The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044039	Klebsiella pneumoniae strain FDAARGOS_630 chromosome, complete genome	5266224	318532	325437	5266224	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|318532_319396_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_039819854.1|319406_320180_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_002912636.1|320420_321314_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_039819857.1|321559_322921_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_004175198.1|323239_323962_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|323958_325437_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
NZ_CP044039	Klebsiella pneumoniae strain FDAARGOS_630 chromosome, complete genome	5266224	368047	383163	5266224	transposase	Enterobacteria_phage(30.0%)	14	NA	NA
WP_001118645.1|368047_368971_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_000043543.1|369846_371253_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|371479_372895_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|372916_374287_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|374441_375506_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819507.1|375519_376389_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
WP_004175259.1|376420_377311_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|377325_377880_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_039819510.1|378059_379226_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_039819538.1|379618_380626_+	acyltransferase	NA	NA	NA	NA	NA
WP_077255456.1|380840_380945_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004144151.1|381636_381759_-	small membrane protein	NA	NA	NA	NA	NA
WP_045327201.1|381895_382090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039819511.1|382158_383163_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 3
NZ_CP044039	Klebsiella pneumoniae strain FDAARGOS_630 chromosome, complete genome	5266224	445195	480302	5266224	terminase,protease,portal,head,integrase,lysis,transposase,tail,capsid	Enterobacteria_phage(31.58%)	44	445022:445081	485169:485232
445022:445081	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_023317562.1|445195_446188_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	86.9	1.1e-174
WP_004184757.1|446189_446417_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_023317563.1|446456_447287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039817954.1|447886_448672_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.1e-60
WP_039817952.1|448671_448971_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	7.2e-13
WP_039817950.1|449060_449978_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.5	1.5e-45
WP_023317570.1|450691_451387_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_001191665.1|451484_451727_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_039817948.1|451761_452223_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	6.4e-69
WP_071557781.1|452460_452673_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_039817942.1|452629_453544_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
WP_039817939.1|453540_454350_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	3.5e-110
WP_039817937.1|454359_454737_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.2	6.7e-48
WP_039817935.1|454749_455730_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	6.4e-135
WP_039817933.1|455743_456322_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_004151282.1|457029_457278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039817927.1|457280_457811_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	80.0	3.2e-80
WP_039817926.1|457807_458272_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	62.9	1.6e-43
WP_039817923.1|458346_458685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071557779.1|458979_459138_+	rz1 lytic protein	NA	NA	NA	NA	NA
WP_039817921.1|459474_459870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039817920.1|460069_460315_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	65.4	1.2e-18
WP_039817918.1|460370_460712_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
WP_039817917.1|460894_461359_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	6.3e-48
WP_039817916.1|461312_463055_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.6	2.0e-139
WP_039817913.1|463054_464362_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.4	4.3e-211
WP_039817990.1|464374_465223_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	1.0e-128
WP_004886697.1|465232_466450_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.4	3.9e-182
WP_064167184.1|466492_466735_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	3.0e-09
WP_039817908.1|466734_467061_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	68.5	1.2e-40
WP_004884319.1|467072_467411_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
WP_039817904.1|467407_467857_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	1.9e-62
WP_039817902.1|467853_468201_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.1	4.0e-31
WP_039817900.1|468257_468962_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	7.2e-80
WP_039817897.1|468992_469397_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	1.7e-33
WP_039817895.1|469399_469705_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	8.1e-28
WP_039817893.1|469809_470565_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.9e-34
WP_039817891.1|470561_472061_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_039817888.1|472194_472428_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	45.8	3.2e-08
WP_039817884.1|472488_475878_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	1.5e-303
WP_004177132.1|475898_476372_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|476358_476835_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_039817877.1|476847_477228_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	3.6e-57
WP_039817875.1|477224_480302_+	kinase	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
485169:485232	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
>prophage 4
NZ_CP044039	Klebsiella pneumoniae strain FDAARGOS_630 chromosome, complete genome	5266224	484330	490170	5266224		Burkholderia_phage(33.33%)	8	NA	NA
WP_032443530.1|484330_484570_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	6.8e-22
WP_039817864.1|484526_484898_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	5.4e-26
WP_039817862.1|485502_486648_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	8.4e-118
WP_014343263.1|487039_487306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705175.1|487186_487468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|487510_488218_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_039817858.1|488261_489695_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	8.9e-101
WP_004200342.1|489675_490170_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
>prophage 5
NZ_CP044039	Klebsiella pneumoniae strain FDAARGOS_630 chromosome, complete genome	5266224	1331684	1342571	5266224		Escherichia_phage(87.5%)	9	NA	NA
