The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	0	23788	2210718		Tetraselmis_virus(25.0%)	22	NA	NA
WP_000100665.1|695_1676_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_000771945.1|1721_2081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270172.1|2084_4370_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_001016380.1|4393_5053_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000389617.1|5209_6412_+	MFS transporter	NA	NA	NA	NA	NA
WP_000192462.1|6429_6882_+	universal stress protein	NA	NA	NA	NA	NA
WP_000570241.1|7049_7898_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_001006190.1|7976_8873_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000171839.1|8997_9753_+	peptidase	NA	NA	NA	NA	NA
WP_000598178.1|9749_10679_+	serine hydrolase	NA	NA	NA	NA	NA
WP_000931877.1|10713_11088_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_000246708.1|11188_13501_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	32.8	4.6e-115
WP_000904560.1|13685_14780_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000255478.1|14850_15333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000451609.1|15446_17867_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.3	1.8e-61
WP_000657514.1|17995_18589_-	signal peptidase I	NA	NA	NA	NA	NA
WP_001092527.1|18604_19498_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_000448289.1|19608_19920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949954.1|19922_20465_+	CvpA family protein	NA	NA	NA	NA	NA
WP_001060323.1|20549_22889_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.6	7.4e-20
WP_000446812.1|22892_23393_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_001162959.1|23473_23788_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.3	8.6e-17
>prophage 2
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	27120	32666	2210718		Streptococcus_phage(50.0%)	5	NA	NA
WP_000609585.1|27120_27612_+	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	73.2	1.3e-59
WP_000068665.1|27656_27896_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000812121.1|28065_29010_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_000174846.1|29034_29706_+	DUF1129 family protein	NA	NA	NA	NA	NA
WP_001152944.1|29837_32666_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.0	0.0e+00
>prophage 3
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	35771	39035	2210718		Acinetobacter_phage(33.33%)	9	NA	NA
WP_000883691.1|35771_36386_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	30.7	1.3e-16
WP_001081097.1|36397_36850_+	hypothetical protein	NA	F8WPT6	Bacillus_phage	54.3	2.5e-33
WP_000927756.1|37151_37316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845520.1|37326_37452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000927730.1|37451_37892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033639.1|37904_38075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000511719.1|38087_38318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001868745.1|38590_38683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000926393.1|38735_39035_+	DUF4176 domain-containing protein	NA	A0A1X9I6T6	Streptococcus_phage	52.4	1.5e-18
>prophage 4
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	42478	43918	2210718		Bacillus_phage(100.0%)	1	NA	NA
WP_001053051.1|42478_43918_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	23.1	1.7e-19
>prophage 5
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	50798	53287	2210718		Pandoravirus(50.0%)	3	NA	NA
WP_000505724.1|50798_51806_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	32.6	1.1e-36
WP_000635015.1|51830_52190_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000625941.1|52186_53287_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.5	9.1e-29
>prophage 6
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	61585	71809	2210718		Geobacillus_virus(33.33%)	9	NA	NA
WP_000974899.1|61585_62968_+	HAD-IIB family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	36.5	1.0e-21
WP_000080032.1|63023_63476_-	universal stress protein	NA	NA	NA	NA	NA
WP_000688108.1|63742_64954_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_001133183.1|65079_65865_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_000158740.1|65931_66480_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	36.7	2.8e-23
WP_000153115.1|66526_67492_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_088181614.1|67680_68310_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000390093.1|68320_69151_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_000448266.1|69163_71809_+	pyruvate, phosphate dikinase	NA	A0A2I7QIA2	Vibrio_phage	38.4	3.5e-95
>prophage 7
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	78502	79135	2210718		Bacillus_virus(100.0%)	1	NA	NA
WP_001162767.1|78502_79135_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	31.9	2.2e-19
>prophage 8
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	83785	85168	2210718		Moumouvirus(50.0%)	2	NA	NA
WP_000675692.1|83785_84190_+	cupin domain-containing protein	NA	A0A2P1EMC0	Moumouvirus	49.1	6.1e-23
WP_000191474.1|84454_85168_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	33.8	6.5e-28
>prophage 9
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	93943	96807	2210718		Planktothrix_phage(50.0%)	3	NA	NA
WP_000032379.1|93943_95014_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	1.8e-29
WP_000574037.1|95010_95703_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001200719.1|95751_96807_-	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	27.0	1.3e-16
>prophage 10
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	100405	102082	2210718		Tupanvirus(100.0%)	1	NA	NA
WP_000651245.1|100405_102082_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.4e-20
>prophage 11
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	108196	119020	2210718	transposase	Bacillus_phage(50.0%)	8	NA	NA
WP_000516681.1|108196_108886_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	4.4e-29
WP_000791116.1|108875_110381_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.2	3.2e-24
WP_001203682.1|110529_111009_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_000074512.1|111008_112184_+	chromosome replication initiation protein	NA	NA	NA	NA	NA
WP_000843626.1|112180_113083_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	31.8	1.1e-27
WP_000244022.1|113130_114441_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000564846.1|114625_115759_+|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_000089135.1|115921_119020_+	DEAD/DEAH box helicase family protein	NA	A0A0S3J0L8	Anticarsia_gemmatalis_multiple_nucleopolyhedrovirus	26.0	4.5e-41
>prophage 12
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	133524	137490	2210718		uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_000167813.1|133524_134499_+	nucleoside-triphosphate diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.1	2.2e-10
WP_001007722.1|134480_135002_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000560703.1|134998_135472_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_032458592.1|135461_136202_+	site-specific tyrosine recombinase XerD	NA	NA	NA	NA	NA
WP_000351869.1|136201_136909_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.1	9.1e-06
WP_000221690.1|136905_137490_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.1	1.7e-10
>prophage 13
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	145717	146308	2210718	protease	Agrobacterium_phage(100.0%)	1	NA	NA
WP_000613483.1|145717_146308_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	54.6	3.7e-53
>prophage 14
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	151231	163514	2210718		Streptococcus_phage(83.33%)	15	NA	NA
WP_001185981.1|151231_151996_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.3	4.4e-14
WP_000178146.1|151995_152706_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.7e-18
WP_001144248.1|152724_153384_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	55.6	5.2e-64
WP_000715592.1|155024_155660_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
WP_000364565.1|155679_156543_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.7	7.3e-74
WP_000358198.1|156572_156899_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_001866320.1|156904_157768_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	3.7e-110
WP_011058366.1|157743_157905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011058365.1|157889_157994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000603277.1|158037_158673_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001167085.1|159965_160514_+	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
WP_000232156.1|160576_161758_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.6	7.0e-168
WP_000966773.1|161812_162289_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.3	1.0e-37
WP_000287944.1|162290_162647_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	71.8	1.5e-41
WP_000767484.1|162686_163514_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.0	4.3e-124
>prophage 15
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	167840	169838	2210718	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_000136757.1|167840_169838_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.6	1.3e-97
>prophage 16
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	184159	185539	2210718		Tupanvirus(100.0%)	1	NA	NA
WP_000073770.1|184159_185539_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	37.2	2.6e-33
>prophage 17
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	189032	198615	2210718	transposase	Indivirus(16.67%)	8	NA	NA
WP_000587174.1|189032_189749_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.5	5.6e-19
WP_000494347.1|189750_190584_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_000721136.1|190635_191439_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	38.4	1.5e-20
WP_000231579.1|191604_194055_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.4	8.7e-88
WP_000546859.1|194136_195852_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	30.8	3.7e-37
WP_088181631.1|195900_197135_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.0	3.4e-64
WP_000639447.1|197316_197670_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_000280435.1|197730_198615_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.9	7.1e-24
>prophage 18
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	208208	209664	2210718		Organic_Lake_phycodnavirus(100.0%)	2	NA	NA
WP_000436149.1|208208_208997_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.0	4.9e-08
WP_000959468.1|208983_209664_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	29.8	2.6e-10
>prophage 19
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	214918	215956	2210718		Erwinia_phage(100.0%)	1	NA	NA
WP_011058362.1|214918_215956_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	48.5	1.4e-47
>prophage 20
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	226274	228505	2210718		Bacillus_virus(50.0%)	3	NA	NA
WP_001114602.1|226274_227096_+	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	30.2	2.1e-22
WP_001873433.1|227092_227680_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_000424353.1|227803_228505_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.3	6.4e-20
>prophage 21
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	232044	239839	2210718		Lactococcus_phage(25.0%)	7	NA	NA
WP_000659926.1|232044_234450_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.9	1.1e-90
WP_000238456.1|234452_234920_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.1	2.6e-41
WP_032458565.1|235003_236392_-	amino acid permease	NA	NA	NA	NA	NA
WP_032458564.1|236520_237447_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	52.1	4.4e-85
WP_001116199.1|237575_237968_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_000159251.1|238055_238730_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000451355.1|238996_239839_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	37.2	3.1e-45
>prophage 22
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	247315	248056	2210718		Planktothrix_phage(100.0%)	1	NA	NA
WP_000818887.1|247315_248056_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.3	5.2e-36
>prophage 23
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	277497	278970	2210718		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000416074.1|277497_278970_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.5	2.7e-76
>prophage 24
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	285664	287929	2210718		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000197731.1|285664_287929_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	37.8	3.3e-09
>prophage 25
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	296277	300597	2210718		Helicobacter_phage(33.33%)	4	NA	NA
WP_000540259.1|296277_298086_+	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	29.6	4.3e-44
WP_000818341.1|298093_299203_+	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	34.8	5.9e-36
WP_000005640.1|299311_299653_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_000600896.1|299742_300597_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	2.5e-26
>prophage 26
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	305632	308237	2210718		Indivirus(50.0%)	3	NA	NA
WP_000661823.1|305632_306457_+	LicD family protein	NA	A0A1V0SD50	Indivirus	31.8	1.3e-08
WP_000981011.1|306456_307179_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000972791.1|307178_308237_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SLA7	Klosneuvirus	25.2	1.3e-16
>prophage 27
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	326107	327602	2210718		Staphylococcus_phage(100.0%)	2	NA	NA
WP_150352931.1|326107_327043_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	50.0	2.7e-34
WP_000596036.1|327035_327602_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	40.9	6.3e-34
>prophage 28
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	332763	335555	2210718		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000471519.1|332763_333789_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	1.7e-13
