The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	0	2767	5099311		Staphylococcus_phage(100.0%)	5	NA	NA
WP_000059111.1|19_1423_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122083097.1|1719_1800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|2029_2170_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2186_2546_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2509_2767_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 2
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	12964	14302	5099311		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|12964_14302_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 3
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	24669	32184	5099311		Bacillus_phage(25.0%)	6	NA	NA
WP_021515182.1|24669_25443_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251985.1|25533_26424_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|26423_27383_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|27469_28510_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|28823_30653_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933754.1|30813_32184_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 4
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	44139	45132	5099311		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845129.1|44139_45132_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	2.2e-50
>prophage 5
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	48300	54153	5099311		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_021515183.1|48300_50169_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.0e-64
WP_001350412.1|50335_50755_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387779.1|50762_52268_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|52272_53238_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|53262_54153_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 6
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	67544	69191	5099311		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012594.1|67544_69191_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.5e-67
>prophage 7
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	76787	82201	5099311		Bacillus_phage(33.33%)	4	NA	NA
WP_001238853.1|76787_78809_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.9e-112
WP_001314257.1|78855_80340_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|80475_81741_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|81871_82201_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 8
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	86243	92387	5099311		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866674.1|86243_87374_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	2.3e-27
WP_150330571.1|87370_88633_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	7.7e-24
WP_001226621.1|88632_89700_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
WP_000676056.1|89718_90600_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145189.1|90577_91252_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612051.1|91256_92387_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 9
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	100461	102117	5099311		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395836.1|100461_102117_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 10
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	110216	111533	5099311		Salmonella_phage(100.0%)	1	NA	NA
WP_001014285.1|110216_111533_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	49.1	3.5e-11
>prophage 11
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	114952	118811	5099311		Bacillus_phage(100.0%)	3	NA	NA
WP_000130676.1|114952_115849_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213586.1|115848_116565_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|116648_118811_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 12
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	126181	128011	5099311		Catovirus(100.0%)	1	NA	NA
WP_024188842.1|126181_128011_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	3.7e-83
>prophage 13
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	138471	139980	5099311		Vibrio_phage(100.0%)	1	NA	NA
WP_000037973.1|138471_139980_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 14
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	161975	165262	5099311		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|161975_163616_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|163694_163964_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|163967_164483_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|164485_165262_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 15
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	174143	174758	5099311		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|174143_174758_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 16
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	188445	191232	5099311		uncultured_virus(100.0%)	1	NA	NA
WP_000250046.1|188445_191232_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 17
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	195258	197729	5099311		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|195258_196668_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190574.1|196679_197729_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
>prophage 18
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	201614	206344	5099311		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|201614_202403_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_001363089.1|202442_203339_-	sugar kinase	NA	NA	NA	NA	NA
WP_000190782.1|203510_204389_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
WP_000094544.1|204413_205301_+	aldolase	NA	NA	NA	NA	NA
WP_000357981.1|205333_206344_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 19
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	218940	221991	5099311		Escherichia_phage(100.0%)	1	NA	NA
WP_012579028.1|218940_221991_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 20
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	233094	237955	5099311		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001350871.1|233094_233715_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	2.4e-63
WP_001166063.1|233974_234958_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270237.1|235106_235781_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|235886_237260_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|237256_237955_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 21
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	249565	254068	5099311		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|249565_250411_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|250835_251081_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|251165_251651_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|251743_252670_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|252736_254068_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 22
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	267278	271872	5099311		Pandoravirus(100.0%)	3	NA	NA
WP_000859437.1|267278_268829_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
WP_000105536.1|269061_270186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150330574.1|270318_271872_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	1.3e-09
>prophage 23
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	278685	285932	5099311		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424854.1|278685_279348_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_150330575.1|279359_281861_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|282169_283249_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|283263_283584_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_150330576.1|283634_285932_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 24
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	298075	299290	5099311		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691040.1|298075_299290_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	27.9	3.8e-44
>prophage 25
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	304730	310513	5099311	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125464.1|304730_306047_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
WP_122083113.1|306150_306801_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|306800_307160_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187001.1|307199_308300_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000591379.1|308668_310513_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
>prophage 26
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	318854	321907	5099311		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|318854_319805_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|320722_321907_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 27
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	325902	334231	5099311		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|325902_329931_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653952.1|330007_334231_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
>prophage 28
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	342524	344288	5099311		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|342524_343196_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|343238_343829_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|344015_344288_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 29
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	349650	351240	5099311		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187584.1|349650_351240_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 30
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	364937	368621	5099311		Dickeya_phage(100.0%)	1	NA	NA
WP_000096034.1|364937_368621_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 31
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	392962	394078	5099311		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|392962_394078_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 32
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	401427	425606	5099311	holin	Enterobacteria_phage(45.71%)	39	NA	NA
WP_000646078.1|401427_402036_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001296637.1|402108_403434_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001296638.1|403549_403759_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416264.1|403800_404316_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_000956557.1|404680_405214_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093916.1|405631_405913_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_001061345.1|405949_406522_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_021038213.1|406521_407094_-	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	65.3	2.5e-62
WP_000224220.1|407104_407368_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_021038214.1|407369_407906_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	65.7	1.5e-61
WP_021038215.1|407907_408207_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	8.1e-57
WP_021038216.1|408203_408620_-	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	48.7	6.3e-31
WP_021038217.1|408610_409147_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	3.1e-99
WP_001673539.1|409274_410099_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	1.7e-149
WP_085447418.1|410164_410527_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	5.6e-60
WP_032153466.1|410915_411194_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	92.3	1.5e-12
WP_001020632.1|411249_411942_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_071784359.1|411915_412038_+	amino acid permease	NA	NA	NA	NA	NA
WP_001191669.1|412039_412300_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_021038219.1|412292_412850_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	96.8	3.3e-96
WP_001250270.1|413025_413238_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_123006721.1|413818_414187_+	hypothetical protein	NA	U5P0A0	Shigella_phage	96.7	2.8e-67
WP_077772149.1|414183_414666_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	95.1	1.2e-81
WP_000066917.1|414665_415319_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|415315_415642_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767105.1|415638_416028_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_001061438.1|416047_416857_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_021038222.1|416864_417854_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.5	8.9e-193
WP_001204822.1|417871_418243_+	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	85.4	1.7e-59
WP_000489186.1|418556_418964_+	hypothetical protein	NA	A0A0U2KD34	Escherichia_phage	63.2	1.1e-43
WP_001318187.1|418999_419731_+	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	74.4	5.2e-97
WP_024186198.1|420195_420411_+|holin	holin	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
WP_000193274.1|420415_420766_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_150330577.1|420829_421309_+	glycoside hydrolase family protein	NA	Q08J98	Stx2-converting_phage	93.6	2.1e-75
WP_104976648.1|421453_422602_+	peptidase	NA	A5LH69	Enterobacteria_phage	80.6	2.9e-163
WP_000620698.1|422598_422823_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_024249647.1|422819_423638_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
WP_001315196.1|423634_424129_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_001175155.1|424787_425606_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	2.5e-47
>prophage 33
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	437106	440688	5099311		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001001003.1|437106_438258_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
WP_000494233.1|438386_439442_-	response regulator	NA	NA	NA	NA	NA
WP_000792585.1|439458_440688_-	ATPase	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
>prophage 34
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	447513	448089	5099311		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|447513_448089_-	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 35
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	482724	483990	5099311	integrase	Enterobacteria_phage(100.0%)	1	470696:470709	485641:485654
470696:470709	attL	AATTACCGTCTTTG	NA	NA	NA	NA
WP_001218869.1|482724_483990_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|482724_483990_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
485641:485654	attR	CAAAGACGGTAATT	NA	NA	NA	NA
>prophage 36
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	492324	494308	5099311		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|492324_492618_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|492661_494308_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 37
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	498512	499046	5099311		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|498512_499046_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 38
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	503966	504944	5099311		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|503966_504944_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 39
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	512940	513486	5099311		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|512940_513486_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 40
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	517512	530543	5099311	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990304.1|517512_518850_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
WP_001298688.1|518859_520707_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001280359.1|520699_521650_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|521735_522044_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|522119_523400_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312482.1|523485_524745_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|524747_525752_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|525833_526031_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|526134_527433_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|527637_528063_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076340.1|528101_530543_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
>prophage 41