WP_032433071.1|1331684_1334792_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|1334846_1336112_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|1336142_1337231_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|1337317_1337578_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|1337875_1338736_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|1338756_1339518_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|1339778_1340681_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|1340692_1341958_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|1341950_1342571_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP044039	Klebsiella pneumoniae strain FDAARGOS_630 chromosome, complete genome	5266224	2018489	2027954	5266224	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_032432850.1|2018489_2020211_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|2020255_2020957_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2021310_2021529_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2021650_2023930_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2023960_2024278_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2024603_2024825_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004209695.1|2024901_2026842_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2026838_2027954_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
NZ_CP044039	Klebsiella pneumoniae strain FDAARGOS_630 chromosome, complete genome	5266224	4527197	4567171	5266224	terminase,portal,head,holin,integrase,plate,tRNA,lysis,tail,capsid	Salmonella_phage(24.44%)	49	4526646:4526661	4557665:4557680
4526646:4526661	attL	GCAATGATGGCATTTA	NA	NA	NA	NA
WP_087835425.1|4527197_4528196_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.9	1.7e-191
WP_032433588.1|4528195_4528771_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_001630878.1|4528900_4529164_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_039818858.1|4529194_4529704_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	8.9e-88
WP_023343330.1|4529711_4529912_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
WP_032433585.1|4529875_4530214_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_032433580.1|4530281_4530509_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
WP_032433578.1|4530508_4530730_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	5.5e-34
WP_032433576.1|4530731_4532948_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.2	0.0e+00
WP_048292468.1|4533066_4533507_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	3.4e-67
WP_071557792.1|4534127_4534436_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.1	2.4e-11
WP_032433573.1|4534413_4535364_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	8.7e-36
WP_032433571.1|4535502_4535934_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.7	2.9e-71
WP_032433569.1|4535932_4536127_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	4.7e-13
WP_032433567.1|4536639_4537683_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
WP_009309687.1|4537682_4539452_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
WP_032433566.1|4539617_4540472_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	9.6e-127
WP_087835427.1|4540545_4541604_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.5	7.1e-164
WP_032433565.1|4541607_4542351_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	78.9	9.6e-99
WP_009309691.1|4542447_4542954_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|4542953_4543157_+|tail	tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_032433564.1|4543161_4543452_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
WP_032433563.1|4543438_4543936_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	84.8	4.8e-78
WP_032433560.1|4543932_4544364_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	1.1e-41
WP_115722967.1|4544245_4544497_+|holin	holin	holin	S4TNY4	Salmonella_phage	72.5	2.6e-24
WP_032433558.1|4544459_4544927_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	9.1e-63
WP_032433555.1|4544919_4545369_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
WP_045326985.1|4545697_4546741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015959011.1|4547083_4547725_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_014343405.1|4547721_4548069_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_032433553.1|4548073_4548982_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
WP_023322996.1|4548974_4549577_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	57.6	1.0e-53
WP_125116968.1|4549512_4551843_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.2e-108
WP_032433551.1|4551848_4552577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032433550.1|4552588_4553668_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.3	4.7e-30
WP_019724797.1|4553777_4554959_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
WP_032433549.1|4554972_4555488_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.2e-68
WP_004195711.1|4555548_4555824_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_015959005.1|4555838_4555976_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
WP_032433547.1|4555968_4558407_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	2.1e-299
4557665:4557680	attR	TAAATGCCATCATTGC	NA	NA	NA	NA
WP_023343304.1|4558423_4558903_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
WP_032433545.1|4558902_4560063_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.6	8.3e-174
WP_032433542.1|4560103_4560511_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	1.2e-26
WP_023343301.1|4560604_4560823_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_002917636.1|4561181_4561688_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|4561787_4563629_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917631.1|4563847_4565593_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|4565704_4565920_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002916879.1|4566157_4567171_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 1
NZ_CP044035	Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence	114306	790	41525	114306	transposase,integrase	Salmonella_phage(22.22%)	37	17919:17978	37941:38199
WP_008322208.1|790_1582_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	1.4e-50
WP_016479957.1|1780_3103_-	GntP family transporter	NA	NA	NA	NA	NA
WP_089046468.1|4039_5160_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.0e-51
WP_022652311.1|6900_7890_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
WP_022652312.1|8745_9015_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_016479963.1|9018_9549_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087728544.1|9680_10697_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_004201176.1|12345_13986_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_004201172.1|14041_14332_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201171.1|14525_14855_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201169.1|14859_15891_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|15901_16540_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|16544_16910_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|16913_17726_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