WP_000719460.1|333804_334737_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000018231.1|334760_335555_-	ABC transporter ATP-binding protein	NA	M1HXU1	Acanthocystis_turfacea_Chlorella_virus	24.2	3.9e-05
>prophage 29
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	342406	350696	2210718		Streptococcus_phage(66.67%)	9	NA	NA
WP_000691023.1|342406_342937_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.0	1.4e-11
WP_001125940.1|342976_343177_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124839.1|343234_343594_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000721255.1|343835_345980_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	67.4	1.4e-259
WP_001037599.1|346114_347272_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.7	6.0e-140
WP_000707048.1|347271_347949_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.4	5.3e-88
WP_001195725.1|348042_349110_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_001269904.1|349110_350277_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.4	7.1e-40
WP_000024629.1|350360_350696_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	39.4	1.5e-19
>prophage 30
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	355424	356603	2210718		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000101231.1|355424_356603_+	CapA family protein	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	28.3	4.8e-36
>prophage 31
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	360980	362051	2210718		Halovirus(100.0%)	1	NA	NA
WP_001085243.1|360980_362051_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	30.6	1.3e-43
>prophage 32
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	365153	365864	2210718		Planktothrix_phage(100.0%)	1	NA	NA
WP_000210674.1|365153_365864_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	1.6e-34
>prophage 33
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	370984	371977	2210718		Streptococcus_phage(100.0%)	1	NA	NA
WP_001044158.1|370984_371977_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	49.2	5.0e-26
>prophage 34
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	383839	393524	2210718	tRNA	Bacillus_phage(40.0%)	8	NA	NA
WP_001238960.1|383839_385048_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.5	3.3e-40
WP_001279326.1|385058_386927_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.6	9.6e-63
WP_000586885.1|386923_387397_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000323504.1|387463_389203_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.5	1.7e-37
WP_001227900.1|389207_390977_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	5.3e-55
WP_000870956.1|391017_391527_-	membrane protein	NA	NA	NA	NA	NA
WP_000200439.1|391694_393044_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000594940.1|393113_393524_+	peptide deformylase	NA	A0A2I7QLT9	Vibrio_phage	35.8	2.7e-10
>prophage 35
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	413582	416440	2210718	protease	Bacillus_phage(33.33%)	4	NA	NA
WP_000158595.1|413582_414422_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.9	2.6e-84
WP_000166043.1|414501_414996_+	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	35.3	6.3e-22
WP_001189822.1|415013_415184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918415.1|415213_416440_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.0	6.2e-135
>prophage 36
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	420409	426497	2210718	protease,transposase	Enterobacteria_phage(50.0%)	6	NA	NA
WP_000002813.1|420409_422518_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.6	4.8e-119
WP_001287288.1|422950_423451_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_001196973.1|423514_423880_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_000345322.1|424014_425184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011058351.1|425170_425287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123957737.1|425391_426497_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.5	5.3e-69
>prophage 37
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	430539	433812	2210718		Bacillus_phage(100.0%)	1	NA	NA
WP_001876742.1|430539_433812_+	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	39.4	7.2e-05
>prophage 38
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	441318	442424	2210718	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_141453361.1|441318_442424_-|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
>prophage 39
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	463928	475733	2210718	tRNA	Enterobacteria_phage(40.0%)	11	NA	NA
WP_000622237.1|463928_466127_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	3.5e-72
WP_001868405.1|466196_466295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247520.1|466278_468843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365343.1|468965_469484_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.6e-31
WP_000221657.1|469601_470282_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	31.8	1.9e-08
WP_000365679.1|470385_471069_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000647413.1|471058_471847_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000716832.1|471855_472959_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000676112.1|473017_473887_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.2	2.7e-100
WP_000139158.1|473886_474480_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_000134279.1|474686_475733_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	1.7e-69
>prophage 40
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	485230	489886	2210718		Only_Syngen_Nebraska_virus(50.0%)	4	NA	NA
WP_000006730.1|485230_486886_-	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	2.3e-07
WP_000790865.1|487244_488249_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000587303.1|488261_489125_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000245086.1|489124_489886_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.9	7.0e-12
>prophage 41
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	495715	496123	2210718		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000411550.1|495715_496123_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	54.5	2.0e-34
>prophage 42
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	499723	504431	2210718		Streptococcus_phage(75.0%)	5	NA	NA
WP_001222596.1|499723_500647_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	36.1	1.2e-05
WP_032458524.1|500835_502293_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	51.6	2.8e-110
WP_000565383.1|502298_503030_+	tyrosine-protein phosphatase CpsB	NA	NA	NA	NA	NA
WP_001033073.1|503038_503731_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	48.5	7.2e-48
WP_000197405.1|503741_504431_+	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	51.8	1.9e-61
>prophage 43
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	509557	514874	2210718		Catovirus(66.67%)	5	NA	NA
WP_000420465.1|509557_510541_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.7	8.5e-10
WP_000362087.1|510533_511499_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.2	4.1e-09
WP_001058925.1|511495_512452_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_001093056.1|512448_513849_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_000262516.1|513848_514874_+	N-acetylneuraminate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	37.1	2.0e-33
>prophage 44
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	518680	524694	2210718		Bacillus_virus(66.67%)	4	NA	NA
WP_000682955.1|518680_519334_+	uracil-DNA glycosylase	NA	A0A0S1TKU8	Elephant_endotheliotropic_herpesvirus	42.0	1.0e-35
WP_001021319.1|519399_520038_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_001876675.1|520139_522101_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.1	4.6e-124
WP_000065538.1|522234_524694_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.3	4.2e-98
>prophage 45
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	533263	537493	2210718		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000174081.1|533263_534589_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.6	7.0e-60
WP_000671267.1|534721_535108_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_001068642.1|535213_537493_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	40.8	3.6e-128
>prophage 46
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	544563	545904	2210718		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011058345.1|544563_545904_-	hypothetical protein	NA	A0A1Q1PVY7	Staphylococcus_phage	36.0	4.8e-08
>prophage 47
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	549716	551264	2210718		Vibrio_phage(100.0%)	1	NA	NA
WP_000037479.1|549716_551264_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.0	3.1e-22
>prophage 48
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	556658	561905	2210718		Mycoplasma_phage(50.0%)	7	NA	NA
WP_001133588.1|556658_557222_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	50.0	1.2e-45
WP_000690157.1|557225_558029_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.8	2.3e-21
WP_000358073.1|558030_558393_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000214497.1|558389_558878_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000598027.1|559021_559924_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000184098.1|559972_561127_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.7	4.0e-35
WP_000753812.1|561110_561905_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	25.6	3.3e-12
>prophage 49
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	578110	662956	2210718	terminase,protease,transposase,portal,holin,head,capsid,tail	Streptococcus_phage(71.15%)	88	NA	NA
WP_071659975.1|578110_579382_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_000391861.1|579353_579539_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000154547.1|579592_579943_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000673009.1|580201_580411_-	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	58.5	4.8e-16
WP_086014977.1|580400_581279_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_001176802.1|582049_582274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003047226.1|582273_583398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017646662.1|583830_584427_+	hypothetical protein	NA	A0A1B0RXB3	Streptococcus_phage	27.9	4.6e-11
WP_017646663.1|584588_585131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017646664.1|585192_587148_-	DNA polymerase	NA	E4ZFK1	Streptococcus_phage	86.2	0.0e+00
WP_017646665.1|587196_587364_-	hypothetical protein	NA	E4ZFK2	Streptococcus_phage	56.9	4.3e-07
WP_017646666.1|587382_587946_-	DUF2815 family protein	NA	A0A1B0RXA9	Streptococcus_phage	92.8	1.5e-91
WP_017646667.1|587950_589072_-	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	90.9	3.5e-201
WP_017646668.1|589064_589388_-	hypothetical protein	NA	D0R0B4	Streptococcus_phage	72.9	8.8e-33
WP_017646670.1|589746_592035_+	hypothetical protein	NA	A0A1B0RXC5	Streptococcus_phage	87.9	0.0e+00
WP_024051851.1|592315_592597_+	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	84.9	2.2e-40
WP_017646672.1|592577_593954_+	DEAD/DEAH box helicase	NA	A0A1X9I6B0	Streptococcus_phage	86.7	1.6e-232
WP_017646673.1|593946_594423_+	hypothetical protein	NA	A0A1B0RXB9	Streptococcus_phage	84.2	3.2e-71
WP_017646674.1|594617_594800_+	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	86.7	1.7e-20
WP_017646676.1|595886_596252_+	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	88.4	3.2e-63
WP_017646677.1|596540_596996_+	hypothetical protein	NA	M1Q209	Streptococcus_phage	50.3	1.0e-42
WP_017646678.1|596967_598224_+	DNA modification methylase	NA	A0A1B0RXE5	Streptococcus_phage	90.9	3.0e-225
WP_017646679.1|598220_599501_+	DNA (cytosine-5-)-methyltransferase	NA	M1NSK8	Streptococcus_phage	92.3	2.2e-231
WP_017646680.1|599562_599814_+	hypothetical protein	NA	M1PG57	Streptococcus_phage	59.3	5.8e-16
WP_017646681.1|599815_600265_+	DUF4314 domain-containing protein	NA	A0A1X9I6A3	Streptococcus_phage	67.1	4.1e-20
WP_017646682.1|600313_600787_+|terminase	phage terminase small subunit P27 family	terminase	A0A1X9I6K0	Streptococcus_phage	96.8	1.5e-84
WP_017646683.1|600783_602376_+|terminase	terminase large subunit	terminase	A0A1B0RXJ8	Streptococcus_phage	95.8	6.0e-308
WP_017646684.1|602442_602736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017646685.1|602728_603067_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017646686.1|603136_603340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017646687.1|603408_604704_+|portal	phage portal protein	portal	A0A1B0RXD8	Streptococcus_phage	89.3	8.0e-226
WP_017646688.1|604696_605395_+|protease	Clp protease ClpP	protease	A0A1B0RXE1	Streptococcus_phage	83.6	5.8e-106
WP_017646689.1|605407_606616_+|capsid	phage major capsid protein	capsid	E4ZFM5	Streptococcus_phage	91.3	1.0e-211
WP_017646690.1|606612_606870_+|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	78.8	9.5e-30
WP_017646691.1|606869_607208_+|head,tail	head-tail adaptor protein	head,tail	A0A1B0RXJ6	Streptococcus_phage	70.5	4.3e-38
WP_017646692.1|607200_607569_+	hypothetical protein	NA	Q6DMT7	Streptococcus_phage	62.9	7.0e-34
WP_017646693.1|607577_607904_+	hypothetical protein	NA	M1Q1Z4	Streptococcus_phage	69.4	8.3e-39
WP_017646694.1|607906_608476_+|tail	phage tail protein	tail	A0A1B0RXE2	Streptococcus_phage	93.6	1.5e-96
WP_001249611.1|608487_608907_+	hypothetical protein	NA	A0A1X9I691	Streptococcus_phage	76.3	1.3e-55
WP_017646695.1|609089_612209_+	hypothetical protein	NA	Q6DMT2	Streptococcus_phage	76.7	2.0e-254
WP_017646696.1|612205_612931_+|tail	phage tail protein	tail	Q6DMT1	Streptococcus_phage	57.9	1.4e-81
WP_017646697.1|612930_615846_+	carbamoylsarcosine amidase	NA	Q6DMT0	Streptococcus_phage	64.8	0.0e+00
WP_017646698.1|615858_617715_+	hypothetical protein	NA	Q6DMS9	Streptococcus_phage	73.3	2.5e-257
WP_017646699.1|617732_618137_+|holin	phage holin family protein	holin	D0R0E9	Streptococcus_phage	74.8	3.0e-46
WP_017646700.1|618138_619608_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1X9I678	Streptococcus_phage	78.9	1.8e-226
