The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044060	Aeromonas veronii strain FDAARGOS_632 chromosome, complete genome	4559061	363844	416855	4559061	protease,holin,terminase,plate,tail,lysis,head,capsid,integrase,portal	Aeromonas_virus(21.21%)	66	379734:379755	416856:416877
WP_005337529.1|363844_364327_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_100646165.1|364625_364997_+	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_005337525.1|364996_365869_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_139123806.1|366106_366982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388867.1|367127_368318_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005359699.1|368424_368928_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_005350890.1|368921_369440_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_150388868.1|369467_371669_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_005350892.1|371773_373537_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.2e-56
WP_150388869.1|373536_374532_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005347033.1|374653_374842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388870.1|374838_375588_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005337448.1|375800_376445_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_150388871.1|376572_378426_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_031227442.1|378625_379180_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
379734:379755	attL	TGTCCACATTTGATCCACACAG	NA	NA	NA	NA
WP_150388872.1|379757_380918_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	49.3	1.5e-98
WP_150388873.1|380917_381409_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	47.9	3.3e-31
WP_150388874.1|381421_383857_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	42.1	3.2e-127
WP_019445431.1|383853_383985_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_150388875.1|383993_384278_-|tail	phage tail assembly protein	tail	R4JJY8	Burkholderia_phage	56.6	3.7e-19
WP_019445429.1|384355_384874_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.0	3.4e-50
WP_150388876.1|384883_386062_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	59.8	7.2e-133
WP_150388877.1|386073_386283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388878.1|386279_386696_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_150388879.1|387937_389353_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	45.7	2.1e-33
WP_108542405.1|389352_389754_-	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	51.9	2.5e-29
WP_150388880.1|389764_390646_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	50.9	4.2e-69
WP_150388881.1|390642_391002_-|plate	baseplate assembly protein	plate	E5E3R0	Burkholderia_phage	50.0	6.0e-22
WP_150388882.1|390998_391550_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	39.1	4.0e-25
WP_150388883.1|391690_392668_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_150388884.1|392812_393616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150388885.1|393681_394146_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	43.7	2.3e-21
WP_139746577.1|394127_394598_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	50.4	9.9e-33
WP_150388886.1|394705_395179_-|lysis	phage lysis regulatory protein LysB	lysis	E5G6N2	Salmonella_phage	35.1	6.5e-08
WP_150388887.1|395189_395990_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	53.9	5.5e-68
WP_013723873.1|395986_396328_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_071911234.1|396324_396696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150388888.1|396705_396936_-	conjugal transfer protein TraR	NA	U3PFL5	Vibrio_phage	39.1	8.5e-06
WP_005352059.1|396964_397168_-|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	57.6	6.8e-15
WP_150388889.1|397167_397644_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	51.9	6.5e-32
WP_150388890.1|397752_398514_-|terminase	terminase	terminase	A4PE31	Ralstonia_virus	45.1	2.6e-43
WP_110303011.1|398523_399582_-|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	57.4	5.5e-108
WP_139746584.1|399594_400398_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	46.6	2.8e-59
WP_150388891.1|400547_402314_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	68.9	3.3e-238
WP_150388892.1|402313_403318_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	56.5	5.3e-108
