The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029197	Streptomyces venezuelae ATCC 10712 chromosome, complete genome	8223505	1565627	1572819	8223505		Bacillus_virus(16.67%)	8	NA	NA
WP_015032601.1|1565627_1566320_+	nucleotidyltransferase	NA	G3M9V9	Bacillus_virus	27.9	3.6e-15
WP_015032602.1|1566411_1567185_-	nucleotidyltransferase	NA	K4K696	Caulobacter_phage	37.1	1.4e-07
WP_015032603.1|1567188_1568211_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_015032604.1|1568207_1568975_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	46.7	3.7e-21
WP_015032605.1|1568971_1570051_-	AAA family ATPase	NA	A0A2K8HHU5	Bacteriophage	31.1	8.9e-29
WP_041662201.1|1570047_1570701_-	nicotinamide mononucleotide transporter	NA	A0A0F6YPU8	Sinorhizobium_phage	31.2	4.9e-14
WP_041662202.1|1570846_1572205_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_015032608.1|1572204_1572819_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.4	3.4e-09
>prophage 2
NZ_CP029197	Streptomyces venezuelae ATCC 10712 chromosome, complete genome	8223505	2315520	2323451	8223505	capsid,portal,terminase	Streptomyces_phage(33.33%)	9	NA	NA
WP_015033339.1|2315520_2316387_+	NAD-dependent epimerase/dehydratase family protein	NA	M1NML0	Moumouvirus	27.6	9.1e-08
WP_015033340.1|2316404_2316602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033342.1|2316891_2317167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106433832.1|2317495_2317942_+	hypothetical protein	NA	A0A2H5BLH4	Streptomyces_phage	47.9	3.2e-25
WP_015033345.1|2317934_2319665_+|terminase	phage terminase large subunit protein	terminase	K4NXE0	Streptomyces_phage	49.8	1.2e-136
WP_015033346.1|2319661_2321089_+|portal	phage portal protein	portal	A0A2H4JAT8	uncultured_Caudovirales_phage	41.5	1.6e-73
WP_015033347.1|2321069_2321840_+	hypothetical protein	NA	A0A2P1CI11	Mycobacterium_phage	27.2	6.0e-11
WP_015033348.1|2321894_2322482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033349.1|2322494_2323451_+|capsid	phage major capsid protein	capsid	V5R986	Arthrobacter_phage	36.1	4.9e-39
>prophage 3
NZ_CP029197	Streptomyces venezuelae ATCC 10712 chromosome, complete genome	8223505	2328136	2339147	8223505		Streptomyces_phage(100.0%)	8	NA	NA
WP_015033359.1|2328136_2332480_+	hypothetical protein	NA	A0A2H5BLS1	Streptomyces_phage	52.6	3.2e-125
WP_015033360.1|2332483_2334715_+	hypothetical protein	NA	Q6VY41	Streptomyces_phage	50.8	1.9e-198
WP_015033361.1|2334716_2335808_+	DUF5047 domain-containing protein	NA	Q6VY40	Streptomyces_phage	60.9	2.3e-117
WP_041663828.1|2336011_2336488_+	hypothetical protein	NA	Q6VY39	Streptomyces_phage	75.7	3.3e-60
WP_015033363.1|2336500_2337094_+	hypothetical protein	NA	Q6VY38	Streptomyces_phage	61.9	1.8e-63
WP_015033364.1|2337107_2337359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033366.1|2338370_2338724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033367.1|2338724_2339147_+	hypothetical protein	NA	Q6VY36	Streptomyces_phage	38.3	1.5e-11
>prophage 4
NZ_CP029197	Streptomyces venezuelae ATCC 10712 chromosome, complete genome	8223505	3115566	3151340	8223505	portal,head,tail,terminase,integrase,capsid	Streptomyces_phage(98.11%)	54	3115366:3115390	3150108:3150132
3115366:3115390	attL	TGGTGCCCGGAACCGGACTCGAACC	NA	NA	NA	NA
WP_110014473.1|3115566_3115977_-	hypothetical protein	NA	A0A142K659	Streptomyces_phage	100.0	5.9e-66
WP_015034041.1|3116171_3116390_+	helix-turn-helix domain-containing protein	NA	A0A142K660	Streptomyces_phage	100.0	8.6e-32
WP_015034042.1|3116386_3116629_+	hypothetical protein	NA	A0A142K661	Streptomyces_phage	100.0	2.6e-37