WP_017646701.1|619717_620119_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_017646702.1|620333_621542_+	recombinase family protein	NA	Q6DMS6	Streptococcus_phage	49.7	1.8e-102
WP_150352935.1|621544_623110_+	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	61.3	2.3e-179
WP_000593347.1|623229_624051_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000895132.1|624151_624766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240708.1|624928_626365_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_000667244.1|626455_627589_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000361440.1|628377_629010_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_000863500.1|629170_629518_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_000639605.1|629519_630635_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	26.8	7.1e-29
WP_000840698.1|630638_631613_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	33.8	1.6e-37
WP_000149079.1|631789_632362_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_000061344.1|632471_633143_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_000192910.1|633117_633954_+	NAD kinase	NA	NA	NA	NA	NA
WP_000667475.1|633950_634835_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_001257093.1|634860_635853_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_000625598.1|635914_636676_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001164946.1|636810_638811_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.7	3.3e-69
WP_001870799.1|638881_639574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162141.1|639844_641185_+	MFS transporter	NA	NA	NA	NA	NA
WP_000481328.1|641388_642372_+	GMP reductase	NA	G3MBI2	Bacillus_virus	75.1	8.1e-138
WP_150352936.1|642627_643209_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000671521.1|643208_644483_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.0	3.3e-30
WP_000051851.1|644581_645370_-	formate transporter	NA	NA	NA	NA	NA
WP_000673640.1|645468_646704_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	51.1	8.3e-63
WP_000766630.1|646727_647330_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	55.2	2.6e-54
WP_001177182.1|647347_648286_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_011058343.1|648315_648459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001117229.1|648434_648617_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_000068109.1|648754_649324_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	54.8	1.7e-50
WP_001028827.1|649358_650438_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_001104948.1|650437_651268_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000998735.1|651260_651857_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_000575546.1|651948_653205_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.7	7.8e-93
WP_000968655.1|653209_654187_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000472259.1|654188_654791_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	40.1	1.1e-20
WP_000826931.1|654802_656524_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.3e-41
WP_000647640.1|656524_658258_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	2.4e-52
WP_000746856.1|658271_658469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088196783.1|658550_659785_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	6.8e-65
WP_000222553.1|659967_661686_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	84.8	2.4e-278
WP_000728786.1|661795_662368_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_000595814.1|662413_662956_-	phosphopantothenoylcysteine decarboxylase	NA	Q9J5A8	Fowlpox_virus	37.0	4.6e-26
>prophage 50
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	667153	667972	2210718		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_001133603.1|667153_667972_+	protein-ADP-ribose hydrolase	NA	A0A2H4UW38	Bodo_saltans_virus	37.6	5.4e-26
>prophage 51
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	675852	677863	2210718		Salicola_phage(50.0%)	2	NA	NA
WP_001165747.1|675852_676191_+	hypothetical protein	NA	A0A248SK58	Salicola_phage	39.1	1.1e-06
WP_000025410.1|676321_677863_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	3.1e-51
>prophage 52
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	682159	684173	2210718		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_001016473.1|682159_683083_+	aspartate carbamoyltransferase catalytic subunit	NA	Q84489	Paramecium_bursaria_Chlorella_virus	31.2	6.3e-23
WP_000826109.1|683096_684173_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.1	1.3e-56
>prophage 53
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	694581	702849	2210718		Mycobacterium_phage(33.33%)	7	NA	NA
WP_001865532.1|694581_698511_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	24.7	2.7e-43
WP_001063012.1|698524_698782_+	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
WP_000140207.1|698886_699249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581833.1|700613_701204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357796.1|701224_701479_+	DUF4176 domain-containing protein	NA	A0A1X9I6T6	Streptococcus_phage	42.1	7.5e-11
WP_000710896.1|701605_702034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001866142.1|702039_702849_+	hypothetical protein	NA	A8AST1	Listeria_phage	32.5	5.2e-05
>prophage 54
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	708173	709913	2210718		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000171904.1|708173_709913_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	32.5	5.2e-63
>prophage 55
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	714185	724895	2210718	transposase	Emiliania_huxleyi_virus(16.67%)	10	NA	NA
WP_000201088.1|714185_714947_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	40.7	1.5e-25
WP_000136509.1|714967_715516_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_000735588.1|715754_716717_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	50.3	3.3e-83
WP_000588576.1|716713_717688_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000614752.1|717684_718446_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	28.6	1.7e-18
WP_000162771.1|718507_719536_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001015240.1|719673_720516_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	32.8	5.0e-27
WP_000564846.1|720635_721769_+|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_000246611.1|721936_724057_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.7	1.1e-102
WP_000120355.1|724193_724895_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	9.2e-35
>prophage 56
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	738646	745741	2210718		Bacillus_virus(40.0%)	6	NA	NA
WP_000852851.1|738646_739450_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.5	1.4e-15
WP_000193363.1|739461_740220_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	4.2e-17
WP_000946330.1|740253_740907_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000859382.1|741052_743602_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.1	2.0e-63
WP_000590620.1|743763_744444_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	7.6e-26
WP_000042580.1|744427_745741_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	29.7	1.1e-07
>prophage 57
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	756190	756943	2210718		Planktothrix_phage(100.0%)	1	NA	NA
WP_000923535.1|756190_756943_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	6.2e-29
>prophage 58
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	762779	764342	2210718		Hokovirus(100.0%)	1	NA	NA
WP_000129872.1|762779_764342_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	4.9e-20
>prophage 59
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	768956	788934	2210718	transposase	Bacillus_virus(33.33%)	18	NA	NA
WP_001152975.1|768956_771416_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.2	5.1e-104
WP_000127487.1|771654_772644_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000036813.1|772764_774135_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024401886.1|774319_775348_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.2	1.7e-40
WP_000060306.1|775516_776473_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000036988.1|776474_777536_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000193235.1|777528_779064_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.9	8.0e-23
WP_001034779.1|779208_780258_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000526762.1|780322_780712_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_000002661.1|781037_781628_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001058331.1|781733_782654_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	35.6	1.1e-32
WP_001274006.1|782722_782956_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001873511.1|783039_783870_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891276.1|783886_784516_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.3	5.6e-31
WP_000120401.1|784525_785167_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000056777.1|785301_785631_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_000564846.1|785809_786943_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_000334314.1|787119_788934_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	36.9	6.4e-96
>prophage 60
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	792584	810791	2210718		Streptomyces_phage(11.11%)	14	NA	NA
WP_000457960.1|792584_795689_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8J9	Streptomyces_phage	28.8	1.1e-114
WP_000312256.1|795833_796202_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000192686.1|796202_796901_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.2e-19
WP_000467138.1|796912_797695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056394.1|797732_798344_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	54.9	2.7e-54
WP_000146565.1|799054_799693_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.4	4.9e-19
WP_000065321.1|799813_800917_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_000168898.1|800916_803709_-	cation-transporting P-type ATPase	NA	M1HK51	Paramecium_bursaria_Chlorella_virus	29.9	7.1e-78
WP_000665410.1|803860_804295_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000621142.1|804294_804759_-	GNAT family N-acetyltransferase	NA	G5DEI8	Salmonella_phage	35.7	1.8e-07
WP_000180005.1|804767_805427_-	HD domain-containing protein	NA	S4W232	Pandoravirus	26.6	1.1e-08
WP_000678300.1|805526_808160_-	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_001019133.1|808406_810239_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
WP_000438314.1|810374_810791_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	40.4	2.8e-23
>prophage 61
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	830456	832214	2210718		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000863368.1|830456_832214_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	1.2e-33
>prophage 62
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	835979	843980	2210718	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_000584913.1|835979_837890_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	4.0e-48
WP_000028893.1|838017_839394_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_000634649.1|839426_840344_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_000143231.1|840356_843980_-	helicase-exonuclease AddAB subunit AddA	NA	A0A068EQC7	Bacillus_phage	23.2	3.4e-16
>prophage 63
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	847380	848283	2210718		Rhodococcus_phage(100.0%)	1	NA	NA
WP_000686759.1|847380_848283_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	33.9	5.9e-34
>prophage 64
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	851414	852455	2210718	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_000365655.1|851414_852455_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.7	1.3e-29
>prophage 65
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	870264	873254	2210718		Catovirus(50.0%)	2	NA	NA
WP_000744293.1|870264_871284_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	28.0	3.6e-19
WP_001880222.1|871295_873254_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	34.0	6.4e-102
>prophage 66
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	883355	884642	2210718		Bacillus_virus(100.0%)	1	NA	NA
WP_000953593.1|883355_884642_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.6	3.2e-17
>prophage 67
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	889552	896237	2210718		Staphylococcus_phage(25.0%)	7	NA	NA
WP_000003955.1|889552_890749_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	64.3	5.8e-138
WP_001872319.1|890933_891869_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_150352939.1|891849_892044_-	DUF3272 family protein	NA	NA	NA	NA	NA
WP_000283819.1|892132_893797_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.9	3.0e-47
WP_001043210.1|893796_894294_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001227823.1|894380_895010_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	9.2e-34
WP_000628861.1|895154_896237_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.3	1.0e-32
>prophage 68
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	901623	912194	2210718	tRNA	Enterococcus_phage(60.0%)	11	NA	NA
WP_000719060.1|901623_901848_+	redoxin NrdH	NA	A0A249XUR7	Enterococcus_phage	47.3	7.8e-12
WP_000053862.1|901925_904085_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	62.9	1.1e-264
WP_000214845.1|904287_905247_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	2.2e-127
WP_000042137.1|905487_906051_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_000977217.1|906135_906897_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_000522957.1|906896_907112_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	43.5	8.0e-06
WP_001866193.1|907156_907444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064638.1|907482_907728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050371.1|907871_908690_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_000232924.1|908777_909494_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000661554.1|909575_912194_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.1	1.8e-62