WP_111809542.1|403705_404086_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_150388893.1|404169_405795_-	MCR-3-related phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_150390505.1|406153_406708_+	cytochrome B	NA	NA	NA	NA	NA
WP_150388894.1|407354_409664_-	replication endonuclease	NA	A5X9G4	Aeromonas_virus	72.2	0.0e+00
WP_150388895.1|409660_409918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139411911.1|409914_410226_-	hypothetical protein	NA	A5X9G2	Aeromonas_virus	65.7	1.5e-29
WP_150388896.1|410203_410404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150388897.1|410400_410607_-	hypothetical protein	NA	A5X9G1	Aeromonas_virus	66.7	3.7e-16
WP_150388898.1|410603_410804_-	hypothetical protein	NA	A5X9G0	Aeromonas_virus	50.8	4.6e-08
WP_150388899.1|410800_411061_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058056131.1|411063_411252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058056132.1|411317_411770_-	hypothetical protein	NA	A5X9F8	Aeromonas_virus	54.3	5.4e-36
WP_005351998.1|411819_412044_-	ogr/Delta-like zinc finger family protein	NA	E5E3T8	Burkholderia_phage	48.5	1.1e-10
WP_150388900.1|412052_412568_-	hypothetical protein	NA	A5X9F7	Aeromonas_virus	42.1	3.2e-24
WP_041214936.1|412601_412964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150388901.1|412974_413166_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_150390506.1|413706_414129_+	S24 family peptidase	NA	A0A1I9KG86	Aeromonas_phage	57.3	3.1e-38
WP_150388902.1|414178_414490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388903.1|414470_414731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150388904.1|414810_415737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150388905.1|415796_416855_+|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	58.0	1.4e-111
416856:416877	attR	TGTCCACATTTGATCCACACAG	NA	NA	NA	NA
>prophage 2
NZ_CP044060	Aeromonas veronii strain FDAARGOS_632 chromosome, complete genome	4559061	519294	529877	4559061	tRNA,protease	Bacillus_phage(42.86%)	11	NA	NA
WP_150388956.1|519294_520620_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	3.0e-18
WP_150388957.1|520641_521352_-	two-component system response regulator RstA	NA	W8CYM9	Bacillus_phage	31.0	4.2e-27
WP_005337113.1|522202_523057_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.9	4.6e-28
WP_005300025.1|523174_523393_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005337111.1|523622_523940_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	1.4e-14
WP_005337110.1|523999_526255_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	2.7e-168
WP_005300033.1|526323_526542_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005351203.1|526610_527327_-	arginyltransferase	NA	NA	NA	NA	NA
WP_064338142.1|527323_528031_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_064338141.1|528050_528521_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_064338140.1|528629_529877_-	response regulator	NA	A0A127AWB9	Bacillus_phage	32.2	2.5e-14
>prophage 3
NZ_CP044060	Aeromonas veronii strain FDAARGOS_632 chromosome, complete genome	4559061	2523948	2581125	4559061	terminase,holin,plate,tail,tRNA,head,integrase,capsid,portal	Enterobacteria_phage(20.45%)	78	2535591:2535610	2585758:2585777
WP_123172343.1|2523948_2525673_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_139461080.1|2525763_2526444_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	26.8	8.4e-09
WP_005335781.1|2526475_2527108_-	TIGR04219 family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_005335782.1|2527203_2527653_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_064341661.1|2527743_2528493_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_005335785.1|2528510_2528939_-	DUF2753 family protein	NA	NA	NA	NA	NA
WP_150389637.1|2529224_2529872_+	CatB-related O-acetyltransferase	NA	NA	NA	NA	NA
WP_123172340.1|2529966_2530674_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_150389638.1|2530858_2532463_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_013723462.1|2532581_2532881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150389639.1|2533018_2534578_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	56.2	4.1e-35
WP_150389640.1|2534641_2535694_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2535591:2535610	attL	TCCAGCATGGGGGCGATGGA	NA	NA	NA	NA
WP_150389641.1|2535784_2536870_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MDN5	Escherichia_phage	67.7	8.4e-144
