|4997577_4997973_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|4998029_4998614_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|4998729_4998834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|4999022_4999235_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|4999402_4999681_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|4999682_5000732_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_151121037.1|5000744_5001104_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.6e-38
WP_001059381.1|5001100_5001790_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302069.1|5001820_5001943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303509.1|5002429_5002858_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|5003335_5005186_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411805.1|5005634_5005841_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|5005845_5006190_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|5006240_5006774_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|5007044_5007614_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5007613_5007760_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|5007987_5008173_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|5008597_5008825_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|5008866_5009232_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|5009521_5010085_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|5010081_5011743_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|5011806_5013744_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|5013788_5014010_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|5013955_5016535_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|5016537_5016864_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|5016873_5017224_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|5017220_5017667_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|5017663_5018008_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_060722693.1|5018073_5018790_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	5.2e-126
WP_001030063.1|5018795_5019170_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|5019265_5019475_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212897.1|5019527_5022608_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_000807954.1|5022600_5022942_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|5022941_5023379_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_038425866.1|5023566_5026827_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|5026829_5027045_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|5027112_5027712_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001023362.1|5029002_5029272_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_010917823.1|5030338_5030686_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001121225.1|5030670_5031321_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|5031903_5033442_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|5033491_5033839_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|5033835_5034216_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|5035178_5035493_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|5036131_5037376_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|5037468_5037657_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|5037653_5037842_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|5038406_5038616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|5038616_5039255_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|5039266_5039419_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|5039711_5040050_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|5040441_5040684_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|5040667_5041093_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|5041161_5042205_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|5042236_5042659_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|5042692_5043409_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|5043441_5043723_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|5043719_5043947_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|5043939_5044251_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|5044378_5044597_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|5044598_5045156_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|5045389_5045602_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|5045721_5046066_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|5046187_5046460_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|5046461_5047511_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|5047523_5047829_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|5047891_5048446_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|5048670_5048868_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|5049003_5049717_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303509.1|5050171_5050600_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023184.1|5051077_5052928_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|5053375_5053582_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|5053586_5053931_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|5053981_5054515_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|5054786_5055356_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|5055355_5055502_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|5055724_5055910_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|5056435_5056750_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|5056831_5057056_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|5057071_5057329_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867493.1|5057442_5057988_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|5057962_5059888_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|5059884_5060091_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|5060087_5061689_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|5061669_5062989_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|5062998_5063331_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|5063386_5064412_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|5064453_5064852_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|5064863_5065217_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|5065231_5065765_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|5065761_5066157_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|5066164_5066917_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|5066930_5067353_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|5067379_5067793_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032166593.1|5067773_5070386_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.3	0.0e+00
WP_000847298.1|5070382_5070712_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|5070711_5071410_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|5071420_5072164_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|5072109_5072739_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_151121038.1|5072979_5076459_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_001230508.1|5076526_5077126_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001023362.1|5078414_5078684_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|5078797_5079373_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|5079445_5080075_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|5080156_5080798_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001480712.1|5080828_5080963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241229.1|5080959_5081274_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|5081333_5082617_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|5082705_5084166_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|5084201_5084405_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 13
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	5258910	5316626	5492765	head,tRNA,terminase,tail,holin,capsid,integrase	Escherichia_phage(40.91%)	74	5255368:5255383	5315787:5315802
5255368:5255383	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_001295593.1|5258910_5259345_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|5259925_5260567_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|5260648_5261278_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|5261350_5261926_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|5262038_5262308_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|5262309_5263623_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|5263687_5264287_-	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_151121039.1|5264357_5267855_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.2	0.0e+00
WP_000649829.1|5267988_5268516_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_010917807.1|5268546_5268753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064732755.1|5268706_5269339_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|5269284_5270028_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|5270038_5270737_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|5270736_5271078_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|5271070_5274151_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|5274202_5274412_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|5274507_5274882_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|5274887_5275604_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|5275671_5276016_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|5276012_5276459_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|5276455_5276806_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|5276815_5277142_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|5279668_5279890_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|5279934_5281872_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|5281935_5283597_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|5283593_5284157_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|5284445_5284811_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|5284852_5285053_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|5285184_5285511_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_001412416.1|5285446_5285629_-	hypothetical protein	NA	H6WZK4	Escherichia_phage	98.3	2.2e-25
WP_077631024.1|5285619_5285820_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	71.8	7.2e-09