WP_015034043.1|3116705_3116930_+	hypothetical protein	NA	A0A142K662	Streptomyces_phage	100.0	9.1e-37
WP_015034044.1|3117036_3117528_+	hypothetical protein	NA	A0A142K664	Streptomyces_phage	100.0	4.1e-90
WP_015034045.1|3117527_3117902_+	hypothetical protein	NA	A0A142K665	Streptomyces_phage	100.0	1.3e-75
WP_015034046.1|3117898_3118348_+	hypothetical protein	NA	A0A142K666	Streptomyces_phage	100.0	5.6e-78
WP_145953706.1|3118344_3118935_+	hypothetical protein	NA	A0A142K667	Streptomyces_phage	100.0	2.7e-112
WP_015034048.1|3118927_3119212_+	hypothetical protein	NA	A0A142K668	Streptomyces_phage	100.0	6.5e-48
WP_041662475.1|3119208_3119415_+	hypothetical protein	NA	A0A142K669	Streptomyces_phage	100.0	7.6e-38
WP_015034049.1|3119418_3119826_+	MarR family transcriptional regulator	NA	A0A142K670	Streptomyces_phage	100.0	6.2e-76
WP_041662476.1|3119896_3120979_+	hypothetical protein	NA	A0A142K671	Streptomyces_phage	100.0	3.1e-170
WP_015034051.1|3121016_3121328_+	hypothetical protein	NA	A0A142K672	Streptomyces_phage	100.0	5.7e-53
WP_015034052.1|3121324_3121981_+	helix-turn-helix transcriptional regulator	NA	A0A142K673	Streptomyces_phage	99.5	1.1e-111
WP_167537156.1|3122011_3122266_+	WhiB family transcriptional regulator	NA	A0A142K674	Streptomyces_phage	100.0	1.3e-44
WP_051025877.1|3122301_3123294_+	hypothetical protein	NA	A0A142K675	Streptomyces_phage	100.0	1.4e-177
WP_015034055.1|3123290_3123983_+	hypothetical protein	NA	A0A142K676	Streptomyces_phage	100.0	5.9e-135
WP_015034056.1|3123979_3124507_+	HTH domain-containing protein	NA	A0A142K677	Streptomyces_phage	100.0	5.8e-90
WP_015034057.1|3124622_3124883_+	hypothetical protein	NA	A0A142K678	Streptomyces_phage	100.0	2.3e-39
WP_145953707.1|3124977_3125160_+	hypothetical protein	NA	A0A142K679	Streptomyces_phage	100.0	2.2e-28
WP_015034059.1|3125156_3125363_+	hypothetical protein	NA	A0A142K680	Streptomyces_phage	100.0	3.5e-35
WP_078508881.1|3125548_3125731_+	hypothetical protein	NA	A0A142K681	Streptomyces_phage	98.3	3.9e-30
WP_015034061.1|3125879_3126362_+|terminase	phage terminase small subunit P27 family	terminase	A0A142K627	Streptomyces_phage	100.0	3.1e-90
WP_069202201.1|3126453_3128190_+|terminase	terminase large subunit	terminase	A0A142K628	Streptomyces_phage	100.0	0.0e+00
WP_015034063.1|3128207_3128390_+	hypothetical protein	NA	A0A142K629	Streptomyces_phage	100.0	1.3e-09
WP_015034064.1|3128392_3130405_+|portal	phage portal protein	portal	A0A142K630	Streptomyces_phage	100.0	0.0e+00
WP_041662478.1|3130591_3131293_+	hypothetical protein	NA	A0A142K631	Streptomyces_phage	100.0	1.3e-129
WP_015034066.1|3131349_3132579_+|capsid	phage major capsid protein	capsid	A0A142K632	Streptomyces_phage	100.0	1.3e-230
WP_015034067.1|3132629_3133007_+	hypothetical protein	NA	A0A142K633	Streptomyces_phage	100.0	1.3e-59
WP_015034068.1|3133092_3133452_+	hypothetical protein	NA	A0A142K634	Streptomyces_phage	100.0	1.4e-42
WP_015034069.1|3133451_3134036_+	hypothetical protein	NA	A0A142K635	Streptomyces_phage	100.0	5.8e-107
WP_015034070.1|3134032_3134365_+|head,tail	head-tail adaptor protein	head,tail	A0A142K636	Streptomyces_phage	100.0	9.0e-57
WP_015034071.1|3134366_3134741_+	hypothetical protein	NA	A0A142K637	Streptomyces_phage	100.0	2.3e-61
WP_041663926.1|3134764_3135163_+	DUF3168 domain-containing protein	NA	A0A142K638	Streptomyces_phage	100.0	6.3e-73
WP_015034073.1|3135229_3135568_+	hypothetical protein	NA	A0A142K639	Streptomyces_phage	100.0	1.0e-47