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	534386	535550	5099311		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944012.1|534386_535550_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 42
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	577798	584286	5099311		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|577798_578329_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265925.1|578638_579595_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205834.1|579734_581237_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	6.2e-12
WP_001298067.1|581250_582273_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595996.1|582259_583255_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|583287_584286_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 43
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	588604	591365	5099311		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106233.1|588604_589069_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187799.1|589226_591365_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 44
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	595003	601100	5099311		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|595003_595951_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|596135_596189_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471858.1|596329_599026_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.5e-45
WP_000047539.1|599231_599618_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_150330584.1|599690_600152_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|600164_601100_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 45
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	611446	620626	5099311	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416385.1|611446_614302_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|614301_614745_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|615002_616514_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|616780_617881_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_150330585.1|617880_618963_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_150330586.1|619123_620626_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	4.4e-82
>prophage 46
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	625755	629907	5099311	transposase	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_001350789.1|625755_626775_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_150330587.1|628678_629907_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	4.1e-171
>prophage 47
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	639824	641549	5099311		Bacillus_virus(50.0%)	2	NA	NA
WP_000175457.1|639824_640592_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|640592_641549_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 48
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	649533	649743	5099311		Escherichia_phage(100.0%)	1	NA	NA
WP_000937727.1|649533_649743_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
>prophage 49
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	661712	664122	5099311		Yersinia_phage(33.33%)	4	NA	NA
WP_001234655.1|661712_662531_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
WP_001350782.1|662872_663346_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001186775.1|663361_663838_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|663900_664122_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 50
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	687061	688042	5099311		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991438.1|687061_688042_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 51
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	691404	693081	5099311		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|691404_692007_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|692484_693081_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 52
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	703349	704810	5099311		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_021515215.1|703349_704810_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	1.4e-48
>prophage 53
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	711379	711934	5099311		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|711379_711934_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 54
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	717880	718801	5099311	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_001513532.1|717880_718801_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	6.4e-60
>prophage 55
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	723677	727646	5099311		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001387312.1|723677_725147_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_001513536.1|725213_727646_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
>prophage 56
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	745174	746454	5099311		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|745174_745912_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001513545.1|745914_746454_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 57
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	754281	757157	5099311		Streptococcus_phage(50.0%)	3	NA	NA
WP_137508726.1|754281_755871_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.7	1.6e-29
WP_001295748.1|756263_756869_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|756995_757157_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 58
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	763196	764519	5099311		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|763196_764519_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 59
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	771262	776617	5099311		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|771262_772495_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|772801_774469_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409456.1|774679_776617_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 60
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	779900	782014	5099311		Bacillus_phage(50.0%)	2	NA	NA
WP_001188664.1|779900_780590_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_001219614.1|780589_782014_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
>prophage 61
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	793781	794735	5099311		Cyanophage(100.0%)	1	NA	NA
WP_000130187.1|793781_794735_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 62
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	797871	812391	5099311	tRNA	Chrysochromulina_ericina_virus(16.67%)	12	NA	NA
WP_000516135.1|797871_799788_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|799876_801007_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|801111_801321_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274823.1|801875_802637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350775.1|802656_804150_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	2.8e-28
WP_021514788.1|804278_805538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681386.1|805772_806939_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	3.0e-91
WP_000062878.1|806998_807904_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001274021.1|807998_808262_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001337277.1|808364_808583_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_000767329.1|808590_809532_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286813.1|809574_812391_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.7	4.6e-77
>prophage 63
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	817199	818348	5099311		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|817199_818348_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 64
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	821810	830221	5099311	transposase	Saccharomonospora_phage(33.33%)	9	NA	NA
WP_000526115.1|821810_822269_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000196509.1|822305_822524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000333104.1|822558_822954_+	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_000122880.1|823072_823663_-	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_000004399.1|823668_824454_-	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_150330592.1|824562_826116_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	7.0e-35
WP_000349942.1|826188_827406_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|827533_828676_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|828706_830221_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 65
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	838115	840077	5099311		Bacillus_phage(50.0%)	3	NA	NA
WP_000624375.1|838115_838595_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|838680_838914_+	antitoxin	NA	NA	NA	NA	NA
WP_000257201.1|839228_840077_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 66
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	847854	853276	5099311		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|847854_850761_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_150330594.1|850924_853276_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	8.7e-37
>prophage 67
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	861551	862250	5099311		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916269.1|861551_862250_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-21
>prophage 68
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	873728	875453	5099311		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425644.1|873728_875453_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 69
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	901423	902467	5099311		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|901423_902467_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 70
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	906713	907265	5099311		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|906713_907265_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 71
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	919680	921105	5099311		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|919680_921105_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 72
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	928925	935393	5099311		Mamastrovirus(33.33%)	5	NA	NA
WP_001189635.1|928925_930476_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
WP_150330595.1|930522_932913_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_000683335.1|933118_933655_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|933695_934358_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|934466_935393_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 73
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	938655	939540	5099311		Sodalis_phage(100.0%)	1	NA	NA
WP_000339931.1|938655_939540_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.4	1.0e-59
>prophage 74
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	949431	956237	5099311	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|949431_950850_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937401.1|950888_951815_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|951851_952307_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396047.1|952484_953189_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294708.1|953203_953734_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001362943.1|953807_956237_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	1.0e-40
>prophage 75
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	961378	962176	5099311		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|961378_962176_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 76
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	968087	968432	5099311		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|968087_968432_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 77
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	972361	973786	5099311	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753936.1|972361_973786_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 78
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	985363	986122	5099311		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|985363_986122_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 79
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	994950	999066	5099311		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569434.1|994950_995547_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294798.1|995583_999066_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
>prophage 80
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1012023	1013055	5099311		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|1012023_1013055_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 81
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1019580	1027432	5099311		Indivirus(25.0%)	9	NA	NA
WP_000997016.1|1019580_1020384_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_000648548.1|1020380_1021295_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1021535_1022336_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211705.1|1022413_1023184_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|1023230_1024589_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052741.1|1024660_1025416_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|1025449_1026172_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1026168_1026636_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|1026700_1027432_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 82
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1036694	1039454	5099311		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614314.1|1036694_1039454_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	4.7e-82
>prophage 83
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1050144	1052127	5099311		Ralstonia_phage(100.0%)	1	NA	NA
WP_000053636.1|1050144_1052127_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-26
>prophage 84
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1061707	1065030	5099311		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|1061707_1062286_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|1062490_1063258_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1063228_1063969_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|1064280_1065030_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
>prophage 85
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1071003	1072155	5099311		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001331869.1|1071003_1072155_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
>prophage 86
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1076903	1086514	5099311		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000749902.1|1076903_1077959_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|1078247_1079351_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|1079362_1080616_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
WP_000772639.1|1080960_1081299_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_001298126.1|1081733_1082258_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001034008.1|1082383_1086514_-	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.6	3.3e-281
>prophage 87
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1104797	1105649	5099311		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|1104797_1105649_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 88
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1113673	1114999	5099311		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046332.1|1113673_1114999_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
>prophage 89
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1124924	1132496	5099311	holin,integrase	Escherichia_phage(33.33%)	6	1123641:1123654	1126638:1126651
1123641:1123654	attL	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001295805.1|1124924_1125488_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001331886.1|1125593_1125779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001159135.1|1126558_1128247_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
1126638:1126651	attR	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001350625.1|1128260_1129733_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001314510.1|1129746_1130334_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131041.1|1130462_1132496_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 90