>prophage 69
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	927153	928296	2210718		Streptococcus_phage(100.0%)	1	NA	NA
WP_000869908.1|927153_928296_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.4	1.9e-45
>prophage 70
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	934119	934728	2210718		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000974719.1|934119_934728_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	55.2	5.2e-58
>prophage 71
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	939743	950988	2210718	tRNA	Streptococcus_phage(40.0%)	11	NA	NA
WP_000939903.1|939743_941981_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	56.0	4.8e-53
WP_000461744.1|941964_942618_-	competence protein CelA	NA	NA	NA	NA	NA
WP_000500220.1|942717_943458_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_000567425.1|943592_944357_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000598736.1|944349_944616_+	GIY-YIG nuclease family protein	NA	A0A0B4UM41	Condylorrhiza_vestigialis_MNPV	37.7	2.9e-05
WP_000673090.1|944800_946387_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.9	9.0e-62
WP_000735504.1|946621_947452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565395.1|947467_948130_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000582850.1|948122_948857_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	33.5	1.6e-16
WP_000510901.1|948977_949358_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_000174832.1|949443_950988_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.8	2.4e-35
>prophage 72
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	962397	963594	2210718		Aureococcus_anophage(100.0%)	1	NA	NA
WP_001040731.1|962397_963594_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	28.7	6.2e-31
>prophage 73
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	969649	973409	2210718		Streptococcus_phage(50.0%)	4	NA	NA
WP_000768691.1|969649_971449_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	36.0	1.4e-103
WP_000759944.1|971507_971897_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_000594806.1|971880_972405_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001254339.1|972560_973409_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1PAF8	Bacillus_phage	34.2	3.7e-22
>prophage 74
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	976602	981604	2210718	tRNA	Staphylococcus_phage(60.0%)	5	NA	NA
WP_000070708.1|976602_978093_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	5.8e-87
WP_000152414.1|978167_978638_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	52.7	1.3e-40
WP_150352940.1|978652_979846_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.5	3.9e-110
WP_000493859.1|979863_980514_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	4.5e-36
WP_000975998.1|980494_981604_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.4	4.0e-56
>prophage 75
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	985034	986321	2210718		Phage_TP(100.0%)	1	NA	NA
WP_000073157.1|985034_986321_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.1	4.2e-41
>prophage 76
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	991146	991575	2210718		Bacillus_phage(100.0%)	1	NA	NA
WP_000186507.1|991146_991575_-	SprT family protein	NA	U5J9G1	Bacillus_phage	26.2	2.1e-05
>prophage 77
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1003764	1008958	2210718		Bacillus_phage(40.0%)	6	NA	NA
WP_000661526.1|1003764_1004451_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	29.9	3.3e-21
WP_000719384.1|1004626_1004995_-	YbaN family protein	NA	NA	NA	NA	NA
WP_001289497.1|1004997_1005807_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	37.6	3.2e-39
WP_001065468.1|1005810_1007160_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	33.8	3.6e-35
WP_000722052.1|1007152_1007863_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.5	3.1e-38
WP_000053145.1|1008202_1008958_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	5.6e-38
>prophage 78
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1013039	1015909	2210718	tRNA	Bacillus_phage(50.0%)	2	NA	NA
WP_001261248.1|1013039_1013744_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	5.6e-32
WP_000591012.1|1013965_1015909_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	1.5e-119
>prophage 79
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1021511	1022540	2210718	transposase	unidentified_phage(100.0%)	1	NA	NA
WP_024401886.1|1021511_1022540_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.2	1.7e-40
>prophage 80
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1031525	1037183	2210718		Vaccinia_virus(50.0%)	4	NA	NA
WP_000966715.1|1031525_1033325_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	42.5	5.3e-135
WP_001062640.1|1033341_1034367_-	sugar kinase	NA	NA	NA	NA	NA
WP_000416108.1|1034433_1035984_-	sugar transporter	NA	NA	NA	NA	NA
WP_000770070.1|1036190_1037183_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	33.7	1.7e-42
>prophage 81
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1042445	1043102	2210718		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000121094.1|1042445_1043102_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	32.3	1.9e-18
>prophage 82
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1046582	1047254	2210718		Bacillus_phage(100.0%)	1	NA	NA
WP_000891268.1|1046582_1047254_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.3	1.2e-10
>prophage 83
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1053385	1054204	2210718		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_001865683.1|1053385_1054204_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	37.8	5.2e-37
>prophage 84
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1070499	1072899	2210718		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000403526.1|1070499_1071429_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	2.6e-24
WP_000164166.1|1071418_1071895_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000611493.1|1071878_1072184_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_000861303.1|1072176_1072899_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	3.2e-14
>prophage 85
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1076281	1077274	2210718		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000061734.1|1076281_1077274_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	4.0e-15
>prophage 86
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1081478	1083362	2210718		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_032458607.1|1081478_1083362_-	recombinase family protein	NA	A0A2I4R675	Erysipelothrix_phage	52.5	2.9e-152
>prophage 87
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1086526	1088335	2210718		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_024383495.1|1086526_1088335_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.3	2.7e-14
>prophage 88
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1093441	1097769	2210718		Staphylococcus_phage(66.67%)	4	NA	NA
WP_024383493.1|1093441_1094143_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.6	1.7e-49
WP_029171581.1|1094314_1095679_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002943322.1|1095656_1096355_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	2.8e-23
WP_000719507.1|1096395_1097769_-	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	35.3	5.2e-58
>prophage 89
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1101392	1105935	2210718		Bacillus_virus(50.0%)	4	NA	NA
WP_024383488.1|1101392_1102934_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	34.4	2.0e-05
WP_032458610.1|1102926_1104681_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032458611.1|1104670_1105459_-	toxin PezT	NA	NA	NA	NA	NA
WP_024415699.1|1105458_1105935_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	34.8	3.6e-06
>prophage 90
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1111169	1225302	2210718	terminase,integrase,protease,transposase,portal,holin,capsid,tail	Streptococcus_phage(71.08%)	140	1207218:1207277	1223632:1224491
WP_002326825.1|1111169_1111442_-	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	96.7	5.4e-07
WP_001835296.1|1111459_1111675_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_002326827.1|1111766_1112663_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	97.9	1.1e-152
WP_000085862.1|1113059_1113191_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	7.9e-17
WP_150352941.1|1113195_1113933_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	98.8	1.2e-133
WP_001814874.1|1114057_1114141_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_150352942.1|1114126_1114342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024401886.1|1114268_1115297_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.2	1.7e-40
WP_150352943.1|1115366_1115606_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	81.5	6.8e-22
WP_000503424.1|1116851_1117043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659121.1|1117113_1117344_-	hypothetical protein	NA	A0A223LEC3	Bacillus_phage	48.5	4.2e-13
WP_000743701.1|1117420_1118275_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	30.2	9.9e-07
WP_001145977.1|1118282_1119248_-	plasmid recombination protein	NA	NA	NA	NA	NA
WP_001170965.1|1119766_1120798_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000323521.1|1120951_1121425_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000323896.1|1121508_1121934_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000872511.1|1122028_1122538_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011528024.1|1123027_1123201_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	98.2	1.7e-27
WP_000691759.1|1123252_1125172_-	tetracycline resistance ribosomal protection protein Tet(O)	NA	A0A1B0RXH7	Streptococcus_phage	99.7	0.0e+00
WP_001140406.1|1125538_1125913_-	TnpV protein	NA	A0A1B0RXG6	Streptococcus_phage	100.0	2.0e-68
WP_000220099.1|1131890_1132442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068445.1|1132425_1132617_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_000167699.1|1132617_1137513_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000037239.1|1137792_1138383_+	abortive infection protein	NA	NA	NA	NA	NA
WP_001030302.1|1138379_1139225_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000656702.1|1139310_1142112_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_000837852.1|1142113_1144444_-	ATPase AAA	NA	NA	NA	NA	NA
WP_001097576.1|1144421_1144775_-	PrgI family protein	NA	NA	NA	NA	NA
WP_000980125.1|1144836_1145691_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_001072182.1|1145709_1145952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287313.1|1145969_1147787_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_000093699.1|1147786_1148275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150352944.1|1148351_1148936_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001005707.1|1148938_1149172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000895333.1|1149180_1149564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050386.1|1149574_1150003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032458621.1|1149986_1151342_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	55.6	6.8e-127
WP_000638409.1|1151393_1151489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032458622.1|1151490_1152309_-	replication initiator protein A	NA	A0A286QNA4	Streptococcus_phage	36.6	6.4e-11
WP_079278499.1|1152305_1152479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902656.1|1152689_1154051_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	72.9	7.4e-190
WP_000089337.1|1154151_1155525_-	LCP family protein	NA	NA	NA	NA	NA
WP_001127193.1|1155581_1156094_-	shikimate kinase	NA	NA	NA	NA	NA
WP_000772014.1|1156086_1157370_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000823931.1|1157598_1158663_+	endonuclease	NA	NA	NA	NA	NA
WP_000022832.1|1158770_1160078_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	95.4	1.5e-235
WP_000137373.1|1160275_1160731_+	YueI family protein	NA	W6LLD2	Streptococcus_phage	48.9	7.8e-27
WP_000409124.1|1160743_1161229_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_000589685.1|1161249_1161891_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000094341.1|1161984_1163709_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_000134196.1|1163802_1165755_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.8	1.5e-143
WP_001106189.1|1165755_1166316_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_000409893.1|1166369_1166474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564846.1|1166457_1167591_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_000078931.1|1167760_1168966_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_000027835.1|1169390_1169579_-	hypothetical protein	NA	J7KIW4	Streptococcus_phage	78.2	3.3e-16
WP_000076708.1|1169620_1169821_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	97.0	8.4e-26
WP_000734169.1|1170697_1172017_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	2.2e-05
WP_000699093.1|1172013_1172667_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	8.1e-25
WP_000594351.1|1172763_1174140_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000353149.1|1174139_1174796_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
WP_000594360.1|1174805_1176083_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000508795.1|1176824_1176986_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_001867107.1|1177158_1177368_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
WP_001865698.1|1177493_1177754_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	3.4e-11
WP_001122304.1|1177775_1177976_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000640620.1|1178137_1178542_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001872365.1|1178541_1178808_+	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_079218646.1|1178810_1179425_+|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
