The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	18179	97449	1972387	integrase,tRNA,transposase	Wolbachia_phage(22.22%)	49	30107:30132	73084:73109
WP_150338845.1|18179_19184_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150338847.1|19168_20272_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_045918451.1|20572_21397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338849.1|24215_25142_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	60.1	7.5e-85
WP_109227713.1|25526_25979_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_150338851.1|27464_27968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227461.1|28014_28659_-	hypothetical protein	NA	K7Y837	Megavirus	34.4	6.7e-16
30107:30132	attL	CAAACTTCATTGTAAATGACTATATA	NA	NA	NA	NA
WP_150338853.1|30644_31271_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_109227463.1|31353_32772_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011944928.1|32778_33906_+	cell division protein FtsW	NA	NA	NA	NA	NA
WP_045919112.1|33909_34989_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_109227464.1|36593_36806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227465.1|38721_39018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227466.1|39930_40161_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011944734.1|41108_41543_-	CopD family protein	NA	NA	NA	NA	NA
WP_150338855.1|41551_42586_-	ferrochelatase	NA	NA	NA	NA	NA
WP_150338857.1|42578_43607_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_150338859.1|45096_46602_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_150340414.1|47341_47530_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_150338861.1|48570_49854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150338863.1|50493_52362_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_045915711.1|52519_53173_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	34.1	6.4e-22
WP_150338865.1|53165_54239_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_150338867.1|54309_54993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338869.1|55001_56366_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_150338871.1|56431_59101_-	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	30.7	2.1e-42
WP_150338873.1|59537_60989_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_045918164.1|61809_62640_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_150338875.1|62796_63150_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150338877.1|64125_64998_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_150338879.1|66967_68365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150338881.1|69413_72641_+	response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	2.4e-21
WP_109227491.1|74348_74588_-	hypothetical protein	NA	NA	NA	NA	NA
73084:73109	attR	TATATAGTCATTTACAATGAAGTTTG	NA	NA	NA	NA
WP_012460882.1|75155_76163_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_150338883.1|76241_76799_+	ankyrin repeat domain-containing protein	NA	K7Y837	Megavirus	32.9	9.3e-14
WP_150338885.1|76843_77347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150338887.1|78296_79025_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045919583.1|79922_80498_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9L285	Tupanvirus	28.9	5.7e-06
WP_045919584.1|80618_81593_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	3.9e-84
WP_080503971.1|82183_82258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150338889.1|82722_86160_-	response regulator	NA	A0A1V0SGX0	Hokovirus	22.2	4.7e-15
WP_045915350.1|86983_87358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045915347.1|87662_88814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150338891.1|89330_89612_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045915056.1|89650_89848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338893.1|89985_90330_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_150338895.1|92683_93508_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_150340416.1|95343_96438_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_150338897.1|96489_97449_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	155685	226415	1972387	protease,integrase,tail,head,transposase,tRNA,capsid	Bacillus_phage(16.67%)	53	155362:155387	186483:186508
155362:155387	attL	TATATAATATAACTGTTTTATAGTGG	NA	NA	NA	NA
WP_108884077.1|155685_155859_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_150338943.1|156132_156939_-	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	33.1	3.7e-11
WP_109227403.1|157967_158294_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150338945.1|159211_159826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338947.1|159812_160424_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_150338949.1|160941_161778_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_150338951.1|163429_163885_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_150338953.1|163982_164546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150338955.1|164632_165208_-	HD domain-containing protein	NA	A0A2K9L285	Tupanvirus	28.9	5.7e-06
WP_150338887.1|166105_166834_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_150338885.1|167783_168287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338957.1|168333_168963_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	31.9	1.2e-12
WP_150338959.1|169198_170647_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.1	1.1e-71
WP_150338961.1|170655_171702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338963.1|171698_172199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918161.1|172794_173178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918162.1|173241_173841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045916011.1|174145_175072_+	AEC family transporter	NA	NA	NA	NA	NA