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1145235	1149773	5099311		Bacillus_virus(50.0%)	4	NA	NA
WP_000447331.1|1145235_1146720_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818902.1|1146712_1147684_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750346.1|1147680_1148637_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692719.1|1148723_1149773_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.8e-71
>prophage 91
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1157304	1159191	5099311		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021514898.1|1157304_1159191_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	4.8e-54
>prophage 92
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1164149	1171431	5099311		Herpes_simplex_virus(33.33%)	5	NA	NA
WP_000177872.1|1164149_1167224_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.5	0.0e+00
WP_150330598.1|1167346_1168429_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	98.9	7.0e-191
WP_001096705.1|1168630_1169170_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419070.1|1169395_1170229_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842109.1|1170321_1171431_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 93
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1176723	1177491	5099311		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|1176723_1177491_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 94
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1184399	1185557	5099311		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830766.1|1184399_1185557_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 95
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1192972	1194088	5099311		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|1192972_1194088_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 96
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1198377	1208475	5099311		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|1198377_1199289_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219315.1|1199413_1200322_+	fructokinase	NA	NA	NA	NA	NA
WP_001331503.1|1200590_1201775_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698877.1|1201900_1205044_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221279.1|1205040_1206243_-	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	25.1	9.1e-06
WP_000113933.1|1206432_1207122_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|1207179_1208475_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 97
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1215552	1224394	5099311	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|1215552_1216680_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|1216702_1217035_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|1217062_1218910_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1218920_1219892_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_001317658.1|1220021_1220369_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295827.1|1220406_1221291_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001298536.1|1221588_1222128_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1222278_1222728_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150487.1|1222731_1223835_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.7e-54
WP_001350619.1|1223923_1224394_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 98
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1245836	1250883	5099311	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1245836_1246460_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1246585_1247860_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1248047_1250402_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1250610_1250883_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 99
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1254023	1254719	5099311		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|1254023_1254719_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 100
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1258042	1261589	5099311		Bacillus_phage(100.0%)	2	NA	NA
WP_001235600.1|1258042_1259815_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.4e-50
WP_001256184.1|1259807_1261589_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	2.0e-41
>prophage 101
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1270426	1273576	5099311		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1270426_1273576_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 102
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1280584	1289042	5099311		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|1280584_1281136_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122015.1|1281264_1283196_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1283248_1283578_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1283577_1284183_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678211.1|1284292_1286167_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.4e-117
WP_001331495.1|1286347_1286992_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|1287123_1288086_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801795.1|1288082_1289042_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	5.0e-15
>prophage 103
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1298604	1301846	5099311		Escherichia_phage(66.67%)	3	NA	NA
WP_000057524.1|1298604_1298907_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	80.0	2.2e-41
WP_000806442.1|1298942_1299284_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083945.1|1299341_1301846_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.0e-115
>prophage 104
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1308943	1309621	5099311		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|1308943_1309621_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 105
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1312757	1313444	5099311		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110564.1|1312757_1313444_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.9e-32
>prophage 106
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1319697	1321479	5099311		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_021514909.1|1319697_1321479_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 107
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1327669	1328815	5099311		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331490.1|1327669_1328815_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 108
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1340669	1345145	5099311	tail,tRNA,integrase	Moumouvirus(20.0%)	7	1343866:1343879	1347175:1347188
WP_000912345.1|1340669_1342055_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|1342090_1342612_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_150330605.1|1342719_1342932_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|1342933_1343800_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
1343866:1343879	attL	GCGCTGTCAGTTTT	NA	NA	NA	NA
WP_001351011.1|1344154_1344535_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	77.9	3.6e-41
WP_001304815.1|1344482_1344782_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	80.0	6.5e-30
WP_000259980.1|1344839_1345145_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
1347175:1347188	attR	GCGCTGTCAGTTTT	NA	NA	NA	NA
>prophage 109
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1353946	1356062	5099311		Hokovirus(50.0%)	2	NA	NA
WP_000253820.1|1353946_1355389_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
WP_000770953.1|1355378_1356062_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 110
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1359207	1362351	5099311		Leptospira_phage(100.0%)	1	NA	NA
WP_000573983.1|1359207_1362351_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.3e-59
>prophage 111
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1373288	1379331	5099311		Tupanvirus(50.0%)	3	NA	NA
WP_000077765.1|1373288_1377170_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	1.7e-61
WP_000096768.1|1377385_1378519_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140634.1|1378515_1379331_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 112
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1393633	1395456	5099311		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502940.1|1393633_1394263_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029771.1|1394235_1395456_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
>prophage 113
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1398561	1400676	5099311		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|1398561_1400127_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001308472.1|1400247_1400676_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
>prophage 114
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1414763	1415410	5099311		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|1414763_1414973_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|1415026_1415410_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 115
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1419625	1422065	5099311		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|1419625_1420837_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231442.1|1420976_1422065_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 116
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1429075	1434198	5099311	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001362899.1|1429075_1431658_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
WP_001044880.1|1431892_1432375_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207539.1|1432419_1433355_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631389.1|1433472_1434198_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 117
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1442145	1443225	5099311		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1442145_1443225_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 118
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1447718	1449383	5099311		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1447718_1449383_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 119
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1454008	1455955	5099311		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|1454008_1455955_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 120
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1464253	1466899	5099311	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_000679501.1|1464253_1465015_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
WP_001287134.1|1465234_1466899_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 121
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1471051	1471816	5099311		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773263.1|1471051_1471816_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	7.5e-06
>prophage 122
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1478471	1490304	5099311		Hokovirus(40.0%)	10	NA	NA
WP_000186082.1|1478471_1479149_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001350605.1|1479145_1481830_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001331974.1|1481822_1482395_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087931.1|1482403_1484452_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	7.9e-26
WP_000730081.1|1484474_1486148_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|1486147_1486237_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424788.1|1486549_1486756_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075783.1|1486856_1487366_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207170.1|1487362_1488781_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	4.7e-62
WP_001032722.1|1488822_1490304_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 123
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1493682	1494474	5099311		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114008.1|1493682_1494474_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.4	3.7e-08
>prophage 124
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1521761	1525281	5099311		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|1521761_1522481_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951260.1|1522477_1523419_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_000784341.1|1523532_1523913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109195.1|1524228_1525281_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 125
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1529644	1536220	5099311		Tupanvirus(33.33%)	7	NA	NA
WP_001265445.1|1529644_1530661_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	8.0e-80
WP_000096843.1|1530923_1532396_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.6e-12
WP_001147445.1|1532463_1533252_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1533380_1533530_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113014.1|1533696_1534470_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604040.1|1534469_1535159_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891671.1|1535161_1536220_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	9.7e-20
>prophage 126
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1546482	1547772	5099311		Klosneuvirus(100.0%)	1	NA	NA
WP_001362906.1|1546482_1547772_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 127
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1554099	1555008	5099311		Streptococcus_phage(100.0%)	1	NA	NA
WP_150330608.1|1554099_1555008_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	4.9e-28
>prophage 128
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1565606	1577268	5099311		Anomala_cuprea_entomopoxvirus(20.0%)	10	NA	NA
WP_001331962.1|1565606_1567343_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001331961.1|1567335_1568331_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001295890.1|1568333_1569005_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007119.1|1569233_1570595_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_021514957.1|1571131_1573282_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	1.8e-41
WP_000386565.1|1573309_1574272_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000253505.1|1574412_1575498_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|1575725_1575986_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|1576250_1576517_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990167.1|1576590_1577268_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	6.9e-19
>prophage 129
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1583831	1589056	5099311		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|1583831_1584554_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|1584550_1585210_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1585348_1586095_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1586498_1587002_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|1587300_1588188_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_122083111.1|1588422_1588488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295296.1|1588540_1589056_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 130
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1594053	1600937	5099311		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|1594053_1595646_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114251.1|1595845_1596661_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209353.1|1596806_1599239_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000576971.1|1599244_1600144_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001350598.1|1600274_1600937_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 131
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1604152	1606024	5099311		Planktothrix_phage(100.0%)	1	NA	NA
WP_001350597.1|1604152_1606024_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 132
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1617358	1618561	5099311		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001467835.1|1617358_1618561_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.4e-99
>prophage 133
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1625050	1671062	5099311	tail,head,portal,capsid,integrase,terminase,lysis,plate	Salmonella_phage(76.6%)	60	1624576:1624602	1659381:1659407
