The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044028	Proteus mirabilis strain K817 chromosome, complete genome	4017079	642882	654836	4017079		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004247426.1|642882_644082_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|644690_645659_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004247428.1|645684_647811_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.2	3.4e-205
WP_004246072.1|647839_648244_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|648255_648480_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|648761_649235_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|649432_649642_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|650709_651084_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|651099_652065_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|652166_652811_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|653162_653426_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|653624_654836_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 2
NZ_CP044028	Proteus mirabilis strain K817 chromosome, complete genome	4017079	856693	935593	4017079	tRNA,protease,plate	Bacillus_phage(17.65%)	58	NA	NA
WP_004244558.1|856693_857008_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|857038_859333_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|859452_859671_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_150452760.1|859990_860683_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004252037.1|860684_862436_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_017628444.1|862438_864208_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004252032.1|864349_865309_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
WP_004244566.1|865851_866346_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_150452761.1|866473_870256_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|870368_870974_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|870984_872334_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|872467_873757_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_036908217.1|873936_874269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971363.1|874668_875718_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|875790_876696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|877052_877793_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|877900_880183_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|880237_881092_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036971369.1|881761_883519_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|883746_884784_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_104731560.1|884858_886112_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004252013.1|886248_887679_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.4	7.5e-07
WP_004244582.1|887815_888904_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004244584.1|889100_890387_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|890674_891352_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|891533_893207_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|893271_893559_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_063215362.1|893963_896333_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	2.7e-22
WP_104731562.1|896369_898115_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	1.1e-60
WP_046335154.1|898111_899113_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|899608_899824_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|900238_900418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|900422_901184_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004247632.1|901306_902137_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004247633.1|902516_903290_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|903299_904622_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|904602_905334_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_046335151.1|905330_909788_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_060554589.1|910070_910724_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.9	2.4e-101
WP_004247637.1|911129_911843_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004244603.1|912185_913901_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|914232_914781_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|914830_915481_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|915573_916047_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_104731563.1|916137_917874_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_004244609.1|917866_919222_-	membrane protein	NA	NA	NA	NA	NA
WP_004244610.1|919259_922808_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|922810_924274_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|924279_924930_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|924931_925720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104731564.1|925723_928435_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	4.9e-84
WP_004244617.1|928443_929199_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004244618.1|929191_930559_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|930551_931103_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|931104_932373_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|932377_933415_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046334530.1|933378_935154_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|935161_935593_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP044028	Proteus mirabilis strain K817 chromosome, complete genome	4017079	1011930	1088154	4017079	tRNA,terminase,protease,capsid,tail,integrase,portal,lysis,head,holin	Proteus_phage(12.86%)	99	1010952:1011011	1051631:1051731
1010952:1011011	attL	AAATTCCAGACATAAAAAAACCAACCGTAAGTGGTTGGTTTTCTTAAATAAAAATGGTCG	NA	NA	NA	NA
WP_074924452.1|1011930_1013109_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	31.9	5.5e-32
WP_020945460.1|1013110_1013323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908179.1|1013297_1013495_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	44.4	1.2e-05
WP_004250516.1|1013935_1014115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074924453.1|1014162_1014663_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	56.4	2.1e-41
WP_150452763.1|1014662_1016630_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.1	1.0e-115
WP_004250523.1|1016642_1016903_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_036908171.1|1016902_1017235_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	2.1e-05
WP_074924455.1|1017790_1018573_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_074924456.1|1018631_1019285_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	67.0	7.7e-76
WP_074924457.1|1019366_1019552_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	49.2	5.1e-09