WP_150338965.1|175091_176393_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_150338967.1|177418_178300_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_150338969.1|178540_178945_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_064591327.1|178941_180378_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_052692508.1|180723_181863_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_150338971.1|181898_182672_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_150338973.1|183057_185055_-	transglycosylase SLT domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	4.4e-05
WP_045916193.1|185096_186035_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_109227718.1|186774_186981_-	hypothetical protein	NA	NA	NA	NA	NA
186483:186508	attR	CCACTATAAAACAGTTATATTATATA	NA	NA	NA	NA
WP_045914669.1|190944_191979_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.7	2.4e-31
WP_150338975.1|191975_194417_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_150338977.1|194502_195432_-	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_041621781.1|195428_196289_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_109227499.1|196631_197483_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_150338979.1|197466_199119_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.6	9.4e-46
WP_150340422.1|199268_199445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338981.1|199929_201414_-	PRANC domain-containing protein	NA	A0A1V0S7Q4	Shearwaterpox_virus	27.2	1.7e-09
WP_109227496.1|202580_204092_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_150338983.1|204424_204634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150338985.1|204929_206822_+	DUF1601 domain-containing protein	NA	NA	NA	NA	NA
WP_150338987.1|208341_209901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338989.1|212589_214188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150338991.1|214728_215112_-	glutaredoxin	NA	A0A223FNA2	NY_014_poxvirus	41.2	9.6e-10
WP_045914457.1|215319_215748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338993.1|215845_216649_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_150338995.1|216661_217264_-	TIGR02217 family protein	NA	A0A1W6DWM9	Sphingobium_phage	33.0	1.8e-18
WP_150338997.1|217256_217682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146695262.1|217681_218023_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_150338999.1|218024_218570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339001.1|218603_219719_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	40.3	4.9e-54
WP_011944605.1|219730_220285_-|head,protease	HK97 family phage prohead protease	head,protease	I6S2W2	Marinomonas_phage	44.6	1.7e-23
WP_150339003.1|220962_221934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045914450.1|222017_223379_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_045918176.1|223583_224849_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_150339005.1|225539_226415_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	322035	414110	1972387	portal,integrase,tRNA,transposase	Salmonella_phage(18.18%)	60	313270:313305	401592:401627
313270:313305	attL	ATAATTTTGAACTACCTTAACCAGTTTCGAAAGAGG	NA	NA	NA	NA
WP_150339078.1|322035_323043_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150340432.1|323052_324099_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_150339080.1|326753_329225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339082.1|333941_334502_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	41.8	1.5e-24
WP_150339084.1|334611_335814_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150339086.1|336064_337756_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_150339088.1|340394_340724_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_045917953.1|340723_340906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338911.1|340935_341253_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_045917956.1|341252_341588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338913.1|341713_341890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227528.1|343578_347016_-	response regulator	NA	A0A1V0SGX0	Hokovirus	22.2	6.2e-15
WP_150339090.1|347769_348438_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	47.5	5.5e-37
WP_045917137.1|348656_349166_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_150339092.1|349189_350224_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	44.3	7.2e-68
WP_150339094.1|350240_351032_+	NAD kinase	NA	NA	NA	NA	NA
WP_150339096.1|351123_352353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011944822.1|352339_352798_-	protein TolR	NA	NA	NA	NA	NA
WP_150339098.1|352803_353493_-	protein TolQ	NA	NA	NA	NA	NA
WP_150339100.1|353663_354677_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_109227535.1|355372_356056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339102.1|356298_357828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339104.1|358146_359251_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_150339106.1|359398_361204_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	32.6	5.7e-20
WP_150339108.1|362794_363655_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_150339110.1|363733_364201_-	single-stranded DNA-binding protein	NA	A0A1B1IVU7	uncultured_Mediterranean_phage	51.9	1.0e-37