WP_000965642.1|1179524_1179704_-	hypothetical protein	NA	J7KIW4	Streptococcus_phage	86.2	2.1e-20
WP_000356856.1|1180120_1180291_+	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	63.8	1.1e-07
WP_000076715.1|1180331_1180532_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	87.9	9.6e-22
WP_000812952.1|1180635_1181607_-	Abi family protein	NA	A0A059NT88	Lactococcus_phage	42.6	1.3e-74
WP_000236381.1|1181939_1182659_-	CHAP domain-containing protein	NA	A0A1U9WRD0	Streptococcus_virus	72.1	1.6e-58
WP_001001742.1|1182660_1182996_-|holin	phage holin	holin	A0A1P8VVK6	Streptococcus_phage	71.2	6.8e-36
WP_000215499.1|1182997_1183300_-	hypothetical protein	NA	X2KT07	Streptococcus_phage	59.6	2.2e-25
WP_000698337.1|1183312_1183525_-	hypothetical protein	NA	J7KDP6	Streptococcus_phage	60.0	2.1e-14
WP_000494205.1|1183499_1183829_-	DUF1366 domain-containing protein	NA	J7KDI9	Streptococcus_phage	54.3	7.2e-22
WP_000536253.1|1183854_1185861_-	hypothetical protein	NA	J7KK23	Streptococcus_phage	43.3	3.6e-140
WP_150352945.1|1185871_1189996_-	CHAP domain-containing protein	NA	J7KBT9	Streptococcus_phage	75.4	0.0e+00
WP_000228810.1|1189996_1191517_-	hypothetical protein	NA	J7KH53	Streptococcus_phage	74.6	2.9e-203
WP_000224695.1|1191510_1193523_-	hypothetical protein	NA	Q9F4J3	Streptococcus_phage	58.9	9.8e-13
WP_150352946.1|1193522_1193894_-	hypothetical protein	NA	A0A1P8BMT6	Lactococcus_phage	53.2	6.2e-30
WP_000858406.1|1193908_1194154_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.3	9.7e-16
WP_000226354.1|1194153_1194711_-|tail	tail protein	tail	M1PKG8	Streptococcus_phage	65.8	3.4e-64
WP_000573598.1|1194720_1195056_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_000032787.1|1195056_1195293_-	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
WP_000517229.1|1195285_1195624_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	67.9	1.4e-41
WP_000180800.1|1195574_1196006_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	70.1	3.8e-47
WP_000640307.1|1196019_1196235_-	hypothetical protein	NA	M1PRX2	Streptococcus_phage	52.9	6.5e-08
WP_000841023.1|1196231_1197134_-|capsid	phage major capsid protein	capsid	A0A0B5A5W3	Streptococcus_phage	86.0	9.7e-146
WP_001288694.1|1197136_1197601_-	DUF4355 domain-containing protein	NA	A0A0B5A7G6	Streptococcus_phage	51.3	9.7e-41
WP_000256853.1|1197681_1199097_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.8	6.3e-216
WP_000421991.1|1199204_1199393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227333.1|1199392_1200613_-	hypothetical protein	NA	Q7Y4I9	Streptococcus_phage	66.0	6.6e-113
WP_001108668.1|1200605_1201874_-|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	76.0	2.4e-190
WP_000725957.1|1201870_1202227_-	hypothetical protein	NA	A0A0B5A7G9	Streptococcus_phage	49.6	5.9e-22
WP_017646473.1|1202378_1202756_-	HNH endonuclease	NA	Q7Y4J1	Streptococcus_phage	71.3	2.1e-41
WP_011058322.1|1203338_1203767_-	DUF1492 domain-containing protein	NA	A0A0B5A564	Streptococcus_phage	49.3	6.4e-31
WP_000660741.1|1204154_1204421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019148.1|1204417_1204951_-	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	41.4	1.6e-23
WP_011058321.1|1205043_1205175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052302.1|1205257_1205590_-	hypothetical protein	NA	J7KDM7	Streptococcus_phage	55.8	2.6e-27
WP_000139629.1|1205592_1205862_-	hypothetical protein	NA	A7J287	Streptococcus_phage	70.8	1.3e-24
WP_000159369.1|1205858_1206023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612734.1|1206019_1206436_-	hypothetical protein	NA	Q938M1	Temperate_phage	58.5	1.1e-32
WP_000906736.1|1206435_1206567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000763909.1|1206570_1206873_-	DUF1599 domain-containing protein	NA	J7KDH9	Streptococcus_phage	74.7	1.0e-30
WP_150352947.1|1206884_1207241_-	hypothetical protein	NA	J7KK12	Streptococcus_phage	86.5	6.1e-51
1207218:1207277	attL	TAGACTTCCTGCGAAACAAAATATGGTACAATAGTTCTATGAATTATGAAGCAAGCAAAC	NA	NA	NA	NA
WP_088181596.1|1207255_1208060_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000143298.1|1208082_1208559_-	RusA family crossover junction endodeoxyribonuclease	NA	J7KBT1	Streptococcus_phage	98.2	1.3e-59
WP_000165747.1|1208548_1208752_-	hypothetical protein	NA	J7KIX6	Streptococcus_phage	96.8	1.7e-26
WP_000561483.1|1208877_1210197_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	39.5	7.3e-57
WP_111695115.1|1210626_1210704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609377.1|1210777_1211194_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	80.6	1.5e-56
WP_001231960.1|1211186_1211861_-	single-stranded DNA-binding protein	NA	Q938M8	Temperate_phage	82.6	7.6e-95
WP_000323859.1|1211861_1212344_-	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	92.5	1.2e-44
WP_001001351.1|1212345_1212507_-	hypothetical protein	NA	J7KDI4	Streptococcus_phage	84.9	5.2e-18
WP_000229417.1|1212509_1212764_-	hypothetical protein	NA	J7KK18	Streptococcus_phage	79.8	1.1e-30
WP_000166038.1|1212774_1212915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371783.1|1212911_1213145_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	8.0e-36
WP_000774716.1|1213125_1213986_-	DnaD domain protein	NA	J7KBV5	Streptococcus_phage	85.5	5.6e-58
WP_000431178.1|1213996_1214221_-	hypothetical protein	NA	J7KBY5	Streptococcus_phage	95.9	1.7e-35
WP_000879943.1|1214358_1214589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247544.1|1214738_1214882_-	hypothetical protein	NA	J7KIV4	Streptococcus_phage	100.0	1.6e-18
WP_001072518.1|1214893_1215643_-	phage antirepressor Ant	NA	F8HGQ0	Streptococcus_phage	59.6	1.9e-78
WP_001183891.1|1215710_1215902_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000573030.1|1215953_1216760_+	DUF4393 domain-containing protein	NA	A0A1S5SD60	Streptococcus_phage	36.5	1.9e-28
WP_000394501.1|1216742_1216931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104154.1|1216960_1217119_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	9.9e-22
WP_001107539.1|1217177_1217402_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	67.6	2.2e-22
WP_000392846.1|1217398_1217542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000550055.1|1217902_1218700_+	XRE family transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	74.7	2.6e-65
WP_000891067.1|1218701_1219259_+	GTP pyrophosphokinase	NA	Q0H269	Geobacillus_phage	30.2	1.6e-18
WP_000505363.1|1219361_1219565_+	hypothetical protein	NA	O34033	Streptococcus_phage	48.4	1.7e-10
WP_000564846.1|1219794_1220928_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_150352948.1|1220989_1222093_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9IGD8	Lactococcus_phage	39.8	1.4e-61
WP_001068667.1|1222317_1222665_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_088181596.1|1222847_1223653_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000595708.1|1224105_1225302_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	4.6e-103
1223632:1224491	attR	GTTTGCTTGCTTCATAATTCATAGAACTATTGTACCATATTTTGTTTCGCAGGAAGTCTATTATTTAAATTTGATTTACTGTTTCTAGGTTAGCTTTTTTCTGATTTTTGAGAGTTTAATTCATTTAATATTTGATTTTTTAAGCTACGTTTTCTATATTAGCTTTCGTGTCACTTAACTCTTTCCCATAAAGTTGAAATCCACATCAACTTTTTATCTTATAATGCATTTCACCATCGCGACTTAAATGCTTGTAGACATTATCCTAACCTAAGTTCCTACACATTCAATTGGATTTTACAGTATTTTAATGACAATCATAAAATCAATTTCTTTGAAGAAATTATATTAGCCACATAATTTTTGCATTCATAAAATTGACAAACTCCATTTTTATAAACTTTAAGAGAATAAAAAAGAGAACGGAATATTCCGTTCTACAAACTGATAAACTCTTTTAAAACTCATCACTAACTATCTAGATTGAGCACCATAAATCGTATGAGCATGTGATATGGAGTAAGCAACAAGACATACAATAACAAAATAAGGAGTGTTGGCAAAGCCAAAGACTTCGCCTCCTATTAAGATAGGACCTAACAGAGTATTCGTTGCACTCCCAAAAACGCTAGTATAGCCTAAAGCAGCAACTAAAATAACTGGCAAACCTAAAATGGGCGCAATAATCACTCCTAAACTTGCTCCGATTGCAAATAAGGGAGTTACTTCTCCTCCCTGATAACCTGCAGCCAAAGTAATAACTGTCAAACACAATTTTAACAACCAATCATAATCATAAAGGTTCTTATTAGTGAAGCTAGCCTCAATTAGATTTGTTCCCAGTCCTGAATATCGTCCAA	NA	NA	NA	NA
>prophage 91
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1231927	1246343	2210718	tRNA	Streptococcus_phage(50.0%)	15	NA	NA
WP_000011316.1|1231927_1232839_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	65.7	1.4e-107
WP_001231102.1|1232835_1233810_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	78.8	9.8e-144
WP_001278848.1|1233806_1234697_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.1	5.7e-05
WP_000965180.1|1234850_1235264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011058320.1|1235360_1235477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001031097.1|1235509_1236493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000167491.1|1236489_1237047_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000038470.1|1237086_1238433_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.4	1.3e-56
WP_000221826.1|1238453_1239647_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000458614.1|1239732_1242240_-	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	50.3	2.0e-217
WP_000048144.1|1242347_1243112_-	(S)-acetoin forming diacetyl reductase	NA	V5L4T3	Hirudovirus	31.8	9.8e-06
WP_001115859.1|1243279_1243978_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	64.9	1.5e-82
WP_001022571.1|1243974_1244685_+	thioesterase	NA	NA	NA	NA	NA
WP_000236202.1|1244737_1245667_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001173889.1|1245650_1246343_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-28
>prophage 92
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1251730	1256537	2210718		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000910746.1|1251730_1254415_-	calcium-translocating P-type ATPase, PMCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.1e-70
WP_000764120.1|1254758_1255145_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_001003543.1|1255220_1256537_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.6	8.1e-24
>prophage 93
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1261304	1262950	2210718		Hokovirus(50.0%)	3	NA	NA
WP_000254063.1|1261304_1262237_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	43.7	6.7e-65
WP_001290370.1|1262280_1262478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284634.1|1262674_1262950_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	1.2e-25
>prophage 94
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1269425	1282964	2210718	protease,tRNA	Acanthamoeba_polyphaga_moumouvirus(16.67%)	12	NA	NA
WP_001286939.1|1269425_1270766_-	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	31.7	3.4e-38
WP_000634981.1|1270891_1271728_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000137498.1|1271724_1272579_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.2	1.5e-39
WP_001106845.1|1272717_1274412_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.6	5.5e-126
WP_000230134.1|1274698_1275433_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	1.1e-35
WP_001011647.1|1275425_1276118_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000443582.1|1276259_1276490_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_011058319.1|1276527_1276632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882549.1|1276787_1279049_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.4	7.4e-126
WP_000184292.1|1279233_1279689_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001237035.1|1279752_1280055_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_000768163.1|1280171_1282964_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.7	3.2e-86
>prophage 95
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1293313	1295155	2210718		Streptococcus_phage(100.0%)	1	NA	NA
WP_000183432.1|1293313_1295155_-	translational GTPase TypA	NA	A0A1B0RXH7	Streptococcus_phage	44.3	7.1e-18
>prophage 96
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1302812	1306981	2210718		Acinetobacter_phage(33.33%)	3	NA	NA
WP_000925635.1|1302812_1303379_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	40.9	2.9e-31
WP_000841525.1|1303506_1305246_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.4e-20
WP_000022475.1|1305235_1306981_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.9	5.6e-49
>prophage 97
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1311948	1314888	2210718		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000161892.1|1311948_1312434_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	31.7	7.3e-15
WP_000384889.1|1312430_1312721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001266829.1|1312732_1313272_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000592263.1|1313401_1313851_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_000748011.1|1313895_1314888_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.1	1.1e-54
>prophage 98
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1319747	1322399	2210718	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000032207.1|1319747_1322399_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.5	9.2e-152
>prophage 99
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1326576	1327047	2210718	integrase	Streptococcus_phage(100.0%)	1	1321659:1321672	1338194:1338207
1321659:1321672	attL	AACATTTTGACCAA	NA	NA	NA	NA
WP_079278500.1|1326576_1327047_-|integrase	tyrosine-type recombinase/integrase	integrase	A7J266	Streptococcus_phage	29.9	9.9e-09
WP_079278500.1|1326576_1327047_-|integrase	tyrosine-type recombinase/integrase	integrase	A7J266	Streptococcus_phage	29.9	9.9e-09
1338194:1338207	attR	AACATTTTGACCAA	NA	NA	NA	NA
>prophage 100
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1337835	1338690	2210718		Klosneuvirus(100.0%)	1	NA	NA
WP_000132680.1|1337835_1338690_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	33.7	1.9e-34
>prophage 101
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1345704	1349296	2210718		Enterococcus_phage(50.0%)	3	NA	NA
WP_000194382.1|1345704_1347870_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	44.2	6.5e-172
WP_000378631.1|1347871_1348285_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_001192437.1|1348285_1349296_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	52.1	1.6e-96
>prophage 102