WP_074924458.1|1019631_1020087_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	54.7	3.8e-29
WP_004250533.1|1020104_1020329_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_049210198.1|1020330_1021182_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	58.3	4.0e-32
WP_049210196.1|1021174_1021768_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	48.1	4.9e-45
WP_101495146.1|1021757_1023134_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
WP_049210194.1|1023153_1023330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049210192.1|1023332_1023566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250545.1|1023562_1024174_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	48.0	7.0e-47
WP_046335186.1|1024219_1024558_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.9	8.7e-31
WP_004250549.1|1024635_1025229_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.7	1.5e-57
WP_049257310.1|1025240_1025552_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	7.7e-34
WP_074561915.1|1025539_1026070_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	51.3	1.1e-35
WP_036895371.1|1026236_1026434_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	63.5	2.4e-09
WP_150452903.1|1026588_1027626_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.4	2.0e-142
WP_064506390.1|1027887_1028157_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	2.5e-17
WP_049257301.1|1028156_1028627_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	2.2e-48
WP_150452764.1|1028769_1029231_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	33.3	1.9e-12
WP_150452765.1|1029720_1030740_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.6	1.6e-35
WP_150452766.1|1030938_1032336_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	5.6e-84
WP_150452767.1|1032339_1033842_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	41.8	2.3e-99
WP_049209903.1|1033879_1034593_+|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	34.8	2.0e-32
WP_049209850.1|1034589_1035849_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.2e-45
WP_049209851.1|1035848_1036346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250578.1|1036345_1037413_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
WP_004250579.1|1037482_1037824_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	33.6	2.7e-08
WP_004250580.1|1037826_1038258_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.0	7.4e-11
WP_004250581.1|1038257_1038716_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	3.2e-12
WP_004250582.1|1038715_1039087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250583.1|1039073_1039589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250584.1|1039597_1041085_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.9	8.7e-83
WP_004250586.1|1041095_1041548_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250588.1|1041588_1042047_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_053088713.1|1042130_1044482_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	26.2	6.3e-19
WP_049209852.1|1044478_1045006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020945489.1|1045005_1045323_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
WP_049209853.1|1045288_1046104_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	1.8e-10
WP_049209854.1|1046106_1046799_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	38.9	9.1e-35
WP_004250600.1|1046795_1047140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049209856.1|1047132_1048320_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.6	2.6e-69
WP_150452768.1|1048316_1048973_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.7	1.5e-39
WP_049209906.1|1050412_1050850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049209858.1|1051221_1051470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074924370.1|1051861_1053043_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.0	1.2e-29
1051631:1051731	attR	AAATTCCAGACATAAAAAAACCAACCGTAAGTGGTTGGTTTTCTTAAATAAAAATGGTCGGCATGATAGGATTTGAACCTACGACCCCTGACACCCCATGA	NA	NA	NA	NA
WP_049219192.1|1053044_1053251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064506363.1|1053327_1053723_-	hypothetical protein	NA	S4TTI6	Salmonella_phage	53.2	2.6e-26
WP_150452769.1|1053722_1054418_-	hypothetical protein	NA	R9VWB9	Serratia_phage	51.5	9.7e-61
WP_150452770.1|1054633_1055131_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	59.6	1.3e-46
WP_150452771.1|1055123_1055657_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	59.2	5.7e-53
WP_150452772.1|1055724_1056306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150452773.1|1056805_1057009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150452774.1|1057253_1057835_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_150452775.1|1057831_1058530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049213205.1|1058664_1059339_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	75.6	1.1e-88
WP_036900931.1|1059434_1059662_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	50.0	1.8e-11
WP_036900998.1|1059700_1060159_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
WP_004251656.1|1060416_1060596_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.8e-11
WP_150452776.1|1060608_1061670_+	replication protein	NA	H2DE83	Erwinia_phage	55.3	1.0e-29
WP_150452904.1|1061669_1062308_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	64.1	1.0e-80
WP_017827292.1|1062304_1062706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126656782.1|1064015_1064195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150452777.1|1064262_1065285_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	67.8	2.0e-131
WP_036905247.1|1065471_1065795_+	negative regulator GrlR	NA	NA	NA	NA	NA
WP_049221519.1|1066160_1066508_+|holin	holin	holin	NA	NA	NA	NA
WP_129765381.1|1066500_1066905_+	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.3	5.9e-26
WP_150452778.1|1066901_1067357_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.6	3.0e-26
WP_150452779.1|1067357_1067567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150452780.1|1067662_1068013_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	93.0	4.1e-60
WP_150452781.1|1068009_1068207_+	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	87.5	3.2e-25
WP_049218005.1|1068354_1068825_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	81.4	7.7e-70
WP_150452782.1|1068828_1070562_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	98.4	0.0e+00
WP_150452783.1|1070561_1071893_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	96.8	9.7e-251
WP_150452784.1|1071897_1072749_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	98.2	1.6e-150
WP_074924469.1|1072760_1073975_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	99.0	3.6e-220
WP_150452785.1|1074260_1074587_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	91.7	7.3e-51