1624576:1624602	attL	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_001471277.1|1625050_1626082_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	2.5e-105
WP_001321204.1|1626268_1626460_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_016245839.1|1626475_1627045_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.9e-38
WP_001247707.1|1627170_1627392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1627424_1627934_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|1627941_1628142_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963473.1|1628105_1628447_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244167.1|1628514_1628748_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	5.0e-30
WP_000752616.1|1628747_1628975_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_150330610.1|1628971_1629829_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	97.9	2.1e-161
WP_021514958.1|1629825_1632240_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_001154431.1|1632393_1632582_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|1632592_1632826_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_100207729.1|1633426_1634329_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_094658700.1|1634559_1636299_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_021514961.1|1636344_1637373_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	2.2e-170
WP_150330611.1|1637372_1639139_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_000216265.1|1639281_1640115_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.2e-121
WP_000742511.1|1640131_1641190_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_021514963.1|1641193_1641844_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	5.6e-111
WP_021514964.1|1641939_1642404_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|1642403_1642607_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1642610_1642826_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_096999131.1|1642845_1643319_+	lysozyme	NA	E5G6N1	Salmonella_phage	89.7	5.4e-79
WP_021514966.1|1643320_1643698_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_021514967.1|1643694_1644123_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	2.4e-46
WP_094322285.1|1644052_1644256_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	74.6	6.8e-23
WP_021514968.1|1644218_1644650_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.2e-71
WP_000829125.1|1644642_1645089_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	82.4	1.3e-61
WP_021514970.1|1645115_1645982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021514971.1|1646077_1646656_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177580.1|1646652_1647012_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_021514972.1|1646998_1647907_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	5.9e-143
WP_021514973.1|1647899_1648505_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	89.6	3.5e-107
WP_113446437.1|1648501_1649899_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.7	1.7e-152
WP_021514927.1|1649900_1650338_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.2	4.1e-49
WP_000368086.1|1650309_1650912_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.5	5.6e-97
WP_053899353.1|1650911_1651430_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.6	3.1e-56
WP_021514975.1|1651460_1652018_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_021514976.1|1652169_1653342_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	1.2e-204
WP_001207660.1|1653351_1653867_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281016.1|1653921_1654224_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_000763311.1|1654238_1654358_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_021514977.1|1654350_1657428_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.9	0.0e+00
WP_000980413.1|1657424_1657910_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001011797.1|1657906_1659007_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_021514978.1|1659097_1659316_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	66.2	4.9e-19
WP_001024876.1|1659551_1661237_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
1659381:1659407	attR	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|1661506_1661884_+	membrane protein	NA	NA	NA	NA	NA
WP_001195230.1|1661913_1662171_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|1662330_1662618_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|1662601_1663324_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1663384_1664287_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1664374_1664851_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|1665200_1666313_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|1666407_1667541_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|1667550_1668504_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1668500_1669346_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1669405_1669894_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149763.1|1669934_1671062_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
>prophage 134
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1674187	1676925	5099311		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|1674187_1674916_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|1675133_1675649_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1675774_1676098_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255187.1|1676094_1676925_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
>prophage 135
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1680512	1682231	5099311		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815373.1|1680512_1682231_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 136
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1691354	1724148	5099311	protease,tRNA	Vibrio_phage(20.0%)	21	NA	NA
WP_000188147.1|1691354_1693301_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1693373_1693598_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1693920_1694241_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_021514980.1|1694271_1696548_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.6	6.7e-167
WP_000097886.1|1697080_1698064_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|1698060_1701294_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000415806.1|1701623_1702931_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001029748.1|1703861_1704863_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000350182.1|1704873_1705428_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001040187.1|1706288_1706507_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|1706791_1707496_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202198.1|1707537_1709259_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043638.1|1709259_1711026_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_000537432.1|1711148_1712114_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|1712657_1713152_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_021514981.1|1713286_1717330_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.4	3.5e-86
WP_001295343.1|1717488_1718100_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|1718110_1719454_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1719544_1720837_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850286.1|1721075_1723520_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
WP_000213098.1|1723530_1724148_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 137
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1727233	1730448	5099311		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|1727233_1727974_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1728165_1730448_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 138
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1734546	1735635	5099311		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057124.1|1734546_1735635_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
>prophage 139
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1740722	1745262	5099311		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|1740722_1741007_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705727.1|1741212_1743477_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|1743513_1745262_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 140
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1759967	1770916	5099311	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|1759967_1760516_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|1760542_1761190_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|1761239_1762430_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977927.1|1762614_1763703_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000117881.1|1764304_1765705_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001298298.1|1765873_1767076_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193873.1|1767341_1769954_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	1.2e-18
WP_001090487.1|1770148_1770916_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
>prophage 141
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1779671	1781579	5099311		Tupanvirus(100.0%)	1	NA	NA
WP_150330613.1|1779671_1781579_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 142
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1794179	1796234	5099311		Bacillus_phage(100.0%)	1	NA	NA
WP_001350178.1|1794179_1796234_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 143
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1800468	1801128	5099311	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1800468_1801128_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 144
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1812122	1824634	5099311		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1812122_1812335_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1812345_1812534_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|1812508_1812739_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1812728_1812902_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_150330615.1|1812950_1814024_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_150330616.1|1814106_1816833_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	5.4e-38
WP_001264953.1|1816915_1817944_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1817916_1818609_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|1818738_1819911_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063164.1|1819910_1822457_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000210216.1|1822453_1823053_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|1823408_1823714_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|1823713_1824634_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 145
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1827664	1829658	5099311		Enterobacteria_phage(100.0%)	2	NA	NA
WP_001273658.1|1827664_1827838_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001028100.1|1829163_1829658_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	9.3e-50
>prophage 146
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1844118	1845042	5099311		Cronobacter_phage(100.0%)	1	NA	NA
WP_001304747.1|1844118_1845042_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.1e-91
>prophage 147
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1851862	1853230	5099311		Bacillus_phage(100.0%)	1	NA	NA
WP_000409834.1|1851862_1853230_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	9.6e-20
>prophage 148
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1856621	1857455	5099311		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1856621_1857455_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 149
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1861588	1862122	5099311		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1861588_1862122_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 150
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1871429	1872350	5099311		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|1871429_1872350_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 151
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1877011	1877257	5099311		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1877011_1877257_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 152
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1893137	1894079	5099311		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001331933.1|1893137_1894079_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 153
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1906435	1907617	5099311		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1906435_1907170_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1907380_1907617_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 154
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1910888	1912531	5099311		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257012.1|1910888_1911530_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.4	3.8e-27
WP_001267963.1|1911526_1912531_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 155
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1924853	1925111	5099311		Erwinia_phage(100.0%)	1	NA	NA
WP_000800132.1|1924853_1925111_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 156
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1932400	1936123	5099311		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|1932400_1933102_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251363.1|1933101_1934346_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291301.1|1934374_1935286_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|1935301_1936123_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 157
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1939398	1941376	5099311		Mycoplasma_phage(100.0%)	2	NA	NA
WP_021515002.1|1939398_1940256_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531578.1|1940239_1941376_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 158
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	1946397	2016562	5099311	tail,tRNA,head,portal,capsid,protease,integrase,terminase,lysis	Enterobacteria_phage(46.97%)	92	1938188:1938202	1995149:1995163
1938188:1938202	attL	CATCACCGTTAACGC	NA	NA	NA	NA
WP_000423737.1|1946397_1947768_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001295971.1|1947771_1948413_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001298466.1|1948448_1949555_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1949608_1950070_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_150330619.1|1950079_1950733_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1950904_1952155_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1952268_1953411_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_150330620.1|1953400_1953637_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1953776_1954016_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1953999_1954326_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1954325_1954547_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|1954933_1955125_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1955097_1955280_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1955276_1955957_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_021515003.1|1955953_1956739_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000995434.1|1956744_1957041_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_001496530.1|1957009_1957162_-	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
WP_000372923.1|1957116_1957260_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1957228_1957393_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|1957465_1957834_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|1958016_1958217_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|1958430_1959012_+	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|1959028_1959301_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1959278_1959461_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1959737_1960490_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1960486_1961044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|1961083_1961779_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1961854_1962070_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1962211_1962508_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|1962540_1963440_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|1963436_1964138_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1964134_1964425_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|1964498_1964939_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1964935_1965463_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1965459_1965636_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1965638_1965980_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950951.1|1965972_1966167_+	protein ninF	NA	NA	NA	NA	NA
