The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	1140197	1196693	5191486	tRNA,transposase	Escherichia_phage(42.11%)	56	NA	NA
WP_106106683.1|1140197_1141546_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.7	4.3e-73
WP_001130266.1|1141680_1142256_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000109536.1|1142272_1142533_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_106106614.1|1142523_1143795_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000987944.1|1143872_1144238_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_001551556.1|1144553_1146353_+	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_001290706.1|1146352_1148065_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_001521160.1|1148138_1148873_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000956458.1|1149137_1149290_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001551555.1|1149484_1152184_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_001551554.1|1152281_1153844_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_000029331.1|1153840_1154377_+	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_000206445.1|1154391_1155447_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_001551553.1|1155457_1156204_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_000281438.1|1156185_1156836_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_000144858.1|1156832_1157756_+	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_000063172.1|1157752_1158046_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_001551551.1|1158862_1159900_-	alkaline phosphatase isozyme conversion aminopeptidase	NA	NA	NA	NA	NA
WP_000372108.1|1160151_1161060_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_001551550.1|1161061_1162489_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|1162488_1163094_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001551549.1|1163143_1163467_+	DUF3561 family protein	NA	NA	NA	NA	NA
WP_000517476.1|1163660_1163972_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_000246131.1|1163990_1164701_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001219242.1|1164700_1165180_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_000568924.1|1165176_1166226_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_001295182.1|1166206_1166968_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1166961_1167588_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1167727_1168867_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1168929_1169922_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001208066.1|1170042_1170450_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001237173.1|1170596_1171190_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_001551547.1|1171189_1172617_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562982.1|1172627_1172864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000526135.1|1173041_1173500_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000104457.1|1173612_1174977_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|1175065_1175842_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1175846_1176485_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001551546.1|1176481_1177744_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_000847985.1|1177740_1178649_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1178844_1179612_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|1179662_1180319_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272891.1|1180424_1182986_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
WP_001551545.1|1183272_1183617_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_000301062.1|1183655_1184084_-	transporter	NA	NA	NA	NA	NA
WP_001067858.1|1184421_1185126_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001262765.1|1185570_1186881_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|1187157_1188018_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|1188489_1189194_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012477590.1|1189227_1190148_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	2.7e-175
WP_000557454.1|1192434_1193295_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|1193307_1193850_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|1194331_1194523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|1194528_1194774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579135.1|1194824_1195952_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|1195988_1196693_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	1348257	1390023	5191486	tail,head,integrase,terminase,holin	Salmonella_phage(52.27%)	54	1347995:1348012	1390231:1390248
1347995:1348012	attL	TTCACACATATCACAATT	NA	NA	NA	NA
WP_001138334.1|1348257_1349655_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001291429.1|1349651_1349852_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001551511.1|1349848_1351243_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	1.0e-210
WP_001551510.1|1351305_1352223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551509.1|1352238_1352523_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	8.3e-27
WP_001551508.1|1352522_1352717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551506.1|1352952_1353714_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_001551504.1|1353778_1355842_-	hypothetical protein	NA	Q775A3	Bordetella_phage	67.7	6.7e-275
WP_000551014.1|1355888_1356518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000769005.1|1356570_1357119_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_001551502.1|1357134_1358436_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	5.2e-132
WP_001551501.1|1358438_1359341_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001551500.1|1359711_1360281_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	52.7	3.2e-38
WP_001551499.1|1360656_1361331_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	1.8e-59
WP_000016208.1|1361472_1361673_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_150395013.1|1361676_1363938_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_000034494.1|1364253_1364544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551497.1|1364569_1364992_+	hypothetical protein	NA	Q8W638	Enterobacteria_phage	65.0	8.0e-42
WP_000781776.1|1365524_1365866_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194119.1|1365869_1366346_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_001551496.1|1366329_1366854_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	67.7	2.6e-42
WP_000162796.1|1366915_1367488_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001551495.1|1367490_1369113_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_001551494.1|1369112_1370579_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.0	6.0e-262
WP_136759112.1|1370469_1371204_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.1	5.2e-97
WP_001551492.1|1371218_1372439_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	9.3e-200
WP_001066732.1|1372442_1372949_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
WP_001551491.1|1372960_1373902_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.6e-154
WP_001107515.1|1373943_1374165_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_001551489.1|1374130_1374538_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	1.5e-69
