The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044069	Vibrio vulnificus strain FDAARGOS_663 chromosome 2, complete sequence	3249353	755622	762676	3249353		Faustovirus(16.67%)	9	NA	NA
WP_013572350.1|755622_756837_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.1	2.2e-31
WP_011078536.1|756880_757264_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	2.0e-52
WP_011149601.1|757336_757660_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.3	1.8e-25
WP_017419976.1|757720_758236_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_017419977.1|758257_760111_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.0	5.7e-108
WP_011078532.1|760122_760461_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011078531.1|760541_760736_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_017419979.1|760888_762187_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.1	1.3e-34
WP_017419980.1|762250_762676_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.6	6.6e-20
>prophage 2
NZ_CP044069	Vibrio vulnificus strain FDAARGOS_663 chromosome 2, complete sequence	3249353	841556	848264	3249353		Staphylococcus_phage(50.0%)	7	NA	NA
WP_017420849.1|841556_842696_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	3.7e-65
WP_080586437.1|842708_843977_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.0	3.0e-100
WP_011149678.1|844177_844627_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017420851.1|844646_845753_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2I2L4R9	Orpheovirus	34.2	6.5e-43
WP_017420852.1|845754_846411_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.5	8.1e-33
WP_026050425.1|846508_847618_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	40.4	2.3e-64
WP_011078424.1|847793_848264_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	2.2e-32
>prophage 3
NZ_CP044069	Vibrio vulnificus strain FDAARGOS_663 chromosome 2, complete sequence	3249353	1116644	1180057	3249353	transposase,integrase,protease	Bacillus_phage(25.0%)	41	1135790:1135822	1176133:1176165
WP_061778578.1|1116644_1117982_+|transposase	IS4-like element ISVvu3 family transposase	transposase	NA	NA	NA	NA
WP_017420313.1|1119103_1120171_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017420312.1|1120170_1123284_+	vibriobactin export RND transporter permease subunit VexH	NA	NA	NA	NA	NA
WP_017420311.1|1123344_1123926_-	porin family protein	NA	NA	NA	NA	NA
WP_017420310.1|1124069_1124408_+	DUF1244 domain-containing protein	NA	NA	NA	NA	NA
WP_017420309.1|1124510_1125596_-	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_011080950.1|1125725_1126187_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017420308.1|1126517_1129565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017420307.1|1129621_1130488_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_011080947.1|1130678_1131104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017420306.1|1131170_1131473_-	MGMT family protein	NA	NA	NA	NA	NA
WP_017420305.1|1131623_1132367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017420304.1|1132491_1134465_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.5	1.4e-08
WP_017420303.1|1134834_1135458_+	endonuclease	NA	NA	NA	NA	NA
WP_017420302.1|1135460_1137326_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1135790:1135822	attL	GGCACTTATTCCGAAGCATACGTTTAAGGGCAA	NA	NA	NA	NA
WP_017420301.1|1137291_1138389_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_017420300.1|1138392_1138701_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020480147.1|1138802_1139339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017420298.1|1139341_1140727_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_017420297.1|1140850_1143307_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	24.9	5.6e-10
WP_017420296.1|1143382_1144714_+	multidrug transporter	NA	NA	NA	NA	NA
WP_017420295.1|1144867_1146358_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	31.6	8.8e-27
WP_017420294.1|1146357_1148103_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001290352.1|1148270_1148981_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	56.0	1.5e-72
WP_000205487.1|1148977_1149457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017420293.1|1149622_1150615_+	membrane protein	NA	NA	NA	NA	NA
WP_017420292.1|1150833_1152597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017420291.1|1152612_1152840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017420290.1|1152924_1154136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017420289.1|1154138_1155854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016732.1|1155857_1157035_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	65.5	3.9e-118
WP_017420286.1|1157094_1157601_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_115173856.1|1157750_1158161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017420284.1|1158560_1160651_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.9	5.7e-48
WP_017420283.1|1160653_1162018_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017420282.1|1162022_1164131_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	31.5	1.7e-52
WP_017420281.1|1164342_1164870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150355168.1|1164881_1175549_+	hypothetical protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	36.7	9.8e-19
WP_017428825.1|1176385_1177570_+	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
1176133:1176165	attR	GGCACTTATTCCGAAGCATACGTTTAAGGGCAA	NA	NA	NA	NA
WP_026050782.1|1178003_1179068_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017428827.1|1179064_1180057_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 4
NZ_CP044069	Vibrio vulnificus strain FDAARGOS_663 chromosome 2, complete sequence	3249353	2822853	2834003	3249353	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_039470155.1|2822853_2825436_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.1	1.7e-78
WP_038964353.1|2825616_2826078_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_039470153.1|2826187_2827237_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.3	1.8e-111
WP_017420280.1|2827369_2827873_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	43.3	3.1e-24
WP_026050395.1|2827956_2830518_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.2	1.3e-30
WP_017420278.1|2830593_2831586_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.8	1.5e-35
WP_049797988.1|2831666_2832563_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	34.1	2.0e-13
WP_017420276.1|2832606_2833233_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.4	1.8e-37
WP_017420275.1|2833235_2834003_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	1.1e-68