WP_150452786.1|1074595_1074925_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_150452787.1|1074914_1075388_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.7	3.3e-12
WP_139654076.1|1075392_1075734_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_150452788.1|1075743_1076445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074924489.1|1076453_1076867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139654073.1|1076863_1077142_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_150452789.1|1077184_1080454_+|tail	phage tail tape measure protein	tail	A0A220VZA0	Acinetobacter_phage	33.9	3.6e-41
WP_150452790.1|1080454_1081051_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	50.3	1.3e-50
WP_150452791.1|1081050_1081632_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	3.4e-51
WP_074924493.1|1081659_1082121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074924494.1|1082184_1082583_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	48.5	6.4e-33
WP_150452792.1|1082582_1085597_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	52.3	2.9e-202
WP_150452793.1|1085599_1086640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150452794.1|1086714_1088154_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	54.2	1.3e-115
>prophage 4
NZ_CP044028	Proteus mirabilis strain K817 chromosome, complete genome	4017079	1167020	1201743	4017079	tRNA,terminase,protease,capsid,tail,integrase,portal,lysis,head	Morganella_phage(26.67%)	45	1167789:1167803	1178464:1178478
WP_004247117.1|1167020_1168124_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1167789:1167803	attL	AAATGCTTTAAATTT	NA	NA	NA	NA
WP_036918198.1|1168229_1168682_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|1168674_1169304_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|1169442_1170696_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_036908088.1|1170805_1171939_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	72.2	6.5e-155
WP_017628380.1|1171913_1172165_-	excisionase	NA	NA	NA	NA	NA
WP_036908086.1|1172250_1172775_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	60.5	1.1e-53
WP_017628378.1|1173059_1173692_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_006537203.1|1173792_1173999_+	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
WP_036908083.1|1174036_1174513_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
WP_036908081.1|1174774_1174954_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	2.6e-10
WP_052124643.1|1175511_1176027_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	4.6e-23
WP_036908080.1|1176048_1176855_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	1.2e-89
WP_036908078.1|1176851_1177877_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	3.0e-82
WP_036908077.1|1178176_1179256_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	39.6	1.4e-50
1178464:1178478	attR	AAATGCTTTAAATTT	NA	NA	NA	NA
WP_036908076.1|1179759_1180158_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.8	3.5e-31
WP_004247137.1|1180497_1180710_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|1181111_1181633_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|1181956_1182292_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_036908075.1|1182395_1183322_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_036908073.1|1183738_1184167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|1184319_1184571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150452797.1|1185014_1185284_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_036900946.1|1185283_1185754_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_036905787.1|1185896_1186358_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_001967215.1|1187255_1187594_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_006537823.1|1187596_1187809_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.4e-07
WP_006537822.1|1187931_1188399_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_017628363.1|1188352_1190086_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_017628362.1|1190085_1191354_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|1191371_1192040_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|1192043_1193210_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|1193248_1193548_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|1193547_1193877_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_063073913.1|1193866_1194340_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.6	2.8e-11
WP_017628357.1|1194345_1194687_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|1194696_1195362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|1195426_1195843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|1195839_1196118_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1196142_1196334_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|1196460_1199736_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|1199736_1200333_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|1200332_1200914_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|1200930_1201266_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|1201344_1201743_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
>prophage 5
NZ_CP044028	Proteus mirabilis strain K817 chromosome, complete genome	4017079	1482303	1492295	4017079		Escherichia_phage(66.67%)	8	NA	NA
WP_104731639.1|1482303_1484361_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
WP_004248043.1|1484372_1486073_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1486408_1487095_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1487094_1487556_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1487608_1488220_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_060554654.1|1488359_1489220_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	2.1e-25
WP_004242892.1|1489221_1489839_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_004248044.1|1489850_1492295_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	7.3e-220
>prophage 6
NZ_CP044028	Proteus mirabilis strain K817 chromosome, complete genome	4017079	2024912	2043716	4017079	holin,lysis	Burkholderia_phage(26.67%)	22	NA	NA
WP_104731704.1|2024912_2027351_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.3	5.5e-260
WP_004243609.1|2027362_2027980_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_049218815.1|2027983_2028760_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	8.6e-42
WP_004250729.1|2028875_2029418_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	1.6e-18
WP_017628013.1|2029986_2030166_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_104731705.1|2030269_2031475_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.4e-14
WP_017628011.1|2031480_2032137_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_012368085.1|2032133_2033321_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	3.2e-72
WP_004243617.1|2033313_2033658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104731706.1|2033654_2034347_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	8.8e-30