WP_001551487.1|1374534_1375089_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	7.4e-80
WP_001551486.1|1375075_1375465_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	3.3e-66
WP_001349562.1|1375439_1376003_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_001551485.1|1376006_1377152_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	5.2e-160
WP_000109249.1|1377162_1377603_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393954.1|1377606_1378059_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_023141050.1|1378070_1378247_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.6e-12
WP_001551484.1|1378236_1380222_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
WP_001298404.1|1380221_1380809_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000155119.1|1380808_1381111_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_001551483.1|1381113_1382178_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	4.2e-156
WP_001551482.1|1382177_1382513_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	71.2	1.7e-23
WP_001551481.1|1382509_1383022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551480.1|1383082_1383835_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.5	8.5e-87
WP_001270631.1|1383834_1384188_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
WP_001551479.1|1384187_1385387_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.6	4.9e-185
WP_000049943.1|1385383_1386064_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	1.5e-103
WP_001551478.1|1386063_1386858_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	91.0	6.9e-79
WP_024192484.1|1386857_1387451_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	64.9	7.0e-60
WP_001174919.1|1387422_1387863_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_077634188.1|1387865_1388264_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.3	8.1e-12
WP_000904955.1|1388290_1388605_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	89.9	1.6e-39
WP_001039127.1|1388609_1389455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253100.1|1389756_1390023_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	83.0	2.7e-35
1390231:1390248	attR	TTCACACATATCACAATT	NA	NA	NA	NA
>prophage 3
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	1603704	1649174	5191486	capsid,head,integrase,terminase,holin,lysis,portal	Enterobacteria_phage(59.32%)	66	1608336:1608351	1648106:1648121
WP_001551412.1|1603704_1605138_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	5.3e-29
WP_001551411.1|1605353_1606277_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197021.1|1606338_1607586_+	MFS transporter	NA	NA	NA	NA	NA
WP_001316510.1|1607665_1607818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163428.1|1608115_1608316_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
1608336:1608351	attL	GGAATCGAACCTGCAA	NA	NA	NA	NA
WP_150395017.1|1608373_1608541_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	94.5	5.4e-26
WP_150395018.1|1608613_1608898_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	1.1e-47
WP_150395019.1|1608890_1609439_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	54.7	1.0e-36
WP_150395020.1|1609440_1609887_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	56.4	3.0e-15
WP_134316725.1|1609963_1610227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150395021.1|1610400_1611024_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	55.6	9.3e-55
WP_016063077.1|1611020_1611188_-	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	100.0	1.3e-24
WP_001595498.1|1611184_1611466_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	97.8	4.3e-44
WP_135507858.1|1611482_1611797_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	1.0e-49
WP_000041326.1|1611808_1612291_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.9	3.5e-78
WP_000065846.1|1612274_1613177_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.4	5.2e-147
WP_000604111.1|1613173_1613482_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_032320516.1|1613566_1613842_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	2.0e-46
WP_000167585.1|1613931_1614402_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_021549545.1|1614457_1614724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119173357.1|1614785_1614980_+	hypothetical protein	NA	M1E1Y7	Enterobacteria_phage	74.4	1.1e-09
WP_016063200.1|1614910_1615273_-	hypothetical protein	NA	K7PHE0	Enterobacteria_phage	100.0	6.2e-59
WP_047083734.1|1615275_1615548_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	97.8	1.5e-25
WP_000233125.1|1615915_1616284_-	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	99.2	1.3e-56
WP_000428318.1|1616301_1617018_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|1617124_1617319_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_150395022.1|1617427_1617706_+	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	96.7	4.4e-41
WP_024259157.1|1617888_1618779_+	hypothetical protein	NA	G5DA89	Enterobacteria_phage	98.6	3.8e-158
WP_150395023.1|1618768_1621234_+	helicase DnaB	NA	K7P7N4	Enterobacteria_phage	58.0	5.8e-233
WP_150395024.1|1621309_1621516_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	89.7	4.3e-25
WP_024239847.1|1621533_1621890_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_139497782.1|1621861_1622272_+	recombination protein NinB	NA	K7PK24	Enterobacteria_phage	99.3	1.2e-71
WP_001254251.1|1622268_1622451_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_139497781.1|1622447_1622618_+	protein ninF	NA	K7PM86	Enterobacteria_phage	96.4	3.9e-24
WP_001003984.1|1622610_1623333_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	99.6	7.1e-131
WP_000002248.1|1623332_1623623_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	97.9	4.2e-50
WP_001008200.1|1623619_1623982_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|1623978_1624167_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_094323802.1|1624163_1624787_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.0	8.9e-114
WP_000783734.1|1625455_1625779_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229399.1|1625762_1626239_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_021554252.1|1626235_1626673_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.2	6.1e-69
WP_001028465.1|1626877_1627399_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000807788.1|1627561_1627804_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_150395025.1|1627806_1628247_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	98.6	1.5e-78
WP_000200764.1|1628243_1629656_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	100.0	1.5e-278
WP_150395026.1|1629658_1631785_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.4	0.0e+00
WP_150395027.1|1631798_1632683_+|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	98.3	1.9e-141
WP_021562847.1|1632694_1633966_+|head	phage head protein	head	Q9AYZ7	Salmonella_phage	99.5	4.3e-240
WP_000375639.1|1634008_1634194_+	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_000246748.1|1634168_1634651_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_150395028.1|1634659_1636078_+	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.2	1.0e-274
WP_150395029.1|1636077_1637031_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.2	5.0e-92