WP_150389642.1|2536866_2537175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389643.1|2537375_2537750_+	helix-turn-helix domain-containing protein	NA	A0A1I9KF60	Aeromonas_phage	43.4	9.0e-21
WP_150389644.1|2537764_2538181_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_150389645.1|2538191_2538854_-	hypothetical protein	NA	U5P0I1	Shigella_phage	33.3	3.1e-16
WP_150389646.1|2539338_2540796_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	30.6	5.4e-21
WP_150389647.1|2540795_2541449_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	47.7	1.7e-46
WP_150389648.1|2541439_2542495_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	56.6	2.6e-105
WP_150389649.1|2542487_2542898_-	hypothetical protein	NA	Q8W616	Enterobacteria_phage	48.5	1.9e-27
WP_150389650.1|2542902_2543418_-|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	51.5	1.1e-32
WP_150389651.1|2543417_2544485_-|plate	baseplate protein	plate	M1FN92	Enterobacteria_phage	48.7	1.2e-86
WP_150389652.1|2544481_2545765_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	38.1	6.4e-74
WP_150389653.1|2545767_2547627_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	64.8	4.2e-151
WP_150389654.1|2547776_2548052_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	48.3	2.9e-16
WP_150389655.1|2548048_2548405_-|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	69.5	1.7e-45
WP_150389656.1|2548405_2549908_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	55.3	5.8e-143
WP_150389657.1|2549907_2550117_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	69.0	4.0e-10
WP_150389658.1|2550799_2551321_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	53.7	4.4e-42
WP_150389659.1|2551335_2551701_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_150389660.1|2551697_2552018_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	42.5	3.1e-14
WP_150389661.1|2552020_2552509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389662.1|2552568_2553846_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	65.0	2.5e-147
WP_150389663.1|2553912_2554851_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	54.0	8.4e-84
WP_150389664.1|2554838_2556086_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	62.3	7.6e-149
WP_150389665.1|2556085_2556271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389666.1|2556264_2557986_-|terminase	terminase large subunit	terminase	M1FN87	Enterobacteria_phage	73.5	4.3e-259
WP_150389667.1|2557995_2558481_-|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	57.1	5.6e-47
WP_150389668.1|2558583_2558955_-	HNH endonuclease	NA	S5FKR6	Shigella_phage	48.7	4.4e-28
WP_150389669.1|2559043_2559586_-	DUF2514 family protein	NA	A0A059VF51	Pseudomonas_phage	71.8	1.4e-06
WP_150389670.1|2559582_2560101_-	glycoside hydrolase family protein	NA	V5YSX1	Pseudomonas_phage	76.0	5.5e-69
WP_150389671.1|2560087_2560411_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	53.5	1.3e-23
WP_150389672.1|2560683_2561466_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150389673.1|2561652_2562201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389674.1|2562218_2562422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389675.1|2562431_2562629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389676.1|2562832_2563087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389677.1|2563104_2563368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389678.1|2563596_2564286_-	hypothetical protein	NA	R9VWB9	Serratia_phage	59.3	1.7e-70
WP_150389679.1|2564413_2564719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150389680.1|2564690_2565380_-|integrase	tyrosine-type recombinase/integrase	integrase	K4K327	Caulobacter_virus	29.7	1.0e-09
WP_150389681.1|2565733_2566183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150390561.1|2566209_2566752_-	antitermination protein	NA	NA	NA	NA	NA
WP_150389682.1|2566838_2567195_-	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	57.8	2.8e-24
WP_150389683.1|2567191_2568181_-	DUF968 domain-containing protein	NA	R9TRM9	Vibrio_phage	32.8	1.8e-36
WP_150389684.1|2568177_2568444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389685.1|2568433_2568742_-	DUF3283 family protein	NA	NA	NA	NA	NA
WP_150389686.1|2568910_2569534_-	3'-5' exoribonuclease	NA	A0A1I9KF44	Aeromonas_phage	46.4	4.2e-39
WP_150389687.1|2569530_2570337_-	Rha family transcriptional regulator	NA	A0A248SL11	Klebsiella_phage	44.4	2.1e-27