WP_001099712.1|1966186_1966549_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1966545_1966686_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1966771_1967155_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1967343_1968426_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1969014_1969230_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|1969229_1969727_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1969943_1970126_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1970216_1970510_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1970990_1971317_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001327285.1|1971439_1971793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337542.1|1971680_1972001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1972268_1972817_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|1972788_1974717_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000258997.1|1974700_1974907_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|1974903_1976496_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253914.1|1976485_1977991_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1978027_1978375_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|1978432_1979461_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|1979512_1979887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1979879_1980233_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|1980244_1980823_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_150330621.1|1980819_1981215_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	3.8e-70
WP_001351266.1|1981222_1981963_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|1981978_1982401_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|1982382_1982817_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000840269.1|1982809_1985371_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000847405.1|1985367_1985697_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|1985696_1986395_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|1986400_1987144_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|1987080_1987713_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_150330622.1|1987773_1991253_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	89.7	0.0e+00
WP_150330623.1|1991320_1991920_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	8.5e-106
WP_150330624.1|1991984_1995227_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	93.0	6.3e-54
1995149:1995163	attR	CATCACCGTTAACGC	NA	NA	NA	NA
WP_000885580.1|1995226_1995811_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_001309429.1|1995783_1995921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240999.1|1995865_1996534_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1996590_1996860_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079492.1|1997632_1998139_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|1998184_1998685_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|1998770_1998950_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|1999330_2000137_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|2000136_2001330_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_021515029.1|2001341_2002700_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|2002703_2004299_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|2004298_2005861_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2005952_2005997_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|2006134_2007016_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2007012_2007633_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|2007660_2009556_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|2009768_2010644_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|2010683_2011274_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|2011270_2012029_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|2012248_2013298_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|2013333_2013585_-	YciN family protein	NA	NA	NA	NA	NA
WP_001304419.1|2013964_2016562_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 159
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2021472	2022063	5099311		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|2021472_2022063_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 160
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2029876	2031811	5099311		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485006.1|2029876_2031811_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	4.8e-33
>prophage 161
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2040745	2042763	5099311		Salmonella_phage(50.0%)	2	NA	NA
WP_000135020.1|2040745_2041909_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.6e-28
WP_000573407.1|2041956_2042763_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 162
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2062105	2063188	5099311		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|2062105_2063188_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 163
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2080412	2080928	5099311		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|2080412_2080928_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 164
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2085689	2095110	5099311	tRNA	Bacillus_phage(20.0%)	8	NA	NA
WP_001350888.1|2085689_2086922_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|2087176_2088160_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_123891623.1|2088448_2088679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000123782.1|2088637_2090011_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157413.1|2090139_2091075_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_071525889.1|2092143_2092323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295593.1|2093401_2093836_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|2093976_2095110_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 165
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2100069	2101059	5099311		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2100069_2101059_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 166
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2119931	2123834	5099311		Klosneuvirus(100.0%)	1	NA	NA
WP_000139522.1|2119931_2123834_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 167
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2127774	2128723	5099311		Escherichia_phage(50.0%)	2	NA	NA
WP_001350640.1|2127774_2128305_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731859.1|2128549_2128723_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 168
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2140274	2142236	5099311		Phage_TP(100.0%)	1	NA	NA
WP_001441964.1|2140274_2142236_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 169
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2145865	2146879	5099311		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220436.1|2145865_2146879_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
>prophage 170
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2152375	2154478	5099311		Salmonella_phage(100.0%)	1	NA	NA
WP_000689338.1|2152375_2154478_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.1	6.6e-137
>prophage 171
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2159103	2161509	5099311		Ralstonia_phage(100.0%)	1	NA	NA
WP_000053647.1|2159103_2161509_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.6	8.4e-27
>prophage 172
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2167994	2169539	5099311		Escherichia_phage(100.0%)	1	NA	NA
WP_000702551.1|2167994_2169539_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 173
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2180963	2182722	5099311		Escherichia_phage(66.67%)	3	NA	NA
WP_000781370.1|2180963_2181248_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000605675.1|2181247_2181526_-	hypothetical protein	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000642412.1|2181711_2182722_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
>prophage 174
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2186128	2188528	5099311		Klosneuvirus(100.0%)	1	NA	NA
WP_001362858.1|2186128_2188528_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	2.1e-09
>prophage 175
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2193996	2200932	5099311		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_000402827.1|2193996_2196792_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	4.4e-19
WP_000832485.1|2196836_2199209_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001304373.1|2199246_2200932_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	3.8e-10
>prophage 176
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2217718	2227600	5099311	tail	Enterobacteria_phage(60.0%)	13	NA	NA
WP_150330631.1|2217718_2219779_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	4.4e-125
WP_150330632.1|2219775_2220054_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000355360.1|2220066_2220360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968127.1|2220451_2221309_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101723.1|2221305_2222163_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|2222159_2222987_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	26.4	2.8e-06
WP_000555630.1|2222986_2223901_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001327170.1|2224179_2224464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304451.1|2224599_2225358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|2225829_2225982_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001445545.1|2226065_2226191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|2226243_2226648_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332310.1|2226868_2227600_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
>prophage 177
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2241835	2242255	5099311		Morganella_phage(100.0%)	1	NA	NA
WP_000897380.1|2241835_2242255_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	2.6e-37
>prophage 178
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2259550	2260309	5099311		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173308.1|2259550_2260309_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-14
>prophage 179
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2272756	2275508	5099311		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033350.1|2272756_2274436_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_001298109.1|2274560_2275508_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 180
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2278644	2284913	5099311		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|2278644_2279727_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456474.1|2279726_2280560_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200375.1|2280556_2280949_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257054.1|2280952_2281762_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|2281797_2282652_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|2282799_2282907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313768.1|2283312_2284413_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|2284682_2284913_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 181
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2296044	2371817	5099311	tail,head,portal,capsid,holin,integrase,terminase,lysis,transposase	Escherichia_phage(33.96%)	92	2292414:2292430	2345331:2345347
2292414:2292430	attL	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_000702647.1|2296044_2297583_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
WP_000571681.1|2297579_2298290_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|2298289_2298967_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001111620.1|2299019_2300219_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|2301011_2301854_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|2301903_2302362_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|2302474_2303380_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|2303471_2304485_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|2304686_2305595_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|2305738_2306152_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|2306755_2307373_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|2308830_2311506_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|2311982_2312630_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001297114.1|2313367_2314999_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|2315084_2316005_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|2316019_2316928_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|2316939_2317953_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|2317949_2318954_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|2319006_2319336_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|2319370_2320831_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|2320973_2321147_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|2321201_2322455_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|2322754_2323051_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|2323274_2323991_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|2324030_2324429_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|2324534_2325074_-	septation protein A	NA	NA	NA	NA	NA
WP_150330633.1|2325103_2325847_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|2326202_2326841_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|2326886_2328017_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2327994_2328243_-	excisionase	NA	NA	NA	NA	NA
WP_150330634.1|2328307_2330779_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|2330871_2331063_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2331059_2331248_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2331648_2331813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|2331813_2332035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2332194_2332350_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|2332642_2332981_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|2333372_2333615_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|2333598_2334024_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|2334095_2335166_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|2335206_2335629_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|2335820_2336783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|2336798_2337800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331714.1|2337911_2338202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2338208_2338316_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|2338360_2338573_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|2338740_2339019_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|2339020_2340067_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|2340079_2340454_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|2340450_2341272_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|2341496_2341694_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|2341844_2342894_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_000951233.1|2343406_2343628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331709.1|2344168_2344396_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|2344664_2344880_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|2344884_2345229_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|2345194_2345467_-	hypothetical protein	NA	NA	NA	NA	NA
2345331:2345347	attR	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_000992052.1|2345572_2346106_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001082537.1|2346404_2346869_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|2347176_2347587_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|2347644_2347878_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|2348263_2348812_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_021527900.1|2348783_2350712_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.5e-260