WP_150395030.1|1637030_1637486_+	DUF2824 family protein	NA	A0A088CQ57	Enterobacteria_phage	98.0	1.7e-85
WP_000964882.1|1637488_1638181_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_097486013.1|1638190_1639597_+	acyltransferase	NA	I6RSG0	Salmonella_phage	55.2	3.2e-127
WP_150395039.1|1639596_1641435_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.4	2.0e-246
WP_000766785.1|1641459_1641849_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	88.4	3.0e-59
WP_001211768.1|1641864_1642200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090234.1|1642196_1642451_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	91.2	1.4e-33
WP_000677939.1|1642541_1642703_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_103041895.1|1642771_1643650_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.5	1.2e-95
WP_150395031.1|1643750_1646150_+|head	phage head protein	head	A5VW57	Enterobacteria_phage	91.2	2.3e-77
WP_033561327.1|1646390_1646678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029701261.1|1646772_1647930_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.4e-221
WP_000368131.1|1648241_1649174_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1648106:1648121	attR	GGAATCGAACCTGCAA	NA	NA	NA	NA
>prophage 4
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	1895550	1904993	5191486		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1895550_1896477_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1896481_1897213_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1897193_1897301_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1897360_1898092_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1898313_1899999_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1899995_1900715_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|1900761_1901232_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|1901273_1901735_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|1901859_1903860_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1903856_1904993_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 5
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	1998858	2006376	5191486		Escherichia_phage(42.86%)	7	NA	NA
WP_021523160.1|1998858_2000253_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
WP_021523159.1|2000410_2001406_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523158.1|2001637_2002531_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001515524.1|2002902_2003988_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523157.1|2003987_2004887_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_021523156.1|2004944_2005823_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523155.1|2005827_2006376_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 6
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	2144128	2200893	5191486	tail,plate,capsid,head,integrase,transposase,terminase,holin,portal	Enterobacteria_phage(81.82%)	74	2163334:2163393	2201000:2201120
WP_001347174.1|2144128_2144653_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_001336494.1|2144675_2145005_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_000334576.1|2144886_2145384_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	5.9e-52
WP_000790504.1|2145492_2145726_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118890.1|2145722_2146928_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|2147114_2147528_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245699.1|2147561_2149049_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001057840.1|2149126_2149492_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000270663.1|2149491_2149902_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_020232902.1|2149926_2151333_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_021523129.1|2151598_2153251_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_020232904.1|2153414_2154134_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001365065.1|2154179_2154731_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001296168.1|2154818_2155619_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020232905.1|2155723_2156710_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|2156724_2157393_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272994.1|2157389_2158142_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001154271.1|2158371_2159094_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|2159160_2159385_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_000590347.1|2159371_2159548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611328.1|2159843_2160500_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|2160496_2162329_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2162385_2162934_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2163334:2163393	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_071790047.1|2163926_2164208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|2164396_2164537_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|2164728_2164989_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|2165278_2166418_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_021525649.1|2166817_2167927_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	4.8e-195
WP_000005424.1|2168084_2169269_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	6.4e-222
WP_000290456.1|2169268_2169781_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000869130.1|2169835_2170201_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	83.5	2.7e-46
WP_000333503.1|2170209_2170365_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853387.1|2170351_2173159_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	89.4	0.0e+00
WP_000979945.1|2173171_2173660_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001447286.1|2173848_2174394_+	transferase	NA	NA	NA	NA	NA
WP_000885638.1|2174357_2174975_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_000104716.1|2174974_2177632_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	71.6	1.7e-278
WP_000071737.1|2177642_2178170_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	88.3	2.8e-84
WP_001111939.1|2178162_2179059_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	1.3e-155
WP_000213455.1|2179062_2179413_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	1.0e-58
WP_001271915.1|2179409_2179991_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.4	1.6e-101
WP_000356322.1|2179987_2180623_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	1.4e-114
WP_000920575.1|2180615_2181083_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	7.6e-86
WP_071599907.1|2181069_2181249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000780561.1|2181220_2181628_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	1.4e-64
WP_000072327.1|2181624_2182017_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|2182013_2182337_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2182339_2182540_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063102.1|2182539_2183034_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.5e-89
WP_000632335.1|2183135_2183936_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_001055081.1|2183981_2185034_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.0	8.0e-192