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1356154	1357510	2210718		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001103627.1|1356154_1357510_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.8	1.0e-74
>prophage 103
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1367932	1368832	2210718		Bacillus_phage(100.0%)	1	NA	NA
WP_000868271.1|1367932_1368832_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.7	9.3e-80
>prophage 104
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1375621	1394001	2210718	tRNA	uncultured_virus(33.33%)	16	NA	NA
WP_000129510.1|1375621_1376764_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.1	7.1e-85
WP_000185054.1|1376950_1377691_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_000770240.1|1377704_1378742_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.6	1.3e-13
WP_000192298.1|1378743_1379430_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	1.8e-35
WP_000703863.1|1379542_1381108_-	YSIRK signal domain/LPXTG anchor domain surface protein	NA	NA	NA	NA	NA
WP_000377090.1|1381260_1381740_-	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_000262487.1|1381821_1382262_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000182605.1|1382291_1384934_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	28.5	3.2e-56
WP_000593336.1|1385046_1385859_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000020721.1|1385873_1386488_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000683375.1|1386597_1386804_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_000013400.1|1386844_1389079_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.0	2.3e-95
WP_000156042.1|1389091_1389508_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_000804611.1|1389670_1390675_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000715537.1|1390758_1391127_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000039156.1|1391217_1394001_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	5.1e-20
>prophage 105
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1399305	1400031	2210718		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000912307.1|1399305_1400031_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.1e-25
>prophage 106
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1404376	1405798	2210718		Moraxella_phage(100.0%)	1	NA	NA
WP_000410400.1|1404376_1405798_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.6	1.7e-43
>prophage 107
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1413047	1414325	2210718	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000886193.1|1413047_1414325_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.4	1.5e-91
>prophage 108
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1420699	1421434	2210718		Bacillus_phage(100.0%)	1	NA	NA
WP_001176108.1|1420699_1421434_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	W8CYX9	Bacillus_phage	36.1	1.7e-07
>prophage 109
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1426213	1426864	2210718		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000335411.1|1426213_1426864_-	HAD family phosphatase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	30.5	4.3e-10
>prophage 110
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1435145	1442594	2210718		Streptococcus_phage(60.0%)	6	NA	NA
WP_000432961.1|1435145_1436435_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	57.3	3.8e-143
WP_001108147.1|1436490_1437135_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	64.9	1.8e-69
WP_000036948.1|1437225_1438152_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	78.3	2.1e-135
WP_000862118.1|1438303_1439392_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000394891.1|1439459_1440128_-	fructose-6-phosphate aldolase	NA	A0A0E3EPH4	Synechococcus_phage	30.5	8.0e-20
WP_000166134.1|1440137_1442594_-	glycyl radical protein	NA	Q66LZ4	Escherichia_phage	52.8	3.6e-09
>prophage 111
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1448100	1460503	2210718	tRNA	Catovirus(25.0%)	11	NA	NA
WP_000339133.1|1448100_1449501_-	bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	46.2	1.3e-27
WP_000357892.1|1449542_1450184_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000716170.1|1450176_1451196_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000714456.1|1451192_1451888_-	transporter	NA	NA	NA	NA	NA
WP_000614568.1|1452048_1454004_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	36.3	3.9e-22
WP_000406233.1|1454003_1454741_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_001262599.1|1454778_1456101_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_000163893.1|1456090_1457026_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.2	1.9e-06
WP_000101528.1|1457072_1459463_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000979239.1|1459536_1459851_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000003861.1|1459873_1460503_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	6.2e-22
>prophage 112
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1463824	1464721	2210718		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_001029973.1|1463824_1464721_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	3.6e-15
>prophage 113
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1474382	1483529	2210718		Bacillus_virus(50.0%)	9	NA	NA
WP_000041114.1|1474382_1475717_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	33.3	1.1e-63
WP_000174854.1|1475829_1476651_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.1	7.7e-73
WP_000276183.1|1476647_1478108_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.3	3.4e-100
WP_000272353.1|1478265_1479180_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.8	2.1e-87
WP_000478229.1|1479248_1479473_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_032458542.1|1479594_1480338_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	3.6e-29
WP_001071299.1|1480337_1481141_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000473468.1|1481235_1482048_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000008549.1|1482185_1483529_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.5	7.9e-43
>prophage 114
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1488271	1495591	2210718	transposase	Streptococcus_phage(50.0%)	5	NA	NA
WP_000221014.1|1488271_1489525_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.0	3.6e-106
WP_000820352.1|1489534_1490338_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.7	9.9e-41
WP_024401886.1|1491240_1492269_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.2	1.7e-40
WP_001104587.1|1493248_1494853_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000589162.1|1494856_1495591_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	2.2e-26
>prophage 115
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1501084	1501783	2210718		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000350763.1|1501084_1501783_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	36.3	5.0e-33
>prophage 116
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1514917	1515634	2210718		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000755578.1|1514917_1515634_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.5	7.2e-27
>prophage 117
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1522174	1522393	2210718		Marinitoga_camini_virus(100.0%)	1	NA	NA
WP_000514223.1|1522174_1522393_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	36.2	1.1e-05
>prophage 118
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1533331	1534477	2210718	holin	Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000529592.1|1533331_1534477_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	31.7	1.9e-13
>prophage 119
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1539622	1540651	2210718	transposase	unidentified_phage(100.0%)	1	NA	NA
WP_024401886.1|1539622_1540651_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.2	1.7e-40
>prophage 120
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1545647	1546904	2210718		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000122833.1|1545647_1546904_-	plasmid recombination protein	NA	M1NXP9	Cellulophaga_phage	30.4	9.4e-14
>prophage 121
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1550964	1552660	2210718	integrase	Streptococcus_phage(100.0%)	2	1545227:1545240	1555576:1555589
1545227:1545240	attL	TATCCAAATCTGAT	NA	NA	NA	NA
WP_000282761.1|1550964_1551441_+	helix-turn-helix domain-containing protein	NA	W6LMS6	Streptococcus_phage	47.1	3.8e-08
WP_000022160.1|1551505_1552660_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	32.6	4.7e-44
1555576:1555589	attR	TATCCAAATCTGAT	NA	NA	NA	NA
>prophage 122
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1557232	1558576	2210718	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000591131.1|1557232_1558576_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.2	2.9e-53
>prophage 123
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1575524	1576938	2210718		Bacillus_virus(50.0%)	2	NA	NA
WP_000171309.1|1575524_1576151_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.0	2.3e-16
WP_000140984.1|1576134_1576938_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	3.2e-07
>prophage 124
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1582804	1585740	2210718		Enterobacteria_phage(33.33%)	3	NA	NA
WP_000930334.1|1582804_1584550_-	sensor protein LytS	NA	Q9EYF3	Enterobacteria_phage	28.8	1.0e-58
WP_000416612.1|1584576_1585221_-	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	29.2	2.2e-11
WP_000282447.1|1585344_1585740_-	single-stranded DNA-binding protein	NA	A1EAD1	Streptococcus_phage	50.0	1.9e-29
>prophage 125
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1589575	1590346	2210718		Streptococcus_phage(100.0%)	1	NA	NA
WP_001865901.1|1589575_1590346_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.2	9.8e-30
>prophage 126
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1597825	1612691	2210718	tRNA	Phaeocystis_globosa_virus(25.0%)	6	NA	NA
WP_000228729.1|1597825_1601476_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.1	2.6e-64
WP_000907191.1|1601592_1605168_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.1	9.8e-40
WP_000472388.1|1605691_1607989_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_001019853.1|1608099_1609359_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	41.0	3.1e-73
WP_000923270.1|1611178_1611991_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001269501.1|1611980_1612691_-	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.6e-08
>prophage 127
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1619611	1621590	2210718		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000138506.1|1619611_1620544_-	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	27.3	2.2e-07
WP_000410286.1|1620543_1621590_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	2.5e-20
>prophage 128
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1630167	1633471	2210718		environmental_halophage(50.0%)	3	NA	NA
WP_000173341.1|1630167_1631400_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.7	2.4e-102
WP_000031280.1|1631401_1632664_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000114502.1|1632700_1633471_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	26.9	3.9e-10
>prophage 129
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1640136	1642969	2210718		Planktothrix_phage(50.0%)	4	NA	NA
WP_000189496.1|1640136_1640877_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	3.8e-23
WP_000768361.1|1641218_1641509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818733.1|1641876_1641993_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_000052520.1|1642084_1642969_-	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	35.4	9.5e-37
>prophage 130
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1650478	1652930	2210718		Bacillus_phage(66.67%)	3	NA	NA
WP_001868596.1|1650478_1651549_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.1	3.5e-41
WP_000590686.1|1651541_1652213_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.8	9.1e-40
WP_001274148.1|1652243_1652930_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	4.5e-34
>prophage 131
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1656478	1657957	2210718		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000687230.1|1656478_1657957_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.3	1.4e-11
>prophage 132
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1661623	1668536	2210718		Erysipelothrix_phage(33.33%)	6	NA	NA
WP_000759706.1|1661623_1662943_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	43.8	3.1e-100
WP_000214742.1|1663096_1663594_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_001085195.1|1663729_1665094_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000049186.1|1665255_1665702_-	dUTP diphosphatase	NA	A0A1P8BMQ4	Lactococcus_phage	46.5	5.7e-30
WP_000723859.1|1665896_1666823_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000170435.1|1666931_1668536_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	45.1	1.6e-135
>prophage 133
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1674499	1681626	2210718		Streptococcus_phage(25.0%)	6	NA	NA
WP_000256871.1|1674499_1675747_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	49.6	5.9e-101
WP_001066287.1|1675860_1677000_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	29.4	1.2e-23
WP_000034648.1|1677288_1679118_-	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.7	1.5e-132
WP_001865751.1|1679298_1679871_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001872861.1|1679873_1680908_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_001231504.1|1681050_1681626_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BV84	unidentified_phage	31.4	4.2e-09
>prophage 134
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1711369	1712386	2210718		Tupanvirus(100.0%)	1	NA	NA
WP_000649193.1|1711369_1712386_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.1	5.1e-26
>prophage 135
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1715476	1724920	2210718		Salmonella_virus(25.0%)	9	NA	NA
WP_001220909.1|1715476_1717255_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	28.1	5.8e-25
