The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044089	Bordetella bronchiseptica strain FDAARGOS_634 chromosome, complete genome	5116077	3017575	3094030	5116077	head,integrase,terminase,capsid,tail,protease,portal,tRNA	Pseudomonas_phage(16.67%)	75	3055419:3055469	3096851:3096901
WP_003820400.1|3017575_3017890_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_150348982.1|3017979_3023169_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_033459775.1|3023165_3025334_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_003812866.1|3025353_3027702_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.9e-164
WP_003820402.1|3027706_3029026_+	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_003820404.1|3029044_3030718_+	MCE family protein	NA	NA	NA	NA	NA
WP_004567487.1|3030722_3031391_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_003820408.1|3031547_3035369_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003812857.1|3035622_3036768_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|3036916_3037846_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_033464799.1|3037842_3038931_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003812849.1|3038927_3039731_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.0e-13
WP_003812846.1|3039727_3040459_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	5.9e-08
WP_010931108.1|3040516_3041806_-	MFS transporter	NA	NA	NA	NA	NA
WP_003820412.1|3041902_3042505_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150348983.1|3042744_3045720_+	autotransporter BapC	NA	NA	NA	NA	NA
WP_003820413.1|3045782_3047021_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	30.5	9.0e-25
WP_003812839.1|3047046_3047385_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_150348984.1|3048092_3048359_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_033465833.1|3048465_3049968_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_003812834.1|3050303_3050501_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003812832.1|3050516_3050876_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_010926359.1|3050950_3051973_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.6	1.0e-26
WP_150348985.1|3051985_3054403_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003812826.1|3054408_3054750_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	2.8e-13
WP_003812822.1|3054808_3055219_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
3055419:3055469	attL	CTTGCATGGGGTGCAAGGGGTCGCGAGTTCGAATCCCGCCGTCCCGACCAG	NA	NA	NA	NA
WP_033839544.1|3055543_3056692_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	61.8	2.9e-134
WP_150348986.1|3056951_3057611_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	43.5	3.2e-37
WP_050484706.1|3059154_3059625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150349175.1|3059860_3060220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348987.1|3060252_3060531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348988.1|3060527_3061349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348989.1|3061345_3062293_-	hypothetical protein	NA	A0A0U4JP11	Pseudomonas_phage	42.6	2.3e-41
WP_126438240.1|3062295_3062523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126438241.1|3062842_3063082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126438242.1|3063123_3063741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068957830.1|3063948_3064191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348990.1|3064225_3064627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150348991.1|3064682_3065138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050489230.1|3065451_3066183_-	helix-turn-helix transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	35.8	9.3e-30
WP_150348992.1|3066283_3066556_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033466657.1|3066661_3067192_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	32.9	2.0e-10
WP_150348993.1|3067486_3067789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150348994.1|3067785_3068274_+	DUF1364 family protein	NA	NA	NA	NA	NA
WP_150348995.1|3068270_3069461_+	replication protein	NA	K7PGT1	Enterobacteria_phage	43.2	1.3e-12
WP_150348996.1|3069457_3070852_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	37.6	5.5e-71
WP_150348997.1|3071084_3071564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349176.1|3071635_3071965_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	55.1	2.4e-25
WP_150348998.1|3071964_3072618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150348999.1|3072919_3073246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150349000.1|3073405_3074194_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	73.4	8.0e-112
WP_150349001.1|3074569_3074950_+	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	51.2	5.9e-12
WP_150349002.1|3075066_3075549_+|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	61.0	1.8e-50
WP_150349003.1|3075550_3077305_+|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	70.4	4.0e-252
WP_150349004.1|3077301_3078600_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	63.1	2.1e-149
WP_150349005.1|3078611_3079481_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	61.3	1.8e-80
WP_150349006.1|3079491_3080700_+|capsid	phage major capsid protein	capsid	A0A2H4PI18	Pseudomonas_phage	53.1	5.4e-107
WP_150349007.1|3080758_3081001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349008.1|3081005_3081335_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H2BDB3	Pseudomonas_virus	61.1	8.4e-23
WP_150349177.1|3081334_3081709_+|head,tail	head-tail adaptor protein	head,tail	H2BDB4	Pseudomonas_virus	49.2	8.4e-27
WP_150349009.1|3081711_3081930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349010.1|3081926_3082412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349011.1|3082411_3082783_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_150349012.1|3082673_3083342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349013.1|3083351_3083684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349014.1|3083722_3084013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349015.1|3084025_3087007_+|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	32.3	3.8e-29
WP_150349016.1|3087008_3087356_+	hypothetical protein	NA	Q2NPH3	Xanthomonas_virus	34.4	1.9e-09
WP_150349017.1|3087357_3087834_+	DUF1833 family protein	NA	I7GYA2	Xanthomonas_virus	25.2	2.4e-10
WP_150349018.1|3087833_3088220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349178.1|3088258_3092053_+	hypothetical protein	NA	A5A3R1	Burkholderia_phage	25.2	1.4e-47
WP_150349019.1|3092057_3092834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349020.1|3092830_3093220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150349021.1|3093285_3093705_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	54.3	5.7e-32
WP_150349179.1|3093724_3094030_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	41.8	1.2e-07
3096851:3096901	attR	CTTGCATGGGGTGCAAGGGGTCGCGAGTTCGAATCCCGCCGTCCCGACCAG	NA	NA	NA	NA
>prophage 2
NZ_CP044089	Bordetella bronchiseptica strain FDAARGOS_634 chromosome, complete genome	5116077	4041868	4049527	5116077	tRNA	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_003811022.1|4041868_4042753_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
WP_003816528.1|4042770_4043460_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	3.2e-32
WP_033459814.1|4043534_4044293_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.1e-68
WP_003811015.1|4044418_4045066_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003811013.1|4045309_4046350_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.6	9.3e-92
WP_003811011.1|4046484_4047777_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
WP_003816534.1|4047982_4049008_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003811007.1|4049143_4049527_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