WP_109227540.1|364469_364952_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_150339112.1|365330_365495_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_150339114.1|365511_365805_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_109227542.1|366017_366179_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_045918756.1|367028_367580_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150339116.1|367977_368136_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_150340434.1|369027_369648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339118.1|372490_372724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339120.1|372786_374127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339122.1|374172_374616_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_150339124.1|375035_377252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339126.1|377777_379067_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_150339128.1|379629_380256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339130.1|380408_380936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339132.1|380941_381517_-	HD domain-containing protein	NA	A0A1X9SH80	Bradyrhizobium_phage	41.5	1.0e-07
WP_150338887.1|382496_383225_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_150338885.1|384174_384678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338957.1|384724_385354_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	31.9	1.2e-12
WP_150338959.1|385589_387038_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.1	1.1e-71
WP_150340436.1|387046_387793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339134.1|388896_390684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339136.1|390815_392006_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	37.1	3.1e-59
WP_150339138.1|392020_392287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011945001.1|392712_392952_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_150339140.1|393130_394702_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_150339142.1|396412_397099_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_150339144.1|397575_398658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045914809.1|402386_403568_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	1.4e-14
401592:401627	attR	ATAATTTTGAACTACCTTAACCAGTTTCGAAAGAGG	NA	NA	NA	NA
WP_150339146.1|404547_404745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339148.1|406922_407591_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_045918742.1|408951_409983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339150.1|410097_410268_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109227549.1|412322_413123_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_150339152.1|413174_414110_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	554420	616746	1972387	integrase,tRNA,transposase	Wolbachia_phage(12.5%)	45	573607:573628	618578:618599
WP_150339234.1|554420_555359_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	60.9	1.7e-84
WP_150339236.1|556178_556373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339238.1|558511_559987_-	PRANC domain-containing protein	NA	Q70GU1	Fowlpox_virus	28.3	1.3e-06
WP_150339239.1|563341_563956_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_150339241.1|563960_564527_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	39.7	6.5e-23
WP_150339243.1|566293_567985_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_150339245.1|567981_568365_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_150340450.1|568387_569356_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_012460825.1|569365_569569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339247.1|569655_570315_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_045917984.1|572780_573110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227581.1|573109_573571_-	conjugal transfer protein	NA	NA	NA	NA	NA
573607:573628	attL	AATGAAATTTTACTTTGAAGCA	NA	NA	NA	NA
WP_045919541.1|573682_574084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041621693.1|574632_574968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340452.1|575020_575449_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	38.2	6.1e-05
WP_045917985.1|577617_578901_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_150339249.1|580418_580682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339251.1|583322_585251_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_150339253.1|585296_587195_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_150339255.1|587343_588264_+	EamA family transporter	NA	NA	NA	NA	NA
WP_150339257.1|588301_589657_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_150339259.1|589656_590229_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_150339261.1|590232_590736_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_150339263.1|590976_591699_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_150339265.1|591693_592161_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_150339267.1|592488_593418_-	tyrosine recombinase	NA	S5W9T9	Leptospira_phage	30.0	3.2e-19
WP_150339269.1|593761_595135_+	TolC family protein	NA	NA	NA	NA	NA
WP_150339271.1|595179_595752_+	DUF2497 domain-containing protein	NA	NA	NA	NA	NA
WP_150339273.1|595753_597637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146695850.1|597684_598449_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_012460802.1|598445_598820_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_150339275.1|598846_601042_+	ATP-dependent RecD-like DNA helicase	NA	A0A0H3UZA5	Geobacillus_virus	27.6	1.1e-54
WP_150339277.1|601663_602566_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_045912308.1|602546_603443_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_109227587.1|603445_603907_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.9	2.5e-28
WP_045918603.1|603927_604836_+	signal peptide peptidase SppA	NA	A0A0F6TJW1	Escherichia_coli_O157_typing_phage	31.6	1.4e-19