17919:17978	attL	TAGGGGTCAGTTTGGATATAGAGAATTATTGTACGGTAAGCCTGTTTTTTGAACAGACTT	NA	NA	NA	NA
WP_000855769.1|18283_19129_-	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_071534640.1|19270_19465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003149906.1|19425_20955_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_099184378.1|21694_22459_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016479967.1|22492_23179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015460531.1|23175_24108_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015460530.1|24109_25075_+	TniQ family protein	NA	NA	NA	NA	NA
WP_033646557.1|25628_26558_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033637916.1|26708_26969_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_101456369.1|27017_28088_-	fimbrial protein	NA	NA	NA	NA	NA
WP_033646559.1|28106_30599_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_033646560.1|30614_31310_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033637910.1|31358_31943_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000608644.1|32504_33767_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_150388093.1|33863_34058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072921.1|34190_35030_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.5	2.9e-11
WP_031974050.1|34959_35139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376617.1|35157_35400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183923.1|35483_35783_-	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_016479969.1|35896_36067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072920.1|37332_37992_+	endonuclease III	NA	NA	NA	NA	NA
WP_032160673.1|39144_40101_-	hypothetical protein	NA	NA	NA	NA	NA
37941:38199	attR	TAGGGGTCAGTTTGGATATAGAGAATTATTGTACGGTAAGCCTGTTTTTTGAACAGACTTACCTATAGCAATAGGGTGTCCTCCCGCGCTATACGGCATTTTCAGAGGTTTGACCTTAATCGGATAACCTAAATGCGATACTGCAAGAGCGACAACTTAAAAGCGATAGCCACTGACGCAAAATCAACCACTTACGAACCAAGATTGGTTAAATAATGCGCTTAACGTACAAAAATTTCCGTTCTCCAAACTGACCCCT	NA	NA	NA	NA
WP_000019445.1|40544_41525_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 2
NZ_CP044035	Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence	114306	91490	103804	114306	transposase	Enterobacteria_phage(30.0%)	15	NA	NA
WP_032072906.1|91490_91751_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
WP_015493073.1|91937_92129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|92171_92678_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493075.1|93082_93862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016479994.1|93915_94335_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493077.1|94345_94567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|94566_95244_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493079.1|95602_96274_+	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_000343760.1|96497_97718_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_015493080.1|97777_98200_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493081.1|98199_99471_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_016479949.1|99606_100578_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493083.1|100574_101780_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479950.1|102142_102775_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.7	1.6e-06
WP_001118645.1|102880_103804_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
>prophage 1
NZ_CP044036	Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence	151028	3317	45762	151028	transposase,integrase	Escherichia_phage(25.0%)	42	31406:31422	50483:50499
WP_150388094.1|3317_4286_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	2.7e-178
WP_085850945.1|4278_4464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901247.1|4624_5836_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_020481021.1|5922_6876_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.0	1.7e-10
WP_004118155.1|7032_7881_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017901245.1|7904_8576_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017901244.1|8572_9235_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017901243.1|9239_10058_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.8e-29
WP_017901242.1|10054_11020_+	DMT family transporter	NA	NA	NA	NA	NA
WP_047681302.1|12972_13896_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	4.3e-173
WP_032414405.1|13982_14441_-	hypothetical protein	NA	G8C7Q9	Escherichia_phage	55.0	5.1e-42
WP_023287162.1|14449_14986_-	hypothetical protein	NA	G8C7Q8	Escherichia_phage	42.5	1.9e-27
WP_113707494.1|15096_15450_-	hypothetical protein	NA	A0A2H4IBK3	Erwinia_phage	51.0	1.7e-24
WP_023287161.1|15474_16398_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	4.7e-172
WP_023287163.1|16513_17767_-	lactose permease	NA	NA	NA	NA	NA
WP_001118645.1|18839_19763_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_004181763.1|20632_20875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|20922_21387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409750.1|21396_21804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|21846_22806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|22802_23561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946351.1|23557_23887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026552.1|24031_24349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386529.1|24414_25551_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016946352.1|25727_25982_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014386530.1|26067_27135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|28534_29419_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_000427619.1|30334_31339_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
31406:31422	attL	AAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_117042284.1|31417_34384_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_011152976.1|35121_35781_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.1	4.2e-130
WP_001067855.1|36002_36707_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|36916_37267_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|37469_38483_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000237816.1|38655_39108_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_001317507.1|39241_39715_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_021566672.1|39865_41092_+	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_000679427.1|41274_41622_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|41615_42455_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|42384_42564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|42582_43083_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|43051_44044_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|44046_45762_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
50483:50499	attR	CTTAGCGTGCTTTATTT	NA	NA	NA	NA
>prophage 2
NZ_CP044036	Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence	151028	56829	125733	151028	transposase,integrase	Enterobacteria_phage(24.0%)	59	56753:56799	87690:87736