WP_015034074.1|3135569_3136001_+	hypothetical protein	NA	A0A142K640	Streptomyces_phage	100.0	2.7e-77
WP_015034075.1|3136017_3136431_+	hypothetical protein	NA	A0A142K641	Streptomyces_phage	100.0	2.5e-72
WP_015034076.1|3136451_3136754_+	hypothetical protein	NA	A0A142K642	Streptomyces_phage	100.0	2.3e-51
WP_015034077.1|3136750_3138787_+	hypothetical protein	NA	A0A142K643	Streptomyces_phage	100.0	4.7e-273
WP_015034078.1|3138789_3141558_+	hypothetical protein	NA	A0A142K644	Streptomyces_phage	100.0	0.0e+00
WP_015034079.1|3141569_3142007_+	hypothetical protein	NA	A0A142K645	Streptomyces_phage	100.0	2.1e-77
WP_015034080.1|3142077_3142953_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A142K646	Streptomyces_phage	100.0	4.5e-172
WP_015034081.1|3142965_3143193_+	hypothetical protein	NA	A0A142K647	Streptomyces_phage	100.0	1.2e-33
WP_051025879.1|3143156_3143435_+	hypothetical protein	NA	A0A142K648	Streptomyces_phage	98.8	2.3e-37
WP_015034083.1|3143479_3143692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015034085.1|3143953_3145177_+	helix-turn-helix domain-containing protein	NA	A0A142K650	Streptomyces_phage	100.0	1.2e-231
WP_015034086.1|3145295_3145739_+	hypothetical protein	NA	A0A142K651	Streptomyces_phage	100.0	5.2e-76
WP_015034087.1|3145877_3146357_+	hypothetical protein	NA	A0A142K652	Streptomyces_phage	100.0	2.2e-88
WP_078508664.1|3146618_3146777_-	helix-turn-helix transcriptional regulator	NA	A0A142K654	Streptomyces_phage	100.0	2.4e-20
WP_015034090.1|3146971_3147922_-	putative regulatory protein	NA	A0A142K655	Streptomyces_phage	100.0	6.6e-177
WP_158506259.1|3148085_3148247_+	hypothetical protein	NA	A0A142K656	Streptomyces_phage	98.1	3.3e-20
WP_041662481.1|3148374_3148641_+	hypothetical protein	NA	A0A142K657	Streptomyces_phage	100.0	2.6e-38
WP_015034093.1|3148723_3150010_-|integrase	site-specific integrase	integrase	A0A142K658	Streptomyces_phage	100.0	1.7e-252
WP_015034094.1|3150569_3151340_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.1	7.3e-17
3150108:3150132	attR	TGGTGCCCGGAACCGGACTCGAACC	NA	NA	NA	NA
>prophage 5
NZ_CP029197	Streptomyces venezuelae ATCC 10712 chromosome, complete genome	8223505	4698281	4716605	8223505	tail	Streptomyces_phage(72.73%)	14	NA	NA
WP_041662771.1|4698281_4701764_+	DNA-directed RNA polymerase subunit beta	NA	G8DH04	Emiliania_huxleyi_virus	22.2	2.0e-29
WP_015035542.1|4701871_4705771_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	6.5e-53
WP_015035543.1|4705836_4706100_-	hypothetical protein	NA	A0A1J0MCA5	Streptomyces_phage	78.2	2.8e-29
WP_015035544.1|4706086_4706332_-	hypothetical protein	NA	A0A142K647	Streptomyces_phage	69.3	1.1e-19
WP_015035545.1|4706355_4707267_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1N078	Streptomyces_phage	59.8	1.1e-101
WP_015035546.1|4707344_4707755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015035547.1|4707813_4708383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015035548.1|4708382_4709513_-	hypothetical protein	NA	A0A2H5BLE2	Streptomyces_phage	45.3	2.7e-84
WP_015035549.1|4709524_4710670_-	hypothetical protein	NA	A0A1J0MCI7	Streptomyces_phage	38.5	6.3e-57
WP_015035550.1|4710701_4711895_-	hypothetical protein	NA	A0A1V0E646	Streptomyces_phage	44.1	1.4e-43
WP_015035551.1|4711932_4713126_-	hypothetical protein	NA	A0A2H5BLD9	Streptomyces_phage	48.2	3.2e-43
WP_015035552.1|4713175_4714108_-	hypothetical protein	NA	A0A1J0MCE5	Streptomyces_phage	43.1	7.7e-53
WP_015035553.1|4714155_4715403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015035554.1|4715399_4716605_-|tail	phage tail protein	tail	Q8SBP1	Clostridium_phage	45.1	1.1e-08