WP_150339279.1|604846_605755_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_150339281.1|605775_606222_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_150339283.1|607419_607614_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109227588.1|608633_609176_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_109227589.1|609459_609795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339285.1|610344_610746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227590.1|610833_611328_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150339287.1|615403_616240_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_150340454.1|616317_616746_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
618578:618599	attR	TGCTTCAAAGTAAAATTTCATT	NA	NA	NA	NA
>prophage 5
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	793790	876950	1972387	integrase,transposase	Pseudomonas_phage(16.67%)	55	790980:791033	825597:825650
790980:791033	attL	TTCGCCTCGCTCTTTATCTCTAATTTTCCACTTAGTTTGTTAACAATGTAATTT	NA	NA	NA	NA
WP_150340468.1|793790_794549_-|integrase	tyrosine-type recombinase/integrase	integrase	B6SD77	Bacteriophage	33.5	1.8e-15
WP_109227638.1|798098_798446_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_108883845.1|799370_799445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918146.1|799444_799648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227639.1|799724_800039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012462169.1|801497_801767_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_150339453.1|801807_802134_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_045918143.1|802272_802941_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012462166.1|803045_803795_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_150339454.1|803987_805358_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.5	2.6e-41
WP_150339456.1|805416_806892_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_150339457.1|806983_809950_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_150339467.1|811006_812686_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	38.4	3.2e-41
WP_045918139.1|812697_813258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918785.1|813526_814240_+	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	4.0e-17
WP_045918780.1|814220_815009_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_109227642.1|815769_816066_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	52.8	2.6e-07
WP_012462157.1|816648_817041_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_045918709.1|823819_824095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340470.1|824264_824738_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_150340472.1|825231_825687_+	ATP-binding protein	NA	NA	NA	NA	NA
825597:825650	attR	AAATTACATTGTTAACAAACTAAGTGGAAAATTAGAGATAAAGAGCGAGGCGAA	NA	NA	NA	NA
WP_150339469.1|826071_826998_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	61.7	2.0e-85
WP_150339472.1|827065_827521_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_012461970.1|830003_831788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339474.1|832378_833494_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_150339476.1|833545_834517_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150339479.1|834526_836092_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_150339482.1|837482_837944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339484.1|838463_839792_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150339487.1|839791_840121_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150339489.1|842715_844407_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_150339492.1|844403_845102_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_150339495.1|845098_846400_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_150339497.1|846399_849051_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_150339499.1|849066_850212_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150339502.1|850215_851970_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_150339504.1|851979_852999_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150340416.1|853050_854145_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_150338895.1|855980_856805_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_150339507.1|856819_857530_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_150339510.1|857501_858824_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_108840172.1|859103_859559_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_150339513.1|859626_860601_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	3.9e-84
WP_150339515.1|860722_861298_-	HD domain-containing protein	NA	B3FJI5	Pseudomonas_phage	38.6	9.6e-06
WP_150339518.1|861398_862256_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045915190.1|862277_863006_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045917470.1|863372_864182_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	26.7	2.4e-18
WP_150339520.1|864185_864689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339523.1|864736_865381_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	33.3	9.7e-15
WP_150339525.1|865415_865991_-	HD domain-containing protein	NA	A0A292GI44	Xanthomonas_phage	28.6	1.0e-07
WP_150339527.1|866224_867661_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	37.0	6.7e-72
WP_150339530.1|867669_869385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339532.1|870577_871276_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_150339535.1|872574_874566_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150339537.1|876458_876950_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	1057730	1162997	1972387	protease,integrase,tRNA,transposase	Streptococcus_phage(15.38%)	60	1142196:1142224	1171193:1171221
WP_150339702.1|1057730_1058984_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.3	3.4e-120