WP_001262664.1|2185056_2185893_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	2.5e-148
WP_000613803.1|2186047_2187799_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087811.1|2187798_2188845_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	3.3e-206
WP_071790046.1|2189233_2189485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000711113.1|2189375_2189906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211245.1|2190443_2190755_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	2.2e-49
WP_000686533.1|2190759_2191719_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	7.6e-181
WP_000123428.1|2191795_2194618_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.8	0.0e+00
WP_000599386.1|2194624_2194990_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	1.1e-60
WP_000775057.1|2195062_2195293_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|2195615_2195915_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153704.1|2195911_2196178_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	2.3e-31
WP_000985157.1|2196174_2196378_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991916.1|2196401_2196818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2196910_2197024_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514277.1|2197020_2197263_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000739026.1|2197564_2197915_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	4.3e-49
WP_000014504.1|2197936_2198140_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2198211_2198349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2198438_2198843_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|2198858_2199509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2199538_2199886_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2199891_2200893_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2201000:2201120	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	2705474	2769599	5191486	tail,transposase	Enterobacteria_phage(35.29%)	54	NA	NA
WP_085948682.1|2705474_2706843_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
WP_001309484.1|2706943_2707093_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2707164_2707338_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001306523.1|2707582_2708113_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000048646.1|2708301_2709303_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115969.1|2709344_2710784_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027956.1|2710980_2711781_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000343026.1|2711896_2712274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|2712393_2712843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523214.1|2712829_2713168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551082.1|2713452_2717355_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_000048949.1|2717555_2718161_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_001563833.1|2718274_2719135_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001551080.1|2719342_2724364_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001551079.1|2724694_2725285_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_001551078.1|2725266_2726217_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632281.1|2726317_2727631_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2727657_2728863_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_001551077.1|2728862_2729285_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_019842675.1|2729277_2730702_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_001551075.1|2730703_2731492_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001551074.1|2731491_2732259_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001551073.1|2732255_2733326_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189203.1|2733333_2733831_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001551072.1|2733845_2734592_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2734600_2734888_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_071591516.1|2734899_2735865_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001551071.1|2736113_2738159_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535436.1|2738406_2740680_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001551070.1|2740738_2742238_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001067519.1|2742473_2743379_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001306533.1|2743550_2743877_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2743884_2744070_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001551069.1|2744066_2746706_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2746913_2747903_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001523197.1|2748013_2748436_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2748432_2748699_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001551068.1|2748972_2752497_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837902.1|2752858_2753992_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
WP_001295593.1|2754132_2754567_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000286867.1|2755153_2756068_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983720.1|2756067_2756895_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
WP_001101728.1|2756891_2757749_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968130.1|2757745_2758603_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000355602.1|2758954_2759248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001544649.1|2759290_2760331_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	3.8e-125
WP_000654143.1|2760340_2760622_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001551066.1|2760621_2762997_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	69.5	6.3e-168
WP_001228337.1|2763061_2763661_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	1.7e-101
WP_001551065.1|2763728_2767208_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.5	0.0e+00
WP_050436738.1|2767268_2767877_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.6	7.1e-100
WP_032147653.1|2767813_2768557_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	2.8e-146
WP_001152425.1|2768562_2769261_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	1.9e-128
WP_000024051.1|2769260_2769599_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
>prophage 8
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	2773806	2812018	5191486	lysis,tRNA,terminase,integrase	Escherichia_phage(56.76%)	45	2778619:2778634	2821108:2821123
WP_001551060.1|2773806_2774769_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	3.8e-55
WP_000673077.1|2774795_2775188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551059.1|2775184_2775565_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	2.9e-19
WP_106106620.1|2775565_2775949_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	38.6	3.7e-14
WP_000634214.1|2775948_2776344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|2776566_2777706_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_001551057.1|2777804_2778569_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.4	1.8e-79
2778619:2778634	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001363932.1|2778673_2779786_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_001551056.1|2779769_2781176_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	2.3e-186