>prophage 6
NZ_CP029197	Streptomyces venezuelae ATCC 10712 chromosome, complete genome	8223505	6320495	6373132	8223505	tail,protease,plate	uncultured_Caudovirales_phage(25.0%)	39	NA	NA
WP_015036990.1|6320495_6323660_+|protease	serine protease	protease	NA	NA	NA	NA
WP_015036991.1|6323694_6325224_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	A0A2H4JC96	uncultured_Caudovirales_phage	37.3	8.0e-07
WP_150162267.1|6325275_6325632_-	extradiol dioxygenase	NA	NA	NA	NA	NA
WP_041663018.1|6325905_6328623_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_015036994.1|6328739_6329555_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_015036995.1|6330180_6331626_+	carbohydrate ABC transporter, N-acetylglucosamine/diacetylchitobiose-binding protein	NA	NA	NA	NA	NA
WP_015036996.1|6331727_6332657_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015036997.1|6332656_6333595_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_015036998.1|6333820_6335041_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_015036999.1|6335162_6336227_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_078508918.1|6336524_6337289_+	sugar ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	30.7	2.3e-10
WP_015037001.1|6337285_6338605_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015037002.1|6338860_6340819_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_015037003.1|6340941_6342456_+	amino acid permease	NA	NA	NA	NA	NA
WP_015037004.1|6342564_6343659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015037005.1|6343729_6345868_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_041663019.1|6345864_6347079_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_015037007.1|6347419_6348703_-	ribonuclease D	NA	NA	NA	NA	NA
WP_015037008.1|6348785_6349451_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041663020.1|6349689_6350391_-	DUF3000 domain-containing protein	NA	NA	NA	NA	NA
WP_015037010.1|6350482_6351559_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_015037011.1|6351653_6353027_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_051025953.1|6353036_6354050_-	DUF4349 domain-containing protein	NA	NA	NA	NA	NA
WP_015037013.1|6354185_6355685_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_041663021.1|6355702_6356416_+	chlorite dismutase family protein	NA	NA	NA	NA	NA
WP_041664326.1|6356610_6357657_-	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_015037016.1|6357664_6359065_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_015037018.1|6360907_6361486_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015037019.1|6361482_6363444_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_015037020.1|6363443_6363866_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	44.9	1.9e-06
WP_015037021.1|6363865_6364183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015037022.1|6364194_6366012_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_015037023.1|6366008_6366731_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015037024.1|6366837_6367263_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_071892231.1|6367332_6370452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015037026.1|6370456_6370615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015037027.1|6370611_6371106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015037028.1|6371102_6371543_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015037029.1|6371578_6373132_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.9	4.7e-71