WP_150339704.1|1059111_1060413_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_045917961.1|1060427_1060721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339707.1|1060734_1061955_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_150339709.1|1062035_1063052_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_150339712.1|1063326_1065783_+	virB4 protein precursor	NA	NA	NA	NA	NA
WP_150339714.1|1065782_1070306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045916484.1|1072667_1074428_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.8	5.7e-41
WP_045913377.1|1074411_1074744_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_150339717.1|1075650_1079763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339720.1|1081925_1082309_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_150339722.1|1082339_1082729_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_150339725.1|1082923_1084711_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_045914354.1|1084745_1085531_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_150339727.1|1086734_1088300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339730.1|1088308_1089757_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.3	6.7e-72
WP_150339733.1|1089899_1091027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339639.1|1091480_1092050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918527.1|1092146_1092602_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109227404.1|1092897_1093056_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_150339736.1|1093100_1094243_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	27.1	7.8e-07
WP_150339738.1|1094257_1095082_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_150339637.1|1095382_1096486_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_150339741.1|1096537_1097338_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_011945084.1|1097799_1098225_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	37.4	1.8e-17
WP_045919076.1|1098368_1098593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339744.1|1100224_1101937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339746.1|1104230_1104875_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.4	2.8e-14
WP_150339749.1|1104922_1105426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339752.1|1105429_1106239_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	28.5	1.3e-19
WP_150339755.1|1106606_1106870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339758.1|1106934_1107633_+	histidine kinase	NA	NA	NA	NA	NA
WP_150340470.1|1107860_1108334_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_150339761.1|1109312_1109807_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_150339763.1|1109858_1110446_+	HD domain-containing protein	NA	A0A2I2L310	Orpheovirus	29.8	3.4e-06
WP_150339766.1|1110567_1111530_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	1.0e-84
WP_150339768.1|1111597_1111996_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_150340482.1|1112347_1115221_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	24.7	6.1e-08
WP_150339770.1|1116877_1117972_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_150339772.1|1118023_1118971_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150339775.1|1118980_1120735_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109234468.1|1120740_1121880_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150339777.1|1126548_1127109_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	39.0	1.7e-23
WP_150339780.1|1127212_1128217_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150339782.1|1130305_1131109_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_150339785.1|1131436_1132537_+	PRANC domain-containing protein	NA	A0A1V0QGP6	Shearwaterpox_virus	30.4	1.9e-10
WP_150339788.1|1132444_1134238_-	TraC family protein	NA	NA	NA	NA	NA
WP_150339791.1|1134218_1134548_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150339794.1|1134547_1134937_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150339796.1|1136222_1136870_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011944522.1|1138628_1138928_-	hypothetical protein	NA	NA	NA	NA	NA
1142196:1142224	attL	AAAGGTAGAAAATAGGTAGAAAAAAAATT	NA	NA	NA	NA
WP_150339799.1|1143120_1144524_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_045918655.1|1144539_1145802_-	MFS transporter	NA	NA	NA	NA	NA
WP_150339802.1|1149877_1150594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339804.1|1151959_1152220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012460860.1|1153356_1153686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339806.1|1155060_1155390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339809.1|1156558_1156894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339811.1|1159013_1159922_-	AAA family ATPase	NA	A0A218KST2	Xenohaliotis_phage	42.4	5.5e-56
WP_012461740.1|1162790_1162997_+|integrase	integrase	integrase	NA	NA	NA	NA
1171193:1171221	attR	AAAGGTAGAAAATAGGTAGAAAAAAAATT	NA	NA	NA	NA
>prophage 7
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	1279563	1348742	1972387	protease,tRNA,transposase,holin	Indivirus(16.67%)	52	NA	NA
WP_045918381.1|1279563_1280472_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_012461867.1|1280495_1280765_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_045918383.1|1281012_1283223_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_045918384.1|1283364_1284642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339907.1|1285123_1286353_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045918387.1|1286444_1287164_-	DUF5394 family protein	NA	NA	NA	NA	NA
WP_150340488.1|1287389_1288619_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_150339910.1|1288808_1290059_-	MFS transporter	NA	NA	NA	NA	NA
WP_108840015.1|1290165_1290663_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_012461860.1|1290691_1290898_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_150339913.1|1291069_1291675_+	COQ9 family protein	NA	NA	NA	NA	NA