WP_000259002.1|2350695_2350902_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|2350898_2352491_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_150330635.1|2352480_2353986_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	3.0e-99
WP_000256823.1|2354022_2354370_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|2354427_2355456_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201495.1|2355507_2355891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|2355883_2356237_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|2356252_2356786_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|2356782_2357178_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2357185_2357938_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|2357951_2358383_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|2358409_2358823_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001596712.1|2358803_2361377_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.0	0.0e+00
WP_000847402.1|2361373_2361703_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|2361702_2362401_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|2362405_2363149_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|2363085_2363688_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_071526774.1|2363820_2364006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560231.1|2364654_2364876_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	79.5	8.1e-30
WP_000935606.1|2364921_2365770_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	56.4	5.7e-55
WP_072105065.1|2366034_2366295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202161.1|2366337_2366559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553098.1|2366548_2366923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379609.1|2366934_2367087_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_000936799.1|2367358_2367646_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000100899.1|2367645_2367837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329851.1|2367864_2368266_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.0	1.3e-12
WP_000887447.1|2368375_2368648_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	8.5e-13
WP_001233195.1|2371217_2371817_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
>prophage 182
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2377847	2379266	5099311		Bacillus_phage(100.0%)	1	NA	NA
WP_000558461.1|2377847_2379266_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	1.4e-18
>prophage 183
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2386008	2388138	5099311		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091198.1|2386008_2386392_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803537.1|2386423_2386642_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012592.1|2386698_2388138_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.8e-30
>prophage 184
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2395640	2396531	5099311		Bacillus_phage(100.0%)	1	NA	NA
WP_000592858.1|2395640_2396531_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 185
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2400918	2415343	5099311		Escherichia_phage(44.44%)	16	NA	NA
WP_000214712.1|2400918_2401122_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000526706.1|2401157_2402618_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	5.1e-43
WP_001350651.1|2402706_2402985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015952996.1|2402968_2403061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836075.1|2403118_2404138_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_001298659.1|2404149_2405364_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_001304355.1|2405569_2405896_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_000705201.1|2406030_2406372_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2406406_2406967_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001296084.1|2406969_2407680_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778146.1|2407787_2408093_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_021515042.1|2408291_2410718_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001468025.1|2410778_2413202_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_000213028.1|2413212_2413830_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526507.1|2413831_2414686_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148695.1|2414728_2415343_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
>prophage 186
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2433032	2434334	5099311		Bacillus_phage(100.0%)	1	NA	NA
WP_000732519.1|2433032_2434334_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 187
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2444229	2446041	5099311		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945903.1|2444229_2446041_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 188
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2466021	2467296	5099311	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001339629.1|2466021_2467296_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 189
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2474207	2475706	5099311		Salmonella_phage(50.0%)	2	NA	NA
WP_001350654.1|2474207_2474729_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250643.1|2474809_2475706_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
>prophage 190
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2480121	2488913	5099311		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101200.1|2480121_2480937_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	9.8e-20
WP_000007283.1|2481064_2481646_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701049.1|2481791_2482961_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2483126_2483216_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|2483514_2484540_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000269493.1|2484536_2485469_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182336.1|2485581_2486793_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|2487083_2488232_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|2488271_2488913_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 191
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2494418	2496685	5099311		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587583.1|2494418_2495231_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069965.1|2495234_2496020_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001362847.1|2496016_2496685_-	ferredoxin	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
>prophage 192
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2504974	2510058	5099311		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|2504974_2506195_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907963.1|2506191_2507463_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948883.1|2507437_2508184_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.1	5.1e-07
WP_001304330.1|2508193_2509681_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367158.1|2509689_2510058_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
>prophage 193
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2528476	2534981	5099311		Staphylococcus_phage(33.33%)	4	NA	NA
WP_000553669.1|2528476_2530177_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.8e-31
WP_000069409.1|2530233_2532612_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000368046.1|2532944_2533778_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|2533934_2534981_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
>prophage 194
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2539204	2549507	5099311	tRNA	Tupanvirus(33.33%)	12	NA	NA
WP_001209783.1|2539204_2539669_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
WP_000029464.1|2539746_2540496_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154199.1|2540495_2541047_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|2541108_2542089_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2542189_2542489_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672426.1|2542493_2544881_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2544895_2545879_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2546162_2546207_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2546329_2546686_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2546738_2546936_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2547032_2547575_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2547578_2549507_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 195
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2558883	2561145	5099311		Tupanvirus(100.0%)	1	NA	NA
WP_150330642.1|2558883_2561145_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.9e-143
>prophage 196
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2567270	2568098	5099311		Bacillus_virus(100.0%)	1	NA	NA
WP_000175056.1|2567270_2568098_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	3.5e-73
>prophage 197
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2575574	2576795	5099311		Klosneuvirus(100.0%)	1	NA	NA
WP_150330645.1|2575574_2576795_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.7e-26
>prophage 198
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2583558	2584212	5099311		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|2583558_2584212_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 199
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2588602	2590558	5099311		Streptococcus_phage(100.0%)	1	NA	NA
WP_001332112.1|2588602_2590558_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 200
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2595484	2599570	5099311		Tupanvirus(50.0%)	4	NA	NA
WP_001135068.1|2595484_2596126_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
WP_001313906.1|2596218_2597577_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|2597694_2598453_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723732.1|2598589_2599570_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	6.7e-07
>prophage 201
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2608385	2609240	5099311		Indivirus(100.0%)	1	NA	NA
WP_150330647.1|2608385_2609240_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 202
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2612558	2617135	5099311		Bacillus_phage(100.0%)	3	NA	NA
WP_000219684.1|2612558_2613842_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621390.1|2613988_2615464_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_021515048.1|2615644_2617135_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.0	4.1e-08
>prophage 203
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2626102	2634208	5099311	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2626102_2627788_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2627992_2628574_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220977.1|2628613_2629309_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128839.1|2629366_2631277_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.0e-91
WP_001351125.1|2631408_2631753_+	RidA family protein	NA	NA	NA	NA	NA
WP_001304301.1|2632114_2632474_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2632593_2632773_-	YoaH family protein	NA	NA	NA	NA	NA
WP_021515050.1|2632846_2634208_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.9	4.0e-42
>prophage 204
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2638070	2639627	5099311		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2638070_2639627_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 205
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2645267	2645477	5099311		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2645267_2645477_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 206
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2650810	2652859	5099311		Moraxella_phage(100.0%)	1	NA	NA
WP_001055805.1|2650810_2652859_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	4.0e-86
>prophage 207
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2660355	2664823	5099311		Escherichia_phage(33.33%)	7	NA	NA
WP_000812741.1|2660355_2661012_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.4e-56
WP_000984819.1|2661406_2661748_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879320.1|2661760_2662633_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2662636_2663011_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2663149_2663380_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|2663481_2664138_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2664160_2664823_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 208
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2672879	2674355	5099311		Cyanophage(100.0%)	1	NA	NA
WP_000301724.1|2672879_2674355_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
>prophage 209
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2678353	2685488	5099311		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|2678353_2679676_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|2679691_2680624_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2680702_2681458_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2681454_2682240_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2682456_2683467_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2683475_2684087_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|2684225_2684291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024939.1|2684362_2684965_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2684966_2685488_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 210
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2689381	2691432	5099311		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639256.1|2689381_2690200_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_001313931.1|2690252_2690648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2690688_2691432_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 211
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2698048	2699782	5099311	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025351.1|2698048_2699782_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	3.7e-85
>prophage 212
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2704309	2708578	5099311		Tupanvirus(33.33%)	4	NA	NA
WP_000763860.1|2704309_2704699_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
WP_000036385.1|2704713_2705763_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204321.1|2705765_2706626_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001350672.1|2706916_2708578_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.5	1.6e-08
>prophage 213
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2718665	2720180	5099311		Cedratvirus(100.0%)	1	NA	NA
WP_001187785.1|2718665_2720180_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.1e-12
>prophage 214
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2732162	2732915	5099311		Bacillus_virus(100.0%)	1	NA	NA
WP_001273001.1|2732162_2732915_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 215
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2745181	2747445	5099311		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000334564.1|2745181_2745850_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.2e-79
WP_001327799.1|2745846_2746035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000737290.1|2746362_2747445_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
>prophage 216
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2763774	2776199	5099311		Bacillus_phage(33.33%)	12	NA	NA
WP_001514281.1|2763774_2765469_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000922683.1|2765900_2766818_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2766990_2767911_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|2767899_2768370_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157275.1|2768350_2769769_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365553.1|2769835_2770531_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	7.3e-08
WP_001447259.1|2770570_2770936_-	permease	NA	NA	NA	NA	NA
WP_032140128.1|2771028_2771283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824356.1|2771501_2772617_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.2e-91