WP_000787700.1|1717251_1717632_-	membrane protein	NA	NA	NA	NA	NA
WP_000754813.1|1717638_1718076_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_000196634.1|1718227_1719226_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	31.8	8.0e-08
WP_000912100.1|1719522_1720434_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000572887.1|1720585_1721884_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	8.5e-18
WP_001079802.1|1721908_1723300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084004.1|1723353_1724445_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001182532.1|1724431_1724920_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	2.4e-18
>prophage 136
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1735631	1743767	2210718		Synechococcus_phage(33.33%)	7	NA	NA
WP_032458546.1|1735631_1736966_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	3.8e-05
WP_001045908.1|1737112_1738012_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000166549.1|1738204_1739752_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.2	3.9e-78
WP_000780022.1|1739771_1740524_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000686114.1|1740546_1741095_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	1.0e-25
WP_001291337.1|1741262_1742285_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.4	1.2e-62
WP_000220683.1|1742312_1743767_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.4e-53
>prophage 137
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1749352	1750057	2210718		Cyanophage(100.0%)	1	NA	NA
WP_000184494.1|1749352_1750057_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SE76	Cyanophage	41.5	6.4e-44
>prophage 138
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1754475	1755444	2210718		Hokovirus(100.0%)	1	NA	NA
WP_000122450.1|1754475_1755444_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.0	1.8e-41
>prophage 139
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1769901	1779565	2210718	protease,tRNA	Micromonas_pusilla_virus(25.0%)	9	NA	NA
WP_150352954.1|1769901_1771878_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	46.8	4.8e-105
WP_000892188.1|1771900_1772443_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.1	3.0e-09
WP_000282856.1|1772447_1773722_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	28.3	2.7e-16
WP_000757205.1|1773723_1775010_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001061058.1|1775009_1775144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042845.1|1775146_1775518_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_001234967.1|1775504_1775777_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011058309.1|1775811_1775907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021202.1|1776067_1779565_-	transcription-repair coupling factor	NA	A0A068EU29	Bacillus_phage	34.8	2.6e-05
>prophage 140
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1783058	1788010	2210718		Rhizobium_phage(25.0%)	4	NA	NA
WP_000581132.1|1783058_1784195_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	24.9	3.2e-21
WP_000138202.1|1784349_1785711_-	chromosomal replication initiator protein DnaA	NA	A6XMI1	Bacillus_virus	31.2	1.0e-05
WP_000456087.1|1785909_1786683_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.3	1.5e-14
WP_000728358.1|1786780_1788010_-	PDZ domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	31.9	3.8e-07
>prophage 141
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1791970	1793590	2210718		Tupanvirus(100.0%)	1	NA	NA
WP_000958804.1|1791970_1793590_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.6	3.4e-48
>prophage 142
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1804382	1816442	2210718		Streptococcus_phage(25.0%)	13	NA	NA
WP_000073440.1|1804382_1805864_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.7	5.0e-99
WP_001865840.1|1805938_1806601_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000398683.1|1806656_1807523_+	sugar transporter	NA	NA	NA	NA	NA
WP_000264863.1|1807534_1808644_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000384871.1|1808646_1809000_-	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	61.8	9.4e-20
WP_000706188.1|1809238_1810483_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	41.3	3.7e-87
WP_000217754.1|1810484_1811768_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	23.6	2.2e-05
WP_000976003.1|1811890_1812433_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000181757.1|1812432_1813272_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.0	3.5e-20
WP_000510606.1|1813247_1814090_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.0e-15
WP_000359358.1|1814082_1814877_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000029068.1|1815092_1815632_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	45.8	6.7e-17
WP_001042655.1|1815737_1816442_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J6C5	uncultured_Caudovirales_phage	56.6	4.2e-27
>prophage 143
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1824762	1826118	2210718		Streptococcus_phage(100.0%)	1	NA	NA
WP_000230635.1|1824762_1826118_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
>prophage 144
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1831536	1832280	2210718		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000138570.1|1831536_1832280_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	29.2	1.2e-05
>prophage 145
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1836399	1837122	2210718		Bacillus_virus(100.0%)	1	NA	NA
WP_000622721.1|1836399_1837122_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	4.9e-31
>prophage 146
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1844612	1848649	2210718		Bacillus_phage(50.0%)	4	NA	NA
WP_000699614.1|1844612_1845284_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	2.4e-32
WP_000186293.1|1845368_1846040_-	peptidase	NA	NA	NA	NA	NA
WP_001125681.1|1846490_1847300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368910.1|1847527_1848649_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	32.0	4.2e-37
>prophage 147
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1852644	1868366	2210718	integrase,tRNA,bacteriocin	Staphylococcus_phage(14.29%)	15	1846412:1846438	1854806:1854832
1846412:1846438	attL	TTTTAATCAGACAAAAATCAGACAAAA	NA	NA	NA	NA
WP_001205484.1|1852644_1854129_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	26.9	6.1e-12
WP_001033386.1|1854121_1854748_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_001265622.1|1854895_1855045_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
1854806:1854832	attR	TTTTAATCAGACAAAAATCAGACAAAA	NA	NA	NA	NA
WP_000290414.1|1855060_1855243_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_000775901.1|1855462_1856743_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000830929.1|1856835_1858587_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	25.7	3.5e-14
WP_000857771.1|1858576_1859521_+	YitT family protein	NA	NA	NA	NA	NA
WP_000915479.1|1859628_1860501_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.5	1.5e-50
WP_001138859.1|1860527_1860836_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000379868.1|1860923_1862615_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.7	6.9e-76
WP_001033152.1|1862836_1863274_+	arginine repressor	NA	NA	NA	NA	NA
WP_001118377.1|1863330_1865907_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.4	7.6e-42
WP_000191849.1|1865963_1866167_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	74.6	1.4e-20
WP_001867198.1|1866160_1866262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054074.1|1866386_1868366_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.4	2.5e-61
>prophage 148
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1872218	1873358	2210718		Bacillus_phage(100.0%)	1	NA	NA
WP_001085741.1|1872218_1873358_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.4	5.4e-125
>prophage 149
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1877118	1882731	2210718		Enterococcus_phage(66.67%)	6	NA	NA
WP_000140248.1|1877118_1879290_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	65.1	6.4e-276
WP_000521645.1|1879364_1879508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939688.1|1879520_1880453_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000776874.1|1880461_1880953_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001287943.1|1881025_1881643_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	57.8	2.3e-53
WP_000590612.1|1881999_1882731_-	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	40.8	9.6e-43
>prophage 150
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1886960	1893247	2210718		uncultured_virus(50.0%)	7	NA	NA
WP_000054430.1|1886960_1887764_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	6.0e-14
WP_000917302.1|1887938_1888223_+	co-chaperone GroES	NA	A0A221S2Z4	uncultured_virus	35.2	4.6e-09
WP_001029978.1|1888318_1889941_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	1.9e-155
WP_001181229.1|1890040_1890337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125581.1|1890349_1891087_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182060.1|1891244_1892024_+	uridine phosphorylase	NA	NA	NA	NA	NA
WP_001159687.1|1892044_1893247_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	25.1	1.8e-17
>prophage 151
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1908898	1911400	2210718	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_000145178.1|1908898_1911400_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.8	0.0e+00
>prophage 152
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1927532	1987343	2210718	protease,integrase,transposase,holin	Bacillus_phage(15.79%)	71	1977184:1977199	1986888:1986903
WP_000684238.1|1927532_1928072_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	42.2	4.8e-31
WP_011058387.1|1928432_1928621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101136.1|1928840_1929608_+	CAMP factor pore-forming toxin Cfb	NA	NA	NA	NA	NA
WP_000162435.1|1929780_1930083_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001071071.1|1930239_1931103_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001223119.1|1931407_1931968_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.1	2.5e-19
WP_000355473.1|1931984_1932281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001036317.1|1932494_1933109_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000900244.1|1933357_1934434_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	40.4	6.9e-05
WP_001090962.1|1934435_1934642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000644459.1|1934638_1935541_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	3.3e-29
WP_001865799.1|1935555_1936299_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000403109.1|1936467_1936956_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000827865.1|1937477_1937813_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000589231.1|1937799_1938408_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_001191784.1|1938842_1939235_+	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_150352956.1|1939413_1940268_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	36.8	6.4e-30
WP_001867162.1|1940786_1940897_+	YydF family exported signaling peptide	NA	NA	NA	NA	NA
WP_000470461.1|1940954_1941572_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000901036.1|1941575_1942298_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001053209.1|1942865_1944434_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_000640387.1|1945139_1945532_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001031939.1|1945560_1947201_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.8	3.7e-50
WP_001281641.1|1947360_1948614_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	55.5	1.4e-126
WP_000808311.1|1951158_1951455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062569.1|1951476_1951938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079278488.1|1952014_1953676_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	31.6	1.9e-41
WP_011058384.1|1953906_1955196_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	28.6	8.2e-29
WP_000287183.1|1955211_1955589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000737133.1|1955572_1955872_+	helix-turn-helix transcriptional regulator	NA	G3MBD2	Bacillus_virus	50.0	3.6e-12
WP_000491711.1|1956068_1957418_+	AAA family ATPase	NA	V9QJ85	Oenococcus_phage	34.1	4.5e-70
WP_000010056.1|1957420_1957990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000017154.1|1958124_1958397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000383283.1|1958449_1958932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000560386.1|1958939_1959413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387490.1|1959557_1959824_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_000481712.1|1959816_1960071_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_000565539.1|1960123_1961077_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_001055037.1|1961097_1961364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390747.1|1961374_1961785_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_088181596.1|1962045_1962850_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001279020.1|1962897_1965168_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000357668.1|1965183_1967184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528441.1|1967373_1967517_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_000511832.1|1967679_1969053_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_000829082.1|1969052_1969601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000048867.1|1969617_1970409_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000578743.1|1970489_1971122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001188031.1|1971314_1971641_+	DUF771 domain-containing protein	NA	A0A1W6JPI1	Staphylococcus_phage	30.5	3.2e-06
WP_000257255.1|1971690_1972812_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	29.4	3.9e-27
WP_001009229.1|1973152_1974709_+	hypothetical protein	NA	Q38324	Lactococcus_phage	46.6	4.2e-128