WP_012817877.1|5285911_5286097_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|5286319_5286451_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|5286545_5287241_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|5287514_5288048_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|5288098_5288443_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|5288447_5288663_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_021497500.1|5288812_5290666_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|5291240_5291672_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|5292233_5292788_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|5292784_5293075_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|5293074_5293674_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|5294173_5295565_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|5295564_5296554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|5296521_5297673_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|5298104_5298350_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|5298428_5298590_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|5298600_5298864_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|5298865_5299030_-	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|5299115_5299328_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|5299433_5299856_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|5299871_5300633_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|5300655_5301402_-	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|5301408_5302197_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|5302274_5302697_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|5302693_5302948_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|5303027_5303447_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_015695616.1|5303483_5303702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233809.1|5303734_5303869_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|5303879_5304035_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|5304031_5304520_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|5304961_5305183_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|5305182_5305353_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000105140.1|5305803_5308404_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|5308396_5309206_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|5309261_5309411_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|5309448_5309637_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|5309736_5309952_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|5309953_5311189_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|5311240_5312176_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|5312304_5313678_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_124056621.1|5313636_5313867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|5314155_5315139_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|5315393_5316626_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
5315787:5315802	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 14
NZ_CP044143	Escherichia coli O157 strain AR-0429 chromosome, complete genome	5492765	5401571	5477026	5492765	head,portal,terminase,transposase,tail,holin,capsid,integrase,protease	Stx2-converting_phage(34.48%)	88	5417073:5417100	5477163:5477190
WP_000422055.1|5401571_5402621_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|5402840_5403599_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|5403595_5404186_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|5404225_5405098_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|5405310_5406894_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|5406921_5407542_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|5407538_5408420_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|5408557_5408602_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|5408693_5410256_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|5410255_5411851_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001302292.1|5411854_5413213_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|5413224_5414418_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|5414417_5415224_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|5415604_5415784_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|5415869_5416370_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|5416415_5416922_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
5417073:5417100	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|5417423_5417642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|5418235_5418664_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|5420392_5420983_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|5421166_5421814_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|5421950_5422097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|5422524_5422803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|5423142_5423523_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5423519_5423867_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|5423916_5425455_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|5426420_5426990_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|5427055_5427967_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|5428073_5428196_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_024262009.1|5429337_5429526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025672.1|5429793_5431119_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|5432145_5432415_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|5432416_5433730_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|5433881_5434481_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_115801855.1|5434548_5436894_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001304109.1|5436845_5438021_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_151121042.1|5438362_5438995_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	90.9	1.9e-95
WP_000194763.1|5438940_5439684_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|5439694_5440393_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|5440392_5440734_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_151121040.1|5440726_5443969_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.3	0.0e+00
WP_001453746.1|5444016_5444226_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|5444321_5444696_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|5444710_5445427_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|5445492_5445837_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|5445833_5446280_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007901.1|5446276_5446627_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|5446636_5446963_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|5447042_5449544_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063095.1|5449489_5449711_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.9e-35
WP_000173030.1|5449755_5451693_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|5451756_5453418_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|5453414_5453978_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|5454267_5454633_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|5454674_5454902_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|5455326_5455512_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|5455739_5455886_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|5455885_5456455_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|5456725_5457259_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|5457309_5457654_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|5457658_5457874_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|5458023_5459877_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_064761991.1|5459996_5460182_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000935548.1|5460673_5461732_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|5461882_5462080_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|5462321_5462852_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|5462860_5463220_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|5463232_5464279_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|5464280_5464559_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|5464628_5464886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|5465106_5465319_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|5465597_5466356_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|5467054_5467219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|5467215_5467797_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|5467983_5468406_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|5468437_5469478_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|5469449_5470001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|5469984_5470212_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|5470288_5470696_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|5470959_5471259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|5471331_5471550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|5471572_5471980_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|5471957_5472191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994727.1|5472184_5472328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|5472664_5472853_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|5472849_5473041_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|5473133_5475605_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|5475669_5475918_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|5475895_5477026_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
5477163:5477190	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 1
NZ_CP044142	Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence	152532	45165	62202	152532	integrase,transposase	Salmonella_phage(28.57%)	23	54338:54397	55754:55876
WP_000427619.1|45165_46170_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|46248_49221_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|49223_49781_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001447826.1|49818_50142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845054.1|50086_51100_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001436322.1|51245_52043_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA7	NA	NA	NA	NA	NA
WP_000679427.1|52206_52554_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_040079219.1|52547_53387_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_072037403.1|53316_53496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|53514_54015_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|54320_54434_-	hypothetical protein	NA	NA	NA	NA	NA
54338:54397	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_001389365.1|54521_55286_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001375131.1|55349_55607_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	61.9	8.9e-12
WP_014839880.1|55648_55825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276635.1|55844_56834_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
55754:55876	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACACATGGCATCTGACATCAAGTTAGGGTATGCCTCAGTCTGACAGTGATGAGTCGCAGGCGTTCG	NA	NA	NA	NA
WP_001087810.1|56830_57067_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000995361.1|57063_57429_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000761850.1|57540_58179_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000149288.1|58193_59879_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000732290.1|59950_60226_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294666.1|60241_60592_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000414383.1|60663_61098_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000427623.1|61197_62202_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP044144	Escherichia coli O157 strain AR-0429 plasmid pAR-0429-2, complete sequence	92690	9309	16618	92690	transposase	Macacine_betaherpesvirus(50.0%)	8	NA	NA
WP_077631973.1|9309_9390_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|9355_10569_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_071525396.1|10530_10869_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|11456_12623_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|12622_13594_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001349526.1|13978_14251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336590.1|14334_14631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138832.1|14893_16618_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