WP_150339916.1|1291711_1294915_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	34.4	2.6e-177
WP_045913650.1|1295051_1295636_+	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_150339919.1|1295990_1297199_+	2-polyprenyl-6-methoxyphenol hydroxylase	NA	NA	NA	NA	NA
WP_150339921.1|1297255_1298416_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_150339924.1|1298430_1299309_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.9	8.6e-22
WP_150339926.1|1299377_1301054_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_150339928.1|1301230_1304059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041621668.1|1304087_1304342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045917099.1|1304338_1304824_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_150339931.1|1304874_1305648_-|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
WP_109227251.1|1305699_1306392_-	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	33.7	7.3e-16
WP_045918076.1|1306468_1307014_-	demethoxyubiquinone hydroxylase family protein	NA	NA	NA	NA	NA
WP_150339934.1|1306967_1307525_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_150339936.1|1307663_1309244_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_045913414.1|1309961_1310255_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_045916254.1|1310260_1311010_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_150339939.1|1311090_1312620_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_150339941.1|1312659_1313265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339944.1|1313525_1313765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339947.1|1313935_1314955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338897.1|1316180_1317140_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150340416.1|1317191_1318286_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_045919247.1|1319851_1320397_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.7	1.1e-19
WP_150339950.1|1320393_1321317_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.2	5.1e-09
WP_150339953.1|1321531_1324063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150339956.1|1324232_1324727_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_150339959.1|1324954_1325911_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_150339962.1|1326003_1328370_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	33.7	3.1e-90
WP_150339965.1|1328369_1329755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150339968.1|1329689_1330595_-	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.1	3.0e-30
WP_150339971.1|1330591_1331608_-	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.1	1.1e-17
WP_150339974.1|1331806_1334590_+	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	28.6	8.9e-97
WP_109227262.1|1334856_1335471_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_109227263.1|1335684_1337085_-|protease	DegP-like serine protease TSA47	protease	W5SAB9	Pithovirus	31.1	1.2e-06
WP_045917627.1|1337102_1337969_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_150339977.1|1337992_1339048_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_150339979.1|1339230_1340262_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_150339982.1|1342168_1342378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108883954.1|1344948_1345896_-	paraslipin	NA	S4VT23	Pandoravirus	26.1	3.7e-10
WP_109227265.1|1346155_1346704_+	cytochrome c family protein	NA	NA	NA	NA	NA
WP_150339984.1|1347872_1348742_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	33.8	6.1e-20
>prophage 8
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	1659990	1749965	1972387	integrase,tRNA,transposase	Streptococcus_phage(14.29%)	59	1645625:1645654	1749817:1749846
1645625:1645654	attL	CTAAAGGCAGAGCTGAAGGCAGAGCTGAAG	NA	NA	NA	NA
WP_150340502.1|1659990_1660410_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_150340209.1|1660922_1661333_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_150340211.1|1665179_1667330_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.3	3.3e-107
WP_150340213.1|1668312_1669749_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	32.1	5.5e-50
WP_150340215.1|1669813_1671160_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	34.8	5.7e-09
WP_150340217.1|1671339_1673382_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.7	7.7e-98
WP_045913615.1|1673409_1674663_-	MFS transporter	NA	NA	NA	NA	NA
WP_150340219.1|1674699_1677264_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_150340221.1|1677256_1680529_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_150340223.1|1680582_1684482_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_150340225.1|1684503_1686951_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_012461381.1|1686950_1689368_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_012461380.1|1689378_1689666_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_150340227.1|1689981_1691922_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_150340229.1|1692108_1693644_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.9	1.3e-94
WP_045914475.1|1693656_1694445_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_150340231.1|1695108_1695975_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_012461375.1|1697025_1697691_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	40.2	4.2e-13
WP_109227702.1|1698500_1700126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340233.1|1701212_1701788_-	HD domain-containing protein	NA	A0A292GI44	Xanthomonas_phage	28.8	5.1e-07
WP_150340235.1|1702068_1703469_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.9	8.8e-69