WP_000218046.1|2773211_2774063_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826721.1|2774169_2775528_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001353857.1|2775527_2776199_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.8e-32
>prophage 217
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2780470	2783649	5099311		Enterobacteria_phage(100.0%)	5	NA	NA
WP_000859544.1|2780470_2781043_-	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
WP_000734593.1|2781039_2781861_-	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000358619.1|2781857_2782571_-	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_000355702.1|2783070_2783361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204579.1|2783370_2783649_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	7.9e-22
>prophage 218
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2796904	2805385	5099311	transposase	Mycobacterium_phage(33.33%)	5	NA	NA
WP_000999383.1|2796904_2798137_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.7	2.9e-60
WP_001013662.1|2798272_2798917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350737.1|2799110_2800559_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_085949155.1|2800729_2801943_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	3.9e-166
WP_000792544.1|2803336_2805385_-	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
>prophage 219
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2813360	2815555	5099311		Yersinia_phage(33.33%)	4	NA	NA
WP_001175160.1|2813360_2814179_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	4.2e-47
WP_000213695.1|2814269_2814755_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	4.0e-13
WP_001186193.1|2814770_2815247_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692347.1|2815333_2815555_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
>prophage 220
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2823891	2827103	5099311	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856826.1|2823891_2825349_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_000003806.1|2825585_2827103_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 221
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2846666	2848169	5099311		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|2846666_2848169_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 222
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2853009	2853798	5099311		Pithovirus(100.0%)	1	NA	NA
WP_001193413.1|2853009_2853798_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.9e-12
>prophage 223
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2859402	2860952	5099311		Bacillus_virus(50.0%)	2	NA	NA
WP_001075531.1|2859402_2860161_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
WP_000611410.1|2860271_2860952_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 224
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2867067	2873438	5099311		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000235242.1|2867067_2868600_+	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	4.4e-13
WP_001314355.1|2869569_2870265_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001171671.1|2870248_2871178_+	allose kinase	NA	NA	NA	NA	NA
WP_001350810.1|2871452_2873438_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	4.9e-150
>prophage 225
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2878682	2880830	5099311		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|2878682_2880830_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 226
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2884747	2886275	5099311		Planktothrix_phage(100.0%)	2	NA	NA
WP_000132446.1|2884747_2885584_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
WP_000156933.1|2885570_2886275_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.3e-20
>prophage 227
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2895645	2897604	5099311		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078225.1|2895645_2897604_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	2.5e-90
>prophage 228
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2903810	2905160	5099311		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|2903810_2905160_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 229
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2908977	2912590	5099311		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2908977_2909514_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357763.1|2909767_2912590_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 230
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2922533	2923952	5099311		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_150330650.1|2922533_2923952_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	5.6e-39
>prophage 231
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2929351	2933474	5099311		Pectobacterium_phage(25.0%)	4	NA	NA
WP_150330651.1|2929351_2930350_-	AAA family ATPase	NA	A0A1L2CV87	Pectobacterium_phage	30.6	2.0e-27
WP_000122235.1|2930346_2930904_-	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.8	1.7e-15
WP_001147328.1|2930926_2932006_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_001296639.1|2932058_2933474_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
>prophage 232
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	2942338	3008609	5099311	tail,tRNA,head,capsid,portal,holin,protease,integrase,terminase	Escherichia_phage(35.56%)	58	2931733:2931748	2986651:2986666
2931733:2931748	attL	CAGAAATCGTCGGTAG	NA	NA	NA	NA
WP_001552194.1|2942338_2943376_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332258.1|2943464_2944562_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	8.1e-211
WP_001217539.1|2944623_2944872_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001204581.1|2945366_2945645_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_021515193.1|2945641_2947708_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	63.2	9.7e-149
WP_021515059.1|2947772_2948372_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_000515673.1|2948439_2952138_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	75.6	0.0e+00
WP_020246041.1|2952197_2952845_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	2.3e-109
WP_000140743.1|2952742_2953486_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_001152449.1|2953491_2954190_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.1	1.3e-129
WP_001330090.1|2954189_2954546_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_021514802.1|2954523_2957751_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	93.6	0.0e+00
WP_071590020.1|2957797_2958058_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001324129.1|2958099_2958486_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_150330652.1|2958485_2959190_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.0	5.3e-115
WP_001206306.1|2959250_2959595_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_032151443.1|2959591_2960041_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.9	3.9e-63
WP_001147814.1|2960037_2960376_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|2960384_2960702_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766108.1|2960778_2961996_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
WP_000999828.1|2962010_2962610_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923131.1|2962602_2963829_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	4.1e-203
WP_001140907.1|2963976_2965734_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001330091.1|2965733_2966216_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	2.5e-84
WP_001140099.1|2966363_2966714_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_024195539.1|2966818_2967004_-	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	76.3	3.9e-17
WP_021573343.1|2967220_2967754_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	1.1e-101
WP_150330653.1|2967809_2968124_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	3.1e-51
WP_000839572.1|2968128_2968344_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000342820.1|2969068_2969782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235237.1|2970027_2970849_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	8.5e-80
WP_001217427.1|2970845_2971220_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	3.4e-36
WP_001265292.1|2971232_2972282_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.9e-109
WP_024193993.1|2972283_2972562_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_047335230.1|2972729_2972942_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	5.6e-28
WP_000150294.1|2973122_2973788_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151152.1|2973962_2974388_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	5.4e-62
WP_001262355.1|2974428_2975499_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	1.6e-62
WP_000693867.1|2975570_2975996_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2975979_2976222_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001362937.1|2976613_2976952_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000379589.1|2977244_2977400_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171970.1|2977559_2977781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2977781_2977946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2978346_2978535_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090203.1|2978531_2978723_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048602.1|2978815_2981296_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	1.1e-58
WP_000096344.1|2981354_2981558_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_150330654.1|2981557_2982583_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001325918.1|2982818_2983616_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024174323.1|2983953_2985216_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	9.0e-73
WP_000703047.1|2985409_2986714_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
2986651:2986666	attR	CAGAAATCGTCGGTAG	NA	NA	NA	NA
WP_001286281.1|2986741_2988022_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_001327263.1|2988014_2989817_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_000098391.1|2989803_2991606_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
WP_000970688.1|2991772_2992732_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623030.1|2992922_2999030_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	3.1e-33
WP_000369530.1|2999117_3008609_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
>prophage 233
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3028076	3029348	5099311	integrase	Stenotrophomonas_phage(100.0%)	1	3024435:3024448	3043051:3043064
3024435:3024448	attL	GATATGGCGGTGAT	NA	NA	NA	NA
WP_000055670.1|3028076_3029348_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
WP_000055670.1|3028076_3029348_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
3043051:3043064	attR	ATCACCGCCATATC	NA	NA	NA	NA
>prophage 234
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3034906	3063125	5099311		Tupanvirus(80.0%)	7	NA	NA
WP_001327259.1|3034906_3039274_-	colibactin non-ribosomal peptide synthetase ClbN	NA	A0A2K9KZV5	Tupanvirus	22.8	4.3e-37
WP_000217768.1|3039270_3040710_-	precolibactin export MATE transporter ClbM	NA	NA	NA	NA	NA
WP_001297937.1|3040771_3042235_-	colibactin biosynthesis amidase ClbL	NA	NA	NA	NA	NA
WP_000222467.1|3042227_3048692_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbK	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-43
WP_001468003.1|3048702_3055203_-	colibactin non-ribosomal peptide synthetase ClbJ	NA	A0A2K9KZV5	Tupanvirus	23.4	2.5e-102
WP_000829570.1|3055246_3058279_-	colibactin polyketide synthase ClbI	NA	D0R7J2	Paenibacillus_phage	37.9	4.0e-50
WP_001304254.1|3058328_3063125_-	colibactin non-ribosomal peptide synthetase ClbH	NA	A0A2K9L3I8	Tupanvirus	28.7	3.0e-44
>prophage 235
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3069369	3078990	5099311		Tupanvirus(100.0%)	1	NA	NA
WP_001518711.1|3069369_3078990_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbB	NA	A0A2K9KZV5	Tupanvirus	23.8	5.0e-46
>prophage 236
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3089914	3091767	5099311		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502870.1|3089914_3090559_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001362826.1|3090543_3091767_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.5e-61
>prophage 237
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3101259	3102488	5099311	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_150330587.1|3101259_3102488_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	4.1e-171
>prophage 238
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3112587	3114389	5099311	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_011076463.1|3112587_3113370_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_150330659.1|3113366_3114389_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.3e-199
>prophage 239
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3117899	3118667	5099311		Bacillus_virus(100.0%)	1	NA	NA
WP_000016205.1|3117899_3118667_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 240
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3129799	3131979	5099311		Yersinia_phage(33.33%)	4	NA	NA
WP_001234569.1|3129799_3130621_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	4.7e-46
WP_000213703.1|3130711_3131197_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.3	9.9e-12
WP_001351157.1|3131212_3131689_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|3131757_3131979_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 241
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3136321	3137488	5099311		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001297905.1|3136321_3137488_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	2.2e-227
>prophage 242
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3143685	3144585	5099311		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|3143685_3144585_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 243
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3152026	3154846	5099311		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704905.1|3152026_3153193_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.9	6.5e-110
WP_000043455.1|3153439_3154846_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
>prophage 244
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3162306	3172947	5099311		Enterobacteria_phage(42.86%)	11	NA	NA
WP_001028393.1|3162306_3162864_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.3	8.1e-50
WP_000691392.1|3162884_3163934_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001513851.1|3163950_3165213_-	O2/O50 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001033086.1|3165212_3166319_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	5.9e-44
WP_001332228.1|3166311_3166779_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_032139969.1|3166765_3167176_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000857507.1|3167193_3168069_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
WP_001023648.1|3168127_3169027_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	8.2e-28
WP_000699453.1|3169026_3170112_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.6e-100
WP_000183029.1|3170484_3171378_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	1.3e-46
WP_001622203.1|3171552_3172947_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	2.2e-19
>prophage 245
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3178455	3185158	5099311		Bacillus_phage(25.0%)	6	NA	NA
WP_001296216.1|3178455_3179826_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079277.1|3179927_3181364_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.3	3.8e-51
WP_000699724.1|3181366_3182590_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|3182586_3183066_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|3183068_3184034_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|3184036_3185158_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 246
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3189475	3200374	5099311		Catovirus(33.33%)	10	NA	NA