WP_004243622.1|2034349_2035162_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2035130_2035451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243624.1|2035463_2035952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104731707.1|2035954_2038258_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
WP_004243627.1|2038340_2038799_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2038858_2039311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248362.1|2039321_2040809_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
WP_012368090.1|2040817_2041330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049210638.1|2041366_2041816_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|2041812_2042217_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|2042219_2042519_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|2042900_2043716_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
>prophage 7
NZ_CP044028	Proteus mirabilis strain K817 chromosome, complete genome	4017079	2766986	2775830	4017079		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|2766986_2768555_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_004245602.1|2768955_2769636_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|2769732_2770308_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|2770384_2770963_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004249445.1|2771030_2772056_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|2772090_2772546_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_104731827.1|2772570_2773707_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_049257396.1|2773707_2774292_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	9.4e-17
WP_049199390.1|2774684_2775830_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.6e-31
>prophage 8
NZ_CP044028	Proteus mirabilis strain K817 chromosome, complete genome	4017079	3453313	3528426	4017079	transposase,integrase,tRNA,protease	Bacillus_phage(25.0%)	60	3497179:3497197	3528630:3528648
WP_017628739.1|3453313_3453898_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004246555.1|3453992_3454904_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_017628737.1|3456346_3456742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104459538.1|3456888_3459003_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_104731889.1|3459005_3461354_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_104731890.1|3461364_3465051_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_004246549.1|3465066_3465537_+	cellulose biosynthesis protein	NA	NA	NA	NA	NA
WP_104731891.1|3465575_3466481_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_017628731.1|3466654_3467617_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.1	2.5e-59
WP_060555791.1|3467690_3468728_+	endoglucanase	NA	NA	NA	NA	NA
WP_071425880.1|3468866_3470516_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_104731892.1|3470624_3472487_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	1.1e-13
WP_004249787.1|3472483_3473875_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_004246539.1|3473890_3474811_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_004246538.1|3475009_3475666_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004246537.1|3475662_3476601_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_080633831.1|3476612_3479660_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_004246534.1|3479839_3480670_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_004246527.1|3480829_3481705_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_004246526.1|3481996_3482539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246525.1|3482753_3483725_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_004249779.1|3483849_3484737_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104731895.1|3485151_3485952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049194461.1|3486126_3487479_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_104731896.1|3487523_3490601_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004249775.1|3490628_3491432_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_104731897.1|3491485_3493351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246518.1|3493478_3494408_-	phosphoesterase	NA	NA	NA	NA	NA
WP_004246516.1|3494592_3495057_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_104731898.1|3495458_3496772_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_004249771.1|3496772_3497030_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3497179:3497197	attL	TTACTTCCCAATACAGAAA	NA	NA	NA	NA
WP_001145449.1|3497305_3497935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150667.1|3498067_3498241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|3498282_3499047_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|3499134_3499248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|3499553_3500054_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|3500072_3500252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|3500181_3501021_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3501014_3501362_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3501525_3502317_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845039.1|3502462_3503476_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_123161504.1|3503444_3503726_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001072145.1|3503749_3504334_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	58.1	5.5e-49
WP_049208435.1|3504412_3505402_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001536280.1|3505422_3507966_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000766277.1|3508043_3509969_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000562220.1|3509965_3511627_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	22.8	7.1e-09
WP_000834750.1|3512695_3513568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742851.1|3513571_3513868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901446.1|3514716_3514986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060800.1|3515400_3515796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150452829.1|3515792_3516650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536376.1|3516893_3518318_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_000347732.1|3518321_3521726_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000043897.1|3521725_3521980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086010879.1|3522266_3523443_+|transposase	IS3-like element ISVch4 family transposase	transposase	Q716C2	Shigella_phage	65.1	1.5e-117
WP_001187968.1|3525318_3525546_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000802150.1|3525532_3526486_+	replication protein	NA	NA	NA	NA	NA
WP_000215270.1|3526843_3527212_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000868887.1|3527208_3528426_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	28.3	6.3e-15