WP_150389688.1|2570383_2570767_-	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	51.1	2.3e-19
WP_150389689.1|2570868_2571075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389690.1|2571074_2571302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389691.1|2571298_2571820_-	hypothetical protein	NA	I6NVL3	Burkholderia_virus	70.3	6.7e-06
WP_150389692.1|2571816_2572077_-	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	50.0	1.8e-12
WP_150389693.1|2572076_2572346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150390562.1|2572348_2572801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389694.1|2572811_2573876_-	hypothetical protein	NA	A0A1I9KG10	Aeromonas_phage	46.8	2.1e-30
WP_150389696.1|2573868_2574072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389697.1|2574064_2575063_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	43.1	1.5e-46
WP_150389699.1|2575131_2575638_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_150389701.1|2575621_2575870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150389703.1|2575976_2576660_+	hypothetical protein	NA	K7P850	Enterobacteria_phage	32.9	1.1e-16
WP_150389704.1|2576683_2577472_-	hypothetical protein	NA	Q8H9M0	Vibrio_phage	28.4	1.5e-09
WP_150389706.1|2578602_2578824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150389708.1|2578859_2579189_+	hypothetical protein	NA	Q6JII5	Burkholderia_virus	41.4	6.1e-13
WP_150389709.1|2579185_2579809_+	hypothetical protein	NA	A0A1I9KF89	Aeromonas_phage	73.4	2.5e-55
WP_150389711.1|2579805_2581125_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.0	5.4e-52
2585758:2585777	attR	TCCAGCATGGGGGCGATGGA	NA	NA	NA	NA
>prophage 4
NZ_CP044060	Aeromonas veronii strain FDAARGOS_632 chromosome, complete genome	4559061	2676334	2682625	4559061		Bacillus_thuringiensis_phage(100.0%)	6	NA	NA
WP_150389772.1|2676334_2677282_+	DUF218 domain-containing protein	NA	Q56AS0	Bacillus_thuringiensis_phage	100.0	2.6e-24
WP_150389773.1|2677366_2677981_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	98.0	1.5e-113
WP_005354955.1|2677998_2678478_-	hypothetical protein	NA	Q56AR5	Bacillus_thuringiensis_phage	98.7	3.0e-37
WP_005335957.1|2678654_2679671_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	99.7	1.3e-191
WP_150389775.1|2679852_2680572_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	94.1	3.3e-128
WP_150389777.1|2680558_2682625_-	GNAT family N-acetyltransferase	NA	Q56AQ2	Bacillus_thuringiensis_phage	91.2	2.3e-94
>prophage 5
NZ_CP044060	Aeromonas veronii strain FDAARGOS_632 chromosome, complete genome	4559061	3658515	3669629	4559061		Phage_NCTB(16.67%)	9	NA	NA
WP_019446506.1|3658515_3659337_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	24.0	4.6e-09
WP_150390169.1|3659465_3659963_+	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	27.7	9.8e-07
WP_005340085.1|3660118_3660295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021231596.1|3660801_3662079_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	39.8	7.1e-41
WP_150390170.1|3662295_3665991_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.3	4.3e-22
WP_005340088.1|3666222_3667119_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.3	7.9e-39
WP_139740289.1|3667190_3667748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150390171.1|3667740_3668964_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_150390172.1|3668960_3669629_-	response regulator	NA	W8CYM9	Bacillus_phage	33.3	7.5e-26
>prophage 6
NZ_CP044060	Aeromonas veronii strain FDAARGOS_632 chromosome, complete genome	4559061	4125272	4134399	4559061		Indivirus(33.33%)	8	NA	NA
WP_150390331.1|4125272_4128095_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	30.2	1.5e-43
WP_150390332.1|4128146_4128431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005338884.1|4128755_4130009_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.2	3.9e-100
WP_005338880.1|4130173_4130623_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_150390333.1|4130720_4131830_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.5	5.2e-48
WP_150390334.1|4131885_4132539_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	37.3	3.5e-20
WP_021230382.1|4132688_4133798_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.5	2.1e-65
WP_005338866.1|4133928_4134399_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	5.1e-29