WP_000625348.1|2781178_2782480_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_001551055.1|2782460_2783555_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	1.0e-112
WP_000126788.1|2783558_2783768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2783745_2784678_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|2784670_2785462_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2785599_2787057_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2787253_2787439_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001551053.1|2787655_2788153_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000839599.1|2788152_2788368_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_000640136.1|2789649_2790192_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.4e-75
WP_001551052.1|2790188_2790479_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	9.0e-45
WP_000940316.1|2790478_2791078_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.6e-107
WP_001551050.1|2791491_2793756_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000385105.1|2793730_2794885_-	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_001551049.1|2794860_2795082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001403739.1|2795078_2795510_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.7	4.4e-64
WP_001551048.1|2795525_2796287_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	93.3	2.3e-119
WP_001551047.1|2796309_2797056_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_001551046.1|2797062_2797920_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	82.6	3.5e-68
WP_001551045.1|2797932_2798355_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	5.3e-70
WP_001551044.1|2798377_2798674_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_001551043.1|2798797_2799274_+	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_001551042.1|2799727_2799880_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000560221.1|2800300_2800522_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
WP_001551041.1|2800521_2800692_+	phage protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	9.7e-23
WP_001314664.1|2800766_2801042_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_001551038.1|2801143_2803795_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001551037.1|2803787_2804597_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	4.4e-105
WP_001317028.1|2804653_2804848_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001551036.1|2804840_2805029_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	7.9e-26
WP_000079604.1|2805128_2805344_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001551035.1|2805345_2806581_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.3e-238
WP_000662472.1|2806632_2807568_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_001551034.1|2807696_2809070_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2809547_2810531_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001314661.1|2810785_2812018_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2821108:2821123	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
>prophage 9
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	3406644	3453826	5191486	tail,capsid,head,integrase,protease,terminase,lysis,portal	Enterobacteria_phage(59.65%)	64	3415001:3415016	3462632:3462647
WP_001550854.1|3406644_3407685_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	1.7e-125
WP_001550853.1|3407694_3407976_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
WP_021561299.1|3407972_3410372_-|tail	phage tail fiber protein	tail	A0A0E3M194	Enterobacteria_phage	57.7	2.9e-136
WP_001563781.1|3410436_3411036_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.4	8.6e-98
WP_001563780.1|3411103_3414583_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_071591506.1|3414643_3415276_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
3415001:3415016	attL	AATCTGGAATACGCCA	NA	NA	NA	NA
WP_000194780.1|3415212_3415956_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001563779.1|3415960_3416659_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_001563778.1|3416658_3416988_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	1.4e-57
WP_001563777.1|3416984_3419564_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.1	0.0e+00
WP_000459472.1|3419556_3419991_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	3.8e-63
WP_001563776.1|3419972_3420386_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	5.4e-67
WP_001563775.1|3420401_3421142_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	2.5e-131
WP_000683138.1|3421149_3421545_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_000975083.1|3421541_3422120_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_000752974.1|3422131_3422485_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	97.4	2.9e-61
WP_000158862.1|3422496_3422895_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
WP_000063277.1|3422936_3423962_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001563774.1|3424017_3424350_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	99.1	2.5e-54
WP_001563773.1|3424359_3425679_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	4.8e-234
WP_001563772.1|3425659_3427261_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.2e-309
WP_000198149.1|3427257_3427464_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001563771.1|3427460_3429386_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.6	0.0e+00
WP_000867489.1|3429360_3429906_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_001307652.1|3430293_3430488_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|3430850_3431144_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3431234_3431417_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135247.1|3431633_3432131_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839582.1|3432130_3432346_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001563769.1|3433615_3434575_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3434767_3435292_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3435447_3435825_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971071.1|3435910_3436051_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001099655.1|3436047_3436410_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000774479.1|3436406_3436697_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224911.1|3436689_3436860_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	66.0	9.1e-13
WP_001053029.1|3436859_3437315_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_072198841.1|3437311_3437413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550848.1|3437613_3441522_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001550847.1|3441761_3442463_-	replication protein P	NA	M1FJ72	Enterobacteria_phage	98.3	1.6e-127
WP_000185505.1|3442459_3443359_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000438490.1|3443391_3443691_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_001180318.1|3443797_3444025_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250470.1|3444103_3444811_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	2.2e-132