3528630:3528648	attR	TTACTTCCCAATACAGAAA	NA	NA	NA	NA
>prophage 9
NZ_CP044028	Proteus mirabilis strain K817 chromosome, complete genome	4017079	3581688	3649852	4017079	tRNA,terminase,capsid,tail,protease,integrase,portal,plate,lysis,head,holin	Salmonella_phage(38.89%)	73	3594266:3594282	3634108:3634124
WP_142836817.1|3581688_3582192_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_063691855.1|3582204_3583371_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.9	3.8e-118
WP_063691853.1|3583604_3584552_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_063691851.1|3584551_3585574_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_081232611.1|3585542_3586676_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_142836816.1|3586672_3587326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081232610.1|3587801_3588917_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_063691847.1|3588913_3589726_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_063691844.1|3589733_3590996_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_063691841.1|3591417_3592413_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_063691839.1|3592417_3593389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062814618.1|3593401_3594100_-	WbqC family protein	NA	NA	NA	NA	NA
WP_142836815.1|3594108_3595149_-	glycosyltransferase	NA	NA	NA	NA	NA
3594266:3594282	attL	TTTTTTAATAAAAAACA	NA	NA	NA	NA
WP_063691833.1|3595135_3596236_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.1	1.4e-21
WP_036919531.1|3596547_3597939_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
WP_004246432.1|3597951_3598650_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
WP_142836814.1|3598833_3599400_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_036908546.1|3599676_3600648_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	64.4	1.6e-117
WP_036908544.1|3600714_3601020_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	49.5	8.4e-17
WP_036908542.1|3601124_3601415_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	63.5	1.1e-31
WP_036908539.1|3601416_3601605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908537.1|3601763_3602039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150452833.1|3602088_3602481_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_006536692.1|3602498_3602756_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_036907622.1|3602748_3602970_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.0e-12
WP_150452834.1|3602971_3603799_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	5.2e-61
WP_012368206.1|3603798_3604122_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_150452835.1|3606693_3609513_+	ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	44.2	7.1e-09
WP_087726284.1|3610049_3611078_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.1	2.1e-136
WP_087726283.1|3611077_3612832_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.4	1.8e-260
WP_071233978.1|3613004_3613814_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	2.0e-65
WP_150452836.1|3613829_3614948_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	66.9	3.7e-126
WP_012368197.1|3614947_3615616_+|terminase	terminase	terminase	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_087726424.1|3615693_3616149_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.3	2.4e-28
WP_150452837.1|3616148_3616355_+|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	50.0	3.1e-15
WP_012368194.1|3616374_3616689_+|holin	holin	holin	NA	NA	NA	NA
WP_150452838.1|3616681_3617086_+	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	57.4	1.2e-39
WP_150452839.1|3617082_3617586_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_109829029.1|3617560_3617998_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	48.6	9.2e-33
WP_150452840.1|3617987_3618629_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	3.4e-28
WP_150452841.1|3618717_3619344_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.6	1.2e-57
WP_150452842.1|3619340_3619679_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	49.5	2.9e-26
WP_150452843.1|3619680_3620589_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	66.9	1.3e-108
WP_049256913.1|3620581_3621193_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.9	4.2e-76
WP_150452844.1|3622561_3622912_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	36.6	1.3e-05
WP_150452845.1|3623004_3624177_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	70.9	6.5e-166
WP_012368183.1|3624180_3624696_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.9	2.6e-55
WP_087726269.1|3624715_3625063_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.7	1.0e-18
WP_072070684.1|3625023_3625197_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	52.6	5.6e-10
WP_150452846.1|3625189_3628024_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	40.9	1.5e-112
WP_036907694.1|3628023_3628488_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_150452847.1|3628487_3629585_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	55.1	5.0e-112
WP_150452848.1|3629637_3629847_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.5	3.6e-19
WP_150452849.1|3629924_3630713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150452850.1|3630779_3631484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063691830.1|3631834_3632896_+	lipopolysaccharide 1,6-galactosyltransferase	NA	NA	NA	NA	NA
WP_063691827.1|3632944_3634096_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_063691996.1|3634214_3634970_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
3634108:3634124	attR	TGTTTTTTATTAAAAAA	NA	NA	NA	NA
WP_004246429.1|3635503_3636481_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_063691993.1|3636774_3637779_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004249716.1|3637874_3638645_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_063691990.1|3638751_3639387_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_004249714.1|3639498_3639927_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_063691988.1|3639987_3640734_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_060557199.1|3641072_3642260_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.9	2.6e-13
WP_004246422.1|3642369_3643902_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246421.1|3643944_3644760_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_012368679.1|3645056_3645299_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_041701484.1|3645459_3645711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004246419.1|3646325_3646844_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_020946557.1|3646952_3647870_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004246417.1|3647968_3649309_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
WP_004246416.1|3649321_3649852_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