WP_150340237.1|1703477_1705043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045912460.1|1706238_1706763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011944708.1|1707234_1707393_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_150340504.1|1707911_1708901_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_150340239.1|1708920_1709298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340241.1|1709320_1709650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045914482.1|1709829_1710570_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_045914483.1|1710909_1711308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340506.1|1711325_1713461_+	RelA/SpoT family protein	NA	A0A2I2L310	Orpheovirus	35.6	1.4e-09
WP_109227397.1|1713471_1713867_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_012460965.1|1714985_1716653_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	53.1	1.4e-142
WP_045914486.1|1716725_1717010_-	co-chaperone GroES	NA	A0A221S4E4	uncultured_virus	29.2	8.1e-06
WP_080503903.1|1717250_1717517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340508.1|1717628_1717886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340243.1|1717944_1719117_+	PRANC domain-containing protein	NA	Q6VZB8	Canarypox_virus	27.6	2.3e-06
WP_045918345.1|1719602_1721057_-	replicative DNA helicase	NA	A0A218KST2	Xenohaliotis_phage	34.6	5.2e-64
WP_150340510.1|1721807_1723319_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	34.4	4.4e-26
WP_011944696.1|1723653_1724004_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_150340245.1|1726283_1727999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340247.1|1728007_1729444_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	37.4	1.2e-73
WP_150340249.1|1729676_1730252_+	HD domain-containing protein	NA	A0A292GI44	Xanthomonas_phage	29.2	4.6e-08
WP_150340251.1|1730286_1730931_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	31.9	1.8e-13
WP_150340253.1|1730977_1731529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340255.1|1731532_1732342_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	27.4	9.7e-20
WP_109456017.1|1732715_1732994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340257.1|1733058_1733760_+	histidine kinase	NA	NA	NA	NA	NA
WP_150340512.1|1734213_1734690_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045915388.1|1735177_1735642_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045914126.1|1735660_1736155_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_150340259.1|1736196_1736784_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	34.1	3.1e-07
WP_150340261.1|1736905_1737916_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	1.8e-84
WP_150340263.1|1738514_1739486_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150340265.1|1739809_1740265_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_150340514.1|1740559_1743403_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_150340267.1|1746391_1746931_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150340269.1|1746920_1748021_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150340516.1|1748324_1749293_-|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	30.2	5.9e-24
WP_150340271.1|1749503_1749965_+|transposase	transposase	transposase	NA	NA	NA	NA
1749817:1749846	attR	CTAAAGGCAGAGCTGAAGGCAGAGCTGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	1810285	1882541	1972387	integrase,transposase	Streptococcus_phage(23.08%)	51	1872428:1872448	1899714:1899734
WP_150340297.1|1810285_1811230_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1P3	Pseudomonas_phage	24.8	7.8e-13
WP_045918420.1|1811282_1811588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340299.1|1811583_1811778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340456.1|1813844_1814813_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_150339301.1|1814835_1815219_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150339303.1|1815589_1816288_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_150339304.1|1820237_1821377_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150339306.1|1821382_1823137_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_150340301.1|1823146_1824142_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150340458.1|1824193_1825288_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_150340303.1|1827123_1827948_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_150340305.1|1827962_1828637_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_150340307.1|1831022_1831382_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150340309.1|1832157_1832958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080946883.1|1833459_1833723_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_150340311.1|1833801_1834728_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	61.7	1.7e-84
WP_045919583.1|1834848_1835424_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9L285	Tupanvirus	28.9	5.7e-06
WP_150338887.1|1836321_1837050_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_150340313.1|1837416_1838226_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	27.4	3.0e-21
WP_045918529.1|1838229_1838733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340315.1|1839518_1840094_-	HD domain-containing protein	NA	A0A292GI44	Xanthomonas_phage	31.3	1.3e-07
WP_150340317.1|1840712_1841546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340319.1|1844645_1847297_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_150340321.1|1847312_1848458_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150340323.1|1848461_1850216_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_150340325.1|1850225_1851266_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150340524.1|1851250_1852354_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_045917117.1|1857328_1857784_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_150340327.1|1858129_1859311_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_150340329.1|1859503_1860538_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	8.4e-85
