The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023695	Streptomyces alboniger strain ATCC 12461 chromosome, complete genome	7962786	579099	637932	7962786	integrase,transposase	Streptomyces_phage(25.0%)	42	624810:624829	639793:639812
WP_150476521.1|579099_580494_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_150476522.1|582356_582872_-	LysM peptidoglycan-binding domain-containing protein	NA	R4T8D6	Streptomyces_phage	39.1	2.3e-14
WP_055528807.1|583279_583693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055528806.1|584681_585929_-	MFS transporter	NA	NA	NA	NA	NA
WP_055528805.1|585991_586753_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_055528804.1|586840_587083_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_055528802.1|587156_588413_-	pyridoxal phosphate-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_055528851.1|588409_590374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055528801.1|590393_591614_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_055528800.1|591673_593359_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_150476523.1|593355_596214_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_055528849.1|598104_599076_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_055528797.1|599329_600298_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	39.6	3.7e-58
WP_150477769.1|600478_601120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055528795.1|601220_603116_+	amidohydrolase	NA	NA	NA	NA	NA
WP_150476524.1|603127_603868_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_150476525.1|603883_604426_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_055528790.1|604462_605314_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_055528788.1|605336_606209_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_055528787.1|606507_607350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055528786.1|607440_608466_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_055528784.1|609167_610055_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_150476528.1|610473_610749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055528782.1|610762_611167_+	DUF317 domain-containing protein	NA	NA	NA	NA	NA
WP_055528781.1|612321_613080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055528780.1|613079_614465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055528779.1|614467_615496_+	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_055528778.1|615604_616282_+	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_055528776.1|616284_618669_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_055528775.1|620584_621067_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150476529.1|621063_621669_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167532660.1|621807_622827_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_055528773.1|623464_624235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150476531.1|624242_627917_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
624810:624829	attL	GAAGACGACGCCGAAGGCGG	NA	NA	NA	NA
WP_055528771.1|627933_630012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055528770.1|630008_630965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150476532.1|630961_633208_-	Hsp70 family protein	NA	A0A1V0SH73	Hokovirus	26.5	2.5e-17
WP_150476533.1|633258_634887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055528766.1|634883_636884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150476534.1|637126_637348_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_150476535.1|637348_637696_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B3AZE5	Gordonia_phage	45.2	3.0e-18
WP_167532661.1|637695_637932_-|transposase	transposase	transposase	NA	NA	NA	NA
639793:639812	attR	CCGCCTTCGGCGTCGTCTTC	NA	NA	NA	NA