WP_000221046.1|1974881_1975496_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_150352957.1|1975719_1976103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032465793.1|1976056_1976314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201152.1|1976428_1976848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483441.1|1976850_1977879_+	replication initiation factor domain-containing protein	NA	NA	NA	NA	NA
1977184:1977199	attL	GATATTTTTGATGAGT	NA	NA	NA	NA
WP_000184042.1|1977939_1978125_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_032458579.1|1978128_1979256_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	30.1	1.6e-41
WP_000564579.1|1979281_1979437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000705809.1|1979490_1980057_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.0	1.4e-20
WP_000355464.1|1980053_1980371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000578732.1|1980751_1981831_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001095354.1|1981820_1982027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000125376.1|1982023_1982926_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.2	5.5e-32
WP_000147179.1|1982922_1983684_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015632319.1|1983880_1984108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774760.1|1984199_1985468_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	46.0	2.1e-93
WP_000586891.1|1985460_1985952_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001051348.1|1986278_1986749_+	DUF3013 family protein	NA	NA	NA	NA	NA
WP_000364969.1|1986754_1986898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350744.1|1986884_1987343_+	NUDIX domain-containing protein	NA	A0A2I7SAS2	Vibrio_phage	43.1	5.0e-05
1986888:1986903	attR	GATATTTTTGATGAGT	NA	NA	NA	NA
>prophage 153
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	1994198	1997938	2210718		Bacillus_phage(66.67%)	4	NA	NA
WP_001874612.1|1994198_1994960_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	1.3e-13
WP_000621378.1|1994956_1995613_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000638639.1|1995612_1996290_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	8.6e-38
WP_000162279.1|1996282_1997938_+	sensor histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	23.6	2.9e-10
>prophage 154
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2002667	2003516	2210718		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000926594.1|2002667_2003516_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	3.0e-24
>prophage 155
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2017422	2019639	2210718		Bacillus_phage(100.0%)	1	NA	NA
WP_000237872.1|2017422_2019639_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	38.3	3.7e-13
>prophage 156
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2035176	2045909	2210718		Planktothrix_phage(25.0%)	10	NA	NA
WP_000229966.1|2035176_2036310_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.7	3.2e-21
WP_000716723.1|2036437_2038045_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_000279626.1|2038132_2039128_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	35.2	8.8e-47
WP_150352959.1|2039140_2039830_-	response regulator	NA	NA	NA	NA	NA
WP_000728117.1|2039831_2041358_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000786044.1|2041511_2042849_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	51.2	4.1e-15
WP_001293702.1|2042873_2044037_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_000286792.1|2044227_2044572_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_000056607.1|2044648_2044990_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_000469563.1|2045156_2045909_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.4	1.8e-23
>prophage 157
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2050077	2055191	2210718		Brevibacillus_phage(50.0%)	2	NA	NA
WP_000842268.1|2050077_2050662_+	glycoside hydrolase family 73 protein	NA	S5M9Y4	Brevibacillus_phage	34.7	3.8e-10
WP_001292137.1|2050784_2055191_+	DNA polymerase III subunit alpha	NA	A0A0A7RWA3	Clostridium_phage	33.0	6.9e-19
>prophage 158
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2069670	2070285	2210718		Synechococcus_phage(100.0%)	1	NA	NA
WP_001272875.1|2069670_2070285_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.2	1.8e-13
>prophage 159
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2073446	2075342	2210718		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_000599038.1|2073446_2075342_+	endopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.7	7.9e-73
>prophage 160
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2078961	2114677	2210718	terminase,integrase,protease,portal,holin,head,tail	Streptococcus_phage(95.92%)	51	2078942:2078965	2112820:2112843
2078942:2078965	attL	CGCCCCAAATTCGCCCCAAATTAT	NA	NA	NA	NA
WP_000179397.1|2078961_2080032_-|integrase	site-specific integrase	integrase	A0A1P8VVR7	Streptococcus_phage	100.0	2.1e-200
WP_001173134.1|2080153_2080558_-	DUF4429 domain-containing protein	NA	A0A1P8VVY3	Streptococcus_phage	100.0	8.1e-68
WP_001132094.1|2080610_2080997_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVS0	Streptococcus_phage	100.0	4.5e-68
WP_000114553.1|2080997_2081360_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVY1	Streptococcus_phage	100.0	3.0e-61
WP_011058377.1|2081508_2081664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000511144.1|2081645_2081810_+	hypothetical protein	NA	A0A1P8VVU2	Streptococcus_phage	100.0	1.8e-21
WP_001052630.1|2081792_2082263_-	hypothetical protein	NA	A0A1P8VVS1	Streptococcus_phage	98.7	8.8e-82
WP_011058376.1|2082224_2082533_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVQ4	Streptococcus_phage	91.3	4.8e-28
WP_001002368.1|2082535_2083246_+	hypothetical protein	NA	A0A1S5SF52	Streptococcus_phage	82.1	3.5e-114
WP_000998973.1|2083305_2083590_+	hypothetical protein	NA	A0A1P8VVZ3	Streptococcus_phage	93.6	2.5e-47
WP_001061697.1|2083606_2083822_+	hypothetical protein	NA	C5J986	Streptococcus_phage	62.0	6.1e-14
WP_000343908.1|2083830_2085162_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	98.0	7.7e-240
WP_079219474.1|2085161_2085767_+	hypothetical protein	NA	A0A1P8VVT8	Streptococcus_phage	63.5	4.2e-68
WP_000079054.1|2085744_2086491_+	hypothetical protein	NA	A0A1P8VVR3	Streptococcus_phage	98.4	1.5e-136
WP_001067867.1|2086491_2087313_+	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	92.3	2.9e-144
WP_000169322.1|2087503_2087995_+	hypothetical protein	NA	A0A1P8VVP1	Streptococcus_phage	95.7	4.9e-83
WP_000793494.1|2087994_2088324_+	DUF1372 family protein	NA	A0A1P8VVQ5	Streptococcus_phage	94.5	1.1e-54
WP_094750246.1|2088323_2088680_+	DUF3310 domain-containing protein	NA	M1NRN1	Streptococcus_phage	69.0	8.5e-37
WP_000748199.1|2088676_2088883_+	hypothetical protein	NA	A0A1P8VVV0	Streptococcus_phage	100.0	6.2e-32
WP_000609565.1|2088872_2089289_+	single-stranded DNA-binding protein	NA	A0A1P8VVS8	Streptococcus_phage	100.0	8.6e-73
WP_111695115.1|2089362_2089440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000561483.1|2089869_2091189_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	39.5	7.3e-57
WP_001008140.1|2091321_2091582_+	hypothetical protein	NA	A0A1P8VVV2	Streptococcus_phage	100.0	9.9e-43
WP_011058373.1|2091566_2091926_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVV5	Streptococcus_phage	100.0	4.1e-63
WP_000163169.1|2091922_2092387_+	hypothetical protein	NA	A0A1P8VVT5	Streptococcus_phage	100.0	1.8e-82
WP_001028147.1|2092496_2093039_+|integrase	site-specific integrase	integrase	A0A1S5SCL7	Streptococcus_phage	100.0	9.8e-101
WP_000651009.1|2093328_2093616_+	hypothetical protein	NA	A0A1P8VVZ1	Streptococcus_phage	100.0	3.6e-46
WP_000542279.1|2093615_2093975_+	HNH endonuclease	NA	A0A1P8VVU5	Streptococcus_phage	100.0	6.3e-64
WP_000601035.1|2094062_2094548_+	hypothetical protein	NA	A0A1P8VVU4	Streptococcus_phage	99.4	1.9e-79
WP_000230004.1|2094540_2096253_+|terminase	terminase large subunit	terminase	A0A1P8VVW5	Streptococcus_phage	100.0	0.0e+00
WP_001067328.1|2096261_2097404_+|portal	phage portal protein	portal	A0A1P8VVT4	Streptococcus_phage	100.0	6.6e-216
WP_000413200.1|2097453_2097996_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1P8VVX2	Streptococcus_phage	100.0	2.7e-98
WP_000749070.1|2098006_2099269_+	hypothetical protein	NA	A0A1P8VVT0	Streptococcus_phage	100.0	2.6e-229
WP_000153862.1|2099289_2099625_+	hypothetical protein	NA	A0A1P8VVS7	Streptococcus_phage	100.0	7.0e-57
WP_000842789.1|2099621_2099927_+|head,tail	head-tail adaptor protein	head,tail	A0A1P8VVX4	Streptococcus_phage	100.0	5.8e-42
WP_001074486.1|2099926_2100274_+	hypothetical protein	NA	A0A1P8VVS6	Streptococcus_phage	100.0	1.1e-60
WP_000508738.1|2100260_2100605_+	hypothetical protein	NA	A0A1P8VVU6	Streptococcus_phage	100.0	1.5e-59
WP_071661714.1|2100619_2101303_+|tail	phage tail protein	tail	A0A1P8VVR1	Streptococcus_phage	99.6	3.4e-127
WP_000591558.1|2101302_2101779_+	hypothetical protein	NA	A0A1P8VVU0	Streptococcus_phage	100.0	9.2e-87
WP_011058372.1|2101817_2101946_+	hypothetical protein	NA	A0A0A0YRS9	Streptococcus_phage	90.5	1.6e-14
WP_071661713.1|2101964_2104700_+|tail	phage tail tape measure protein	tail	A0A1P8VVW8	Streptococcus_phage	99.6	4.7e-268
WP_000161557.1|2104696_2105419_+	hypothetical protein	NA	A0A1P8VVR4	Streptococcus_phage	100.0	2.8e-135
WP_071661712.1|2105419_2109094_+	hypothetical protein	NA	A0A1P8VVT1	Streptococcus_phage	99.9	0.0e+00
WP_001071121.1|2109110_2109341_+	hypothetical protein	NA	A0A1P8VVV7	Streptococcus_phage	100.0	2.9e-30
WP_000213866.1|2109343_2109682_+	hypothetical protein	NA	A0A1P8VVU3	Streptococcus_phage	100.0	4.3e-62
WP_001135353.1|2109716_2110127_+	hypothetical protein	NA	A0A1P8VVS2	Streptococcus_phage	100.0	2.0e-69
WP_000192161.1|2110129_2110459_+|holin	phage holin	holin	A0A1P8VVR0	Streptococcus_phage	100.0	4.8e-50
WP_000405192.1|2110462_2111869_+	muramidase	NA	A0A1P8VVS3	Streptococcus_phage	100.0	6.9e-231
WP_000139836.1|2112075_2112261_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1P8VVU8	Streptococcus_phage	100.0	2.6e-29
WP_000878126.1|2112321_2112726_+	HicB family protein	NA	A0A1P8VVW2	Streptococcus_phage	100.0	1.4e-67
WP_000242129.1|2113144_2114677_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	28.7	9.1e-19
2112820:2112843	attR	CGCCCCAAATTCGCCCCAAATTAT	NA	NA	NA	NA
>prophage 161
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2118689	2126671	2210718	protease,tRNA	Streptococcus_phage(50.0%)	7	NA	NA
WP_000020289.1|2118689_2121137_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.4	1.5e-124
WP_000586895.1|2121356_2121848_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000909526.1|2121861_2122503_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	49.5	4.9e-51
WP_000192730.1|2122623_2123601_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000357824.1|2123584_2124460_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001285393.1|2124599_2125856_-	hypothetical protein	NA	M1PLC8	Streptococcus_phage	63.3	2.5e-123
WP_000239573.1|2125852_2126671_-	hypothetical protein	NA	M1PFV6	Streptococcus_phage	36.0	2.0e-28
>prophage 162
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2131644	2132937	2210718		Megavirus(100.0%)	1	NA	NA
WP_000205037.1|2131644_2132937_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.7	5.1e-71
>prophage 163
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2139047	2143071	2210718		Cyanophage(50.0%)	4	NA	NA
WP_000873297.1|2139047_2139695_+	fructose-6-phosphate aldolase	NA	M4SIN4	Cyanophage	43.5	4.5e-44
WP_000462134.1|2139858_2140842_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000700534.1|2141076_2142096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358398.1|2142114_2143071_+	dihydrofolate reductase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	29.8	2.3e-28
>prophage 164
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2153992	2155216	2210718		Bacillus_virus(100.0%)	1	NA	NA
WP_000181803.1|2153992_2155216_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.6e-29
>prophage 165
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2160787	2165592	2210718		Bacillus_phage(33.33%)	5	NA	NA
WP_001238594.1|2160787_2161462_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	9.5e-29
WP_000490535.1|2161461_2162649_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000806142.1|2162659_2162782_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_000581010.1|2162794_2164330_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.0	5.5e-40
WP_150352961.1|2164326_2165592_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.1	2.5e-22
>prophage 166
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2180178	2182257	2210718		Streptococcus_phage(100.0%)	1	NA	NA
WP_000090323.1|2180178_2182257_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	29.6	6.7e-65
>prophage 167
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2192646	2201003	2210718	tRNA	Moraxella_phage(33.33%)	10	NA	NA
WP_000655087.1|2192646_2193657_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.8	1.2e-56
WP_000902186.1|2193776_2194802_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011058370.1|2194838_2194955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001085659.1|2195162_2195432_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_000338252.1|2195590_2196373_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_000683561.1|2196416_2197589_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	54.2	4.0e-14
WP_000215421.1|2197723_2198260_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_000811662.1|2198303_2198891_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_001292007.1|2199017_2199743_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000244923.1|2199812_2201003_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	34.8	5.7e-45
>prophage 168
NZ_CP044090	Streptococcus agalactiae strain FDAARGOS_670 chromosome, complete genome	2210718	2207869	2209588	2210718		Bacillus_phage(100.0%)	1	NA	NA
WP_000884540.1|2207869_2209588_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.1	7.3e-25