WP_000076839.1|3444940_3445840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032145726.1|3446068_3446284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216183.1|3446282_3446591_+	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	70.6	7.9e-31
WP_001550846.1|3446607_3447189_-	hypothetical protein	NA	K7P6T7	Enterobacteria_phage	92.2	4.0e-92
WP_001550845.1|3447402_3447603_+	restriction inhibitor protein ral	NA	K7P7K1	Enterobacteria_phage	100.0	1.9e-33
WP_024189690.1|3447785_3448154_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	5.0e-64
WP_001198861.1|3448226_3448391_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3448359_3448503_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001550843.1|3448577_3448874_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001550842.1|3448879_3449665_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000186804.1|3449661_3450342_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000682318.1|3450338_3450521_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|3450493_3450685_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3450695_3450977_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763367.1|3451075_3451297_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001348592.1|3451507_3452110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071591521.1|3452234_3452420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3452352_3452520_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3452559_3452778_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001550841.1|3452755_3453826_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	4.3e-201
3462632:3462647	attR	AATCTGGAATACGCCA	NA	NA	NA	NA
>prophage 10
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	4018641	4091658	5191486	protease,plate,tRNA,transposase	Ralstonia_phage(11.11%)	58	NA	NA
WP_024192499.1|4018641_4019778_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001077735.1|4019998_4020376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550647.1|4024951_4027093_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001142958.1|4027302_4027821_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001550646.1|4028517_4029018_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001521869.1|4029052_4029277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550644.1|4029327_4030803_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521866.1|4030809_4031223_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001521865.1|4031226_4033077_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348804.1|4033040_4034123_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001550643.1|4034147_4035428_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4035424_4035949_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246418.1|4035951_4037283_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001521863.1|4037287_4038049_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001563737.1|4038057_4040883_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.1	1.0e-79
WP_001550641.1|4040879_4041623_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240537.1|4041627_4043040_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_134268629.1|4043148_4046583_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001563736.1|4046593_4047946_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_000002621.1|4047969_4048452_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908071.1|4048495_4049410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236629.1|4049419_4049887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086163.1|4050035_4050821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106106613.1|4051359_4052091_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	5.8e-40
WP_000917883.1|4052155_4052623_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308373.1|4052619_4053342_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052732.1|4053375_4054131_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4054202_4055561_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001550637.1|4055607_4056378_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4056455_4057256_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648583.1|4057496_4058411_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997053.1|4058407_4059211_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_001140178.1|4064971_4065544_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4065730_4066762_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4066754_4067408_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4067447_4068263_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4068380_4068785_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094022.1|4068781_4069489_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260708.1|4069599_4071318_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001550629.1|4071370_4072195_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239188.1|4072225_4072936_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635534.1|4072949_4073372_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185287.1|4073368_4073914_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4074079_4074280_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062311.1|4074266_4074527_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_001550628.1|4074575_4075874_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4075938_4076328_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|4076384_4078526_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055748.1|4078623_4079583_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294781.1|4079595_4083078_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	2.2e-209
WP_001550627.1|4083114_4083711_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	7.9e-27
WP_001550626.1|4083707_4084856_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4084855_4085644_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4085647_4086103_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139287.1|4086207_4087233_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4087236_4087722_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4087843_4090276_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001520521.1|4090305_4091658_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 11
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	4291072	4372902	5191486	tail,tRNA,capsid,head,integrase,terminase,holin,portal	Enterobacteria_phage(40.32%)	101	4333611:4333625	4374883:4374897
WP_001223149.1|4291072_4291759_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4292158_4292299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4292394_4293111_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920350.1|4293170_4294523_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219577.1|4294580_4296005_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	1.2e-09
WP_001188679.1|4296004_4296694_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4296706_4297180_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4297390_4298260_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4298256_4298904_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001545810.1|4298955_4299471_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068678.1|4299464_4299791_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|4299880_4301818_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046743.1|4302028_4303696_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