WP_150340331.1|1860659_1861247_-	HD domain-containing protein	NA	A0A2I2L310	Orpheovirus	29.0	9.8e-06
WP_150339761.1|1861298_1861793_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_150340470.1|1862770_1863244_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_150339758.1|1863471_1864170_-	histidine kinase	NA	NA	NA	NA	NA
WP_150339755.1|1864234_1864498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340333.1|1864865_1865675_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	27.8	2.8e-19
WP_150340335.1|1865678_1866227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340337.1|1866273_1866918_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.2	8.2e-14
WP_150340339.1|1866952_1867528_-	HD domain-containing protein	NA	A0A292GI44	Xanthomonas_phage	29.2	6.7e-07
WP_150340341.1|1867760_1869209_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.9	4.4e-71
WP_150340343.1|1869217_1870777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340344.1|1871492_1872053_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	41.1	5.9e-24
WP_150340346.1|1872163_1873567_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
1872428:1872448	attL	ATTAGGATTATATTTAATAGC	NA	NA	NA	NA
WP_150339824.1|1874189_1874573_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150340348.1|1877111_1877519_-	TraC family protein	NA	NA	NA	NA	NA
WP_150340350.1|1877427_1877748_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150340352.1|1877747_1879076_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150340354.1|1879799_1880288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064612831.1|1880284_1880836_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_150340356.1|1880835_1881171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340358.1|1881296_1882541_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	24.1	9.7e-19
1899714:1899734	attR	GCTATTAAATATAATCCTAAT	NA	NA	NA	NA
>prophage 10
NZ_CP044031	Orientia tsutsugamushi strain Wuj/2014 chromosome, complete genome	1972387	1901601	1951931	1972387	integrase,tRNA,transposase	Wolbachia_phage(12.5%)	40	1922556:1922587	1962947:1962978
WP_150340371.1|1901601_1902573_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150340193.1|1902624_1903728_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_150340526.1|1905947_1906082_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_109227356.1|1906904_1908155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919549.1|1908177_1908597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340373.1|1908831_1909734_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	57.6	1.3e-86
WP_150339763.1|1909855_1910443_-	HD domain-containing protein	NA	A0A2I2L310	Orpheovirus	29.8	3.4e-06
WP_150339761.1|1910494_1910989_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_150340470.1|1911967_1912441_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045918709.1|1912610_1912886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338885.1|1913850_1914354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338957.1|1914400_1915030_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	31.9	1.2e-12
WP_150338959.1|1915265_1916714_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.1	1.1e-71
WP_150338961.1|1916722_1917769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150338963.1|1917765_1918266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227703.1|1919178_1920147_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_150340375.1|1920418_1921078_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
1922556:1922587	attL	AGCAAAACGCTGATGCAGATTGCTTAGCTTTC	NA	NA	NA	NA
WP_109227704.1|1923170_1923338_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_012461748.1|1925079_1925550_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_109227405.1|1925552_1925714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918548.1|1925760_1925991_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_109227705.1|1927028_1927529_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	40.0	7.1e-05
WP_150340377.1|1927877_1928234_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_150340379.1|1929352_1929940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340381.1|1930192_1931185_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_150340383.1|1931247_1932519_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_150340385.1|1932846_1933611_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_150340528.1|1933594_1933765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340387.1|1934374_1937188_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_052692533.1|1937920_1938160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150340389.1|1940094_1941483_-	2-polyprenylphenol 6-hydroxylase	NA	A0A0R6PKQ6	Moraxella_phage	25.9	2.9e-32
WP_150340391.1|1941479_1942253_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_150340393.1|1942844_1943327_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_109227479.1|1943345_1944848_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_045918048.1|1945097_1947638_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	27.3	6.1e-28
WP_011944947.1|1947668_1948031_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_109227480.1|1949511_1949751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340395.1|1950916_1951339_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_150339412.1|1951495_1951687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150340397.1|1951595_1951931_+|integrase	tyrosine-type recombinase/integrase	integrase	B6SD77	Bacteriophage	42.9	2.1e-05
1962947:1962978	attR	GAAAGCTAAGCAATCTGCATCAGCGTTTTGCT	NA	NA	NA	NA