56753:56799	attL	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATC	NA	NA	NA	NA
WP_001118645.1|56829_57753_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_014386537.1|57977_58625_+	EcsC family protein	NA	NA	NA	NA	NA
WP_032430779.1|58756_60256_-	kinase	NA	NA	NA	NA	NA
WP_032412835.1|60283_62017_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001118645.1|63648_64572_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_000134999.1|65204_65846_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_078310596.1|66874_67072_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	57.4	1.2e-11
WP_071886836.1|67139_67355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031942322.1|67435_68104_-	tetracycline resistance transcriptional repressor TetR	NA	NA	NA	NA	NA
WP_031942321.1|68204_69404_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_013851371.1|69918_70422_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001067855.1|70458_71163_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001749988.1|71474_72044_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_015344971.1|72183_72468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|72436_73450_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032488343.1|74222_75482_+	EreB family erythromycin esterase	NA	NA	NA	NA	NA
WP_014386554.1|76563_77166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045372405.1|79601_80051_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	36.9	4.1e-12
WP_117035083.1|80097_81021_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	7.3e-173
WP_023287210.1|81109_81325_-	hypothetical protein	NA	J9Q747	Salmonella_phage	71.7	3.2e-15
WP_045372388.1|84034_84544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181916.1|86088_86553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217257.1|86552_87341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112035439.1|87813_88737_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	4.7e-172
87690:87736	attR	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATC	NA	NA	NA	NA
WP_017146595.1|88857_89211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050515775.1|89330_90404_+	FUSC family protein	NA	NA	NA	NA	NA
WP_150388095.1|90484_91408_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	2.4e-171
WP_023288221.1|91962_93195_+	MFS transporter	NA	NA	NA	NA	NA
WP_023288222.1|93324_94761_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_023287222.1|94747_95371_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_023287223.1|95387_96257_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_023287224.1|96267_97182_+	alpha/beta hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	28.0	9.0e-06
WP_023287225.1|97214_98153_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023287226.1|98204_99743_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	3.0e-280
WP_000612626.1|99791_100139_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_023287227.1|100135_100540_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.0	2.1e-68
WP_071838905.1|100585_100816_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	98.5	5.9e-31
WP_016151366.1|101045_101480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152084.1|101695_103096_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|103092_103773_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|103827_104757_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|104761_105142_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|105181_106078_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|106077_107895_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|108128_108578_+	copper resistance protein	NA	NA	NA	NA	NA
WP_000287501.1|108866_109604_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_000843497.1|109637_109835_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004187133.1|109875_112323_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	4.4e-84
WP_000758228.1|112449_112890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|112976_116123_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004098959.1|116133_117426_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|117539_117893_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475503.1|117921_119307_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|119496_120177_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555737.1|120169_121645_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|121895_122327_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000694953.1|122470_122821_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
WP_001372261.1|123208_124117_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_047681302.1|124809_125733_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	4.3e-173
>prophage 1
NZ_CP044037	Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed3, complete sequence	23368	0	2411	23368	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_117264688.1|1487_2411_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.8	6.0e-167
>prophage 2
NZ_CP044037	Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed3, complete sequence	23368	9512	11872	23368		Macacine_betaherpesvirus(50.0%)	2	NA	NA
WP_001568031.1|9512_10268_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
WP_017901447.1|11239_11872_+	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.8e-29
>prophage 3
NZ_CP044037	Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed3, complete sequence	23368	16765	23182	23368	transposase	Salmonella_phage(40.0%)	6	NA	NA
WP_000239590.1|16765_17641_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_094929366.1|17896_19159_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_087835521.1|19722_20280_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.5	1.2e-93
WP_000027057.1|20462_21323_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_017900922.1|21687_21966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805503.1|22228_23182_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
>prophage 1
NZ_CP044038	Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence	77529	63237	74239	77529	integrase	Escherichia_phage(37.5%)	12	61638:61650	68329:68341
61638:61650	attL	TGATGAACTGCCT	NA	NA	NA	NA
WP_150388108.1|63237_64032_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	7.2e-52
WP_006788217.1|64463_64643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|64762_65389_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004197644.1|66029_66905_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.8	1.1e-82
WP_150388109.1|67316_68588_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	62.6	3.7e-151
68329:68341	attR	AGGCAGTTCATCA	NA	NA	NA	NA
WP_001568036.1|68587_69019_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_009483812.1|69178_69430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|69429_70914_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568038.1|71162_72134_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_015345000.1|72136_72808_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|72870_73101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|73537_74239_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