WP_000566334.1|4303850_4304738_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000023622.1|4304871_4305882_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001550574.1|4305901_4306699_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001140838.1|4306724_4307141_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000848792.1|4307298_4307511_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_071591563.1|4307559_4307745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000093813.1|4307970_4309203_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4309223_4310606_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|4310654_4311623_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001550573.1|4311728_4312373_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001550572.1|4312400_4313417_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566139.1|4313448_4313712_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224877.1|4313872_4314592_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4314648_4315872_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477829.1|4315923_4317246_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	5.2e-79
WP_001550571.1|4317323_4318103_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001550570.1|4318360_4319911_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001550569.1|4319882_4320746_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001550568.1|4320779_4321559_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001550567.1|4321555_4322629_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4322750_4322912_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4323038_4323644_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4324036_4325623_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217539.1|4325842_4326091_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_120795384.1|4326517_4326631_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836769.1|4326699_4326933_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_000086527.1|4327312_4327903_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001545206.1|4328130_4328424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060579084.1|4328434_4329139_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654173.1|4329148_4329430_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	7.0e-18
WP_094158907.1|4329426_4331817_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	48.5	9.9e-105
WP_094179059.1|4331881_4332481_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	2.8e-101
WP_000515622.1|4332548_4335944_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.5	0.0e+00
4333611:4333625	attL	ATTGATACTGGCGGC	NA	NA	NA	NA
WP_000090882.1|4336004_4336607_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_024177847.1|4336543_4337287_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_001560932.1|4337291_4337990_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	6.8e-131
WP_000847355.1|4337989_4338319_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_106106625.1|4338315_4340877_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.3	0.0e+00
WP_000459457.1|4340869_4341304_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_060579045.1|4341285_4341708_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.1	3.6e-58
WP_001577918.1|4341723_4342464_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_032244082.1|4342471_4342867_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	97.7	1.4e-69
WP_021528534.1|4342863_4343442_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000753019.1|4343453_4343807_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|4343818_4344214_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000063260.1|4344255_4345281_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_060579022.1|4345336_4345669_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_000123236.1|4345678_4346998_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_019842487.1|4346978_4348580_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.2e-310
WP_000198149.1|4348576_4348783_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_019842488.1|4348779_4350705_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453587.1|4350679_4351225_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|4351613_4351808_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000548594.1|4352058_4352265_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	80.9	2.6e-22
WP_001019207.1|4352560_4352734_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|4352906_4353062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|4353209_4353398_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4353408_4353621_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|4353984_4354482_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|4354478_4355012_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|4355125_4355386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072201599.1|4355333_4355885_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.3e-36
WP_000839581.1|4355889_4356105_-|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066482.1|4356857_4357073_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_001589622.1|4357373_4357586_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122990953.1|4357640_4357730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001589621.1|4358008_4358761_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.6	7.1e-134
WP_001589620.1|4358774_4359764_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001072669.1|4359771_4360587_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_000767110.1|4360749_4361145_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210181.1|4361141_4361468_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_021518588.1|4361464_4362118_-	phage N-6-adenine-methyltransferase	NA	S5M7S1	Escherichia_phage	99.1	4.3e-127
WP_001305611.1|4362117_4362612_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_060579161.1|4362608_4363550_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	95.8	1.2e-135
WP_071789194.1|4363539_4363719_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
WP_060579163.1|4363894_4364452_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	93.5	1.0e-92
WP_000205494.1|4364489_4364690_-	cell division protein	NA	NA	NA	NA	NA
WP_000450737.1|4364787_4365414_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000357060.1|4365781_4366285_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
WP_120785030.1|4366486_4366732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|4366746_4367109_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081305.1|4367174_4367999_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	2.3e-149
WP_000008178.1|4368126_4368663_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_001242716.1|4368653_4369016_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_023154558.1|4369015_4369636_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	93.2	2.5e-116
WP_029402496.1|4369635_4369884_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	98.4	1.7e-31
WP_053891200.1|4370080_4371307_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_001218280.1|4371678_4372902_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	1.5e-234
4374883:4374897	attR	GCCGCCAGTATCAAT	NA	NA	NA	NA
>prophage 12
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	4404092	4426352	5191486	transposase	Escherichia_phage(50.0%)	23	NA	NA
WP_000181193.1|4404092_4405013_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
WP_001535800.1|4405197_4406478_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|4406648_4407353_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071591559.1|4407343_4407634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904895.1|4407527_4408142_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.1	4.3e-36
WP_001082319.1|4408207_4409011_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4409010_4409847_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000427619.1|4412536_4413541_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001043260.1|4414510_4415326_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|4415412_4415715_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|4415608_4415860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|4415890_4417384_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|4417594_4417819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|4417815_4418553_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001550559.1|4418659_4419151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4419184_4419889_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|4419900_4420557_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|4420652_4421837_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_001550555.1|4421931_4422222_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	41.8	5.2e-08
WP_000027057.1|4422316_4423177_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|4423668_4424373_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_021553079.1|4424940_4425600_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	98.6	1.6e-129
WP_001067855.1|4425647_4426352_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 13
NZ_CP040263	Escherichia coli strain 631 chromosome, complete genome	5191486	4503168	4533422	5191486	integrase,protease,transposase	Stx2-converting_phage(42.86%)	21	4512993:4513052	4536016:4539055
WP_042047045.1|4503168_4503525_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001550535.1|4503697_4504156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001499263.1|4505196_4505322_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001550531.1|4506579_4511289_+	hypothetical protein	NA	NA	NA	NA	NA
4512993:4513052	attL	CCTAGATTCTACGTCAGTACTTCAAAAAGCATAATCAAAGCCTTGATAAATATGCATTCC	NA	NA	NA	NA
WP_000608644.1|4513178_4514441_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001617865.1|4514690_4515566_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_086625795.1|4516231_4516561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550529.1|4517306_4517858_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000735752.1|4518308_4518836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550528.1|4518935_4521344_+	PefC/AfrB family outer membrane usher protein	NA	NA	NA	NA	NA
WP_113228315.1|4521360_4522029_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_001550526.1|4522015_4522537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024189727.1|4522691_4523447_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001550520.1|4523480_4524341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550519.1|4524625_4525366_+	porin family protein	NA	NA	NA	NA	NA
WP_001171554.1|4526168_4526549_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4526545_4526893_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001550332.1|4526942_4528481_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	9.3e-298
WP_001550516.1|4529825_4531091_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.7	6.5e-79
WP_150395040.1|4531675_4531909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240487.1|4531937_4533422_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	3.6e-73
4536016:4539055	attR	GGAATGCATATTTATCAAGGCTTTGATTATGCTTTTTGAAGTACTGACGTAGAATCTAGGTGATCGATAACGAATGGGGATTTTCACAATATCCACTGGTTGCCGGGCATGAGGTGATTGGTCGCGTAGTGGCGCTCGGGAGTGCCGCGCAGGATAAAGGTTTGCAGGTCGGTCAGCATGTCGGGATTGGCTGGACGGCACGCAGCTGCGGGCATTGCGATGCCTGTATTAGCGGTAATCAGATCAACTGCGAGCAAGGTGCGGTGCCGACGATTATGAATCGCGGTGGCTTTGCCGAGAAGTTGCGTGCGGACTGGCAATGGGTGATTCCACTGCCAGAAAATATCGACATTGAATCTGCCGGACCGCTGTTGTGCGGCGGTATCACGGTCTTTAAACCGCTGTTGATGCACCATATCACTGCCACCAGCCGCGTTGGGGTAATTGGTATTGGCGGGCTGGGGCATATAGCTATAAAACTTCTGCACGCAATGGGATGCGAGGTGACAGCCTTTAGTTCTAATCCGGCGAAAGAGCAGGAAGTGCTGGCGATGGGTGCCGATAAAGTGGTGAATAGCCGCGATCCACAGGCACTGAAAGCACTGGCGGGGCAGTTTGATCTCATTATCAACACCGTCAACGTCAGCCTAGACTGGCAGCCCTATTTTGAGGCGCTGACCTATGGCGGTAATTTCCATACGGTCGGTGCGGTCCTCACGCCGCTGTCTGTTCCGGCCTTTACGTTAATTGCGGGCGACCGCAGCGTCTCTGGTTCAGCAACCGGTACACCTTATGAGTTGCGTAAGCTGATGCGCTTTGCCGCCCGCAGCAAGGTTGCGCCGACTACCGAACTGTTCCCGATGTCGAAAATTAACGACGCCATCCAGCATGTGCGCGATGGTAAAGCGCGCTACCGCGTGGTGTTGAAAGCAGATTTTTGAAAATCATTCGCAGCGCTGATCTGAGGCGCTGCCCTCTTTCGCACATATTCTGTTTTGTCTTATCGCCAGCACAGCCTGCCGACATTGTTCGGTGACATTGGCAATATCATGGTTGATATCAATGCGCACAATATCCTGTTCATCTGCTTGTGGACGCTCCAGCGCCTCAAACTGACTTTTTAGTAACGCTACCGGCATAAAATGCCCAGCCCGCCGCTGCATTCGCGCGAGAATAGTTTCATAGTCGCCATCTAACCAGAGGAAATGAACATGGGGGCTACCCTTGCGTAAAATATCACGATACTGTTTTTTTAATGATGAACAGACAATAAATCCTGTTTCATTCTTTTTATAAAGACTGTATGAAGCATCATTTAAGCGTTCCAGCCAGGGAAGTCGATCTTCATCAGATAATGGAATACCCTGCGACATTTTATCTATATTTTTGGCTGGATGAAGATCGTCACCATCAATAAATTTAGCAGATAATAACGCGGCAACCTTGCTACCAATTAATGTTTTACCACTCCCTGAAACGCCCATCAAAATAAAGCTTTCACCCGCCATTTAAAATCTCCTGAATCATCTTACCTGCTGCGATACTACGCCTGGTGGCATAATAATTTCACGTTTTTTTATTTCTGCTGATAAGAATTACAAGGCACATCACGTTATGCGTAACATAGTAATGTAACAATTTTCTGACGTGATCTTCATCACAAATAATGACAATTAAAACCGCTTAAATGCTTCCGAGGTGTCTACCTGACCAGTGAGGAATTTATGCAAGTGAAAACACAGTCCTGCGTTGTTGCAGGCAAGAAAACTGTTGCCGTTACCGAGCAGACGATAGATTGGAATAATAATGGAACATTAGTACAAATAACCCGAGGTGGAATTTGCGGTTCCGATTTACATTATTATCAGGAAGGAAAAGTAGGTAATTTCATGATAAAGGCACCGATGGTGTTAGGTCATGAAGTTATCGGTAAAGTTATTCATAGCGACTCATCAGAATTACATGAAGGGCAAACGGTAGCCATTAATCCGTCTAAACCGTGCGGTCACTGCAAATACTGCATTGAACATAACGAGAATCAGTGTACAGATATGCGTTTTTTTGGCAGTGCCATGTATTTCCCTCATGTTGATGGTGGTTTTACCCGTTATAAAATGGTCGAAACGTCGCAATGTGTCCCTTATCCGGCCAAAGCTGACGAAAAGGTTATGGCTTTTGCCGAACCTTTAGCCGTCGCGATTCATGCCGCACATCAGGCCGGCGAGTTACAGGGCAAGCGAGTATTTATTTCTGGTGTTGGGCCCATTGGCTGCCTGATTGTCAGTGCTGTGAAAACACTGGGGGCCGCGGAAATTGTCTGTGCCGATGTGAGTCCCCGTTCCCTTTCGCTGGGCAAAGAGATGGGGGCGGAGGTGCTCGTAAACCCACAAAACGACGACATGGATCACTGGAAAGCGGAAAAAGGCTATTTCGATGTCAGCTTTGAAGTGTCCGGTCATCCTTCATCAGTGAATACCTGTCTGGAGGTCACTCGTGCACGCGGCGTAATGGTGCAGGTAGGTATGGGAGGCGCGATGGCAGAATTCCCAATGATGACATTGATTGGTAAGGAGATTTCACTCAAAGGCTCTTTCCGTTTTACCAGCGAATTTAATACCGCAGTGTCATGGCTGGCGAATGGCGTTATCAATCCACTGCCTTTACTGAGTGCTGAATATCCCTTCACTGACCTGGAAGAGGCGCTACGTTTCGCCGGTGATAAAACCCAGGCAGCAAAAGTCCAGCTTGTTTTCTAAGAGATAAATAAAGGAATAATACAATGAACGATCTATTTTCACTGGCAGGAAAAAATATCTTGATTACCGGTTCAGCACAGGGCATTGGCTTTTTACTGGCAACCGGCCTGGGTAAATATGGCGCACAAATAATTATTAATGATATTACTGCCGAACGCGCAGAACTTGCTGTAGAAAAACTCCACCAGGAGGGTATTCAGGCCGTTGCCGCACCTTTTAATGTTACTCATAAACATGAAATTGATGCCGCCGTTGAACATATCGAAAAGAACATCGGCCCCATT	NA	NA	NA	NA