WP_000654488.1|3189475_3190315_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_000137112.1|3190443_3192606_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482915.1|3192608_3193052_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|3193057_3194197_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454701.1|3194855_3196439_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001227699.1|3196513_3196852_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000687871.1|3196841_3197132_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_150330663.1|3197184_3199038_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|3199059_3199641_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|3199732_3200374_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 247
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3205101	3206454	5099311		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469710.1|3205101_3206454_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 248
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3219561	3221684	5099311		Bacillus_phage(100.0%)	2	NA	NA
WP_000675178.1|3219561_3220965_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|3220961_3221684_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
>prophage 249
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3227523	3231017	5099311	tRNA	Phage_TP(50.0%)	3	NA	NA
WP_000476019.1|3227523_3228885_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_001350699.1|3229384_3229702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807360.1|3230117_3231017_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 250
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3240158	3243715	5099311		Serratia_phage(50.0%)	4	NA	NA
WP_000846205.1|3240158_3241163_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	2.2e-13
WP_000011933.1|3241159_3242125_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434049.1|3242098_3242845_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297940.1|3242896_3243715_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
>prophage 251
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3254364	3256398	5099311	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350700.1|3254364_3256398_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 252
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3268489	3277934	5099311		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|3268489_3269626_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|3269622_3271626_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|3271750_3272212_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|3272252_3272723_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001419932.1|3272769_3273489_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3273485_3275171_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|3275392_3276124_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|3276183_3276291_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|3276271_3277003_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|3277007_3277934_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 253
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3298284	3299805	5099311		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|3298284_3299805_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 254
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3303499	3307285	5099311		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|3303499_3304168_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425456.1|3304425_3305262_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489277.1|3305293_3307285_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 255
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3311353	3312211	5099311		Catovirus(100.0%)	1	NA	NA
WP_021515080.1|3311353_3312211_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	4.0e-24
>prophage 256
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3325598	3329899	5099311		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001332203.1|3325598_3327065_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
WP_000198797.1|3327182_3328169_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|3328207_3328921_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|3329332_3329899_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 257
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3335654	3343304	5099311		Vibrio_phage(50.0%)	7	NA	NA
WP_000194888.1|3335654_3337244_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|3337247_3337592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150330666.1|3337925_3339116_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	8.4e-20
WP_001234850.1|3339143_3339839_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578103.1|3339988_3341749_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	9.9e-102
WP_000494186.1|3341873_3342158_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|3342296_3343304_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 258
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3353207	3353825	5099311		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|3353207_3353825_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 259
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3362593	3368359	5099311		Bacillus_phage(25.0%)	5	NA	NA
WP_000422239.1|3362593_3364237_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.6	1.6e-13
WP_000884927.1|3364312_3364963_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000872522.1|3364962_3366027_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.2	3.1e-18
WP_000406059.1|3366100_3367156_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865556.1|3367267_3368359_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.3	2.7e-118
>prophage 260
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3372636	3377479	5099311		Hokovirus(50.0%)	2	NA	NA
WP_000876050.1|3372636_3375486_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	3.2e-41
WP_001296244.1|3375652_3377479_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 261
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3392402	3406278	5099311		Pseudomonas_phage(33.33%)	8	NA	NA
WP_059323803.1|3392402_3395030_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	3.2e-88
WP_000990768.1|3395176_3395899_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001351169.1|3396038_3399797_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	28.2	3.3e-22
WP_001075170.1|3400478_3402764_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|3402910_3404041_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|3404040_3404295_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301034.1|3404348_3404999_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|3405201_3406278_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 262
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3412170	3416741	5099311	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140576.1|3412170_3413130_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.6e-69
WP_000150339.1|3413142_3413328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992976.1|3413368_3414172_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001297939.1|3414189_3415479_-	MFS transporter	NA	NA	NA	NA	NA
WP_001350710.1|3415535_3416741_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 263
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3420344	3425348	5099311		Tupanvirus(50.0%)	4	NA	NA
WP_000879110.1|3420344_3420947_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_011076488.1|3421254_3422394_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	7.2e-29
WP_000461633.1|3422397_3423366_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_042094848.1|3423365_3425348_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 264
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3460309	3460909	5099311		Salmonella_phage(100.0%)	1	NA	NA
WP_000813854.1|3460309_3460909_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 265
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3474095	3475955	5099311		Sodalis_phage(50.0%)	2	NA	NA
WP_000156130.1|3474095_3474986_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	4.0e-67
WP_001293612.1|3475181_3475955_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 266
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3480166	3481684	5099311		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|3480166_3481684_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 267
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3486542	3556756	5099311	tRNA,head,portal,holin,integrase,terminase,lysis	Enterobacteria_phage(77.19%)	85	3503500:3503516	3548875:3548891
WP_001283598.1|3486542_3487355_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|3487354_3488368_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_150330670.1|3488433_3489570_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|3489668_3490664_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|3490660_3491839_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|3492103_3493324_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_021515090.1|3493482_3495489_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|3495609_3495888_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|3495921_3496470_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|3496469_3497279_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|3497278_3498103_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|3498106_3499192_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|3499226_3500159_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3500324_3500876_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|3501195_3502038_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|3502039_3502567_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|3502563_3503043_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|3503039_3503543_-	fimbrial protein	NA	NA	NA	NA	NA
3503500:3503516	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_000120670.1|3503559_3504312_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001195816.1|3508167_3508653_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|3508855_3511000_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|3510999_3512310_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|3512490_3512775_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|3513146_3514487_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|3514544_3515300_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|3515593_3516526_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958671.1|3516837_3517995_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_029130956.1|3518234_3518990_-	acyltransferase	NA	C7U0V2	Enterobacteria_phage	99.1	3.0e-79
WP_000129909.1|3519143_3522089_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	100.0	0.0e+00
WP_021515093.1|3522189_3523092_-	antirepressor protein ant	NA	Q0H8C7	Salmonella_phage	98.3	3.3e-170
WP_000410001.1|3523324_3523477_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051911.1|3523591_3523840_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903306.1|3523839_3524376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198454.1|3524424_3524874_-	hypothetical protein	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000064337.1|3524882_3525449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011703616.1|3525645_3525975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868966.1|3525992_3528005_-	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.7	2.9e-97
WP_000257015.1|3528004_3529456_-	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
WP_000964905.1|3529466_3530159_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
WP_000627629.1|3530161_3530617_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|3530616_3531318_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|3531317_3532736_-	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|3532745_3533207_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001362792.1|3533187_3533376_-	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_001558143.1|3533417_3534671_-	hypothetical protein	NA	A5VW72	Enterobacteria_phage	99.8	7.5e-237
WP_021515096.1|3534689_3535583_-	phage scaffold protein	NA	A5VW73	Enterobacteria_phage	99.7	1.4e-133
WP_000818371.1|3535673_3537872_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000200779.1|3537873_3539289_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113731.1|3539285_3539726_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|3539728_3539971_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|3540198_3540741_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|3540946_3541099_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001350934.1|3541086_3541524_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_000229389.1|3541520_3541997_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|3541980_3542304_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027549.1|3542900_3543419_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000994516.1|3543415_3543604_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|3543600_3543963_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|3543959_3544250_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|3544249_3544972_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950973.1|3544964_3545141_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000177653.1|3545133_3545559_-	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_001254264.1|3545555_3545732_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000814617.1|3545728_3546139_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_000091236.1|3546150_3546336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000229808.1|3546768_3546975_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_150330671.1|3547047_3548424_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.3e-253
WP_150330672.1|3548420_3549368_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.7	3.7e-156
3548875:3548891	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
WP_001244621.1|3549370_3549643_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|3549665_3549959_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|3550067_3550253_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|3550333_3550984_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219332.1|3551505_3551805_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
WP_000167596.1|3551813_3552284_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_014532157.1|3552373_3552649_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_000031365.1|3552905_3553511_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|3553510_3553894_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|3553917_3554214_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|3554308_3554827_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|3554823_3555123_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|3555124_3555697_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000253289.1|3555696_3555981_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000002106.1|3555973_3556258_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|3556330_3556498_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|3556555_3556756_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 268
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3564623	3572200	5099311		Bacillus_phage(50.0%)	4	NA	NA
WP_001331804.1|3564623_3568217_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001331805.1|3568272_3569418_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3569491_3570436_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283509.1|3570505_3572200_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 269
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3575893	3576814	5099311		Morganella_phage(100.0%)	1	NA	NA
WP_000484022.1|3575893_3576814_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 270
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3580632	3581370	5099311		Clostridioides_phage(100.0%)	1	NA	NA
WP_001314031.1|3580632_3581370_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	6.1e-13
>prophage 271
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3614627	3636355	5099311		Streptococcus_phage(25.0%)	23	NA	NA
WP_000443708.1|3614627_3616643_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	2.9e-150
WP_001317975.1|3616713_3617712_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_150330674.1|3617941_3618703_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3618887_3619859_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3620242_3620500_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623142.1|3620544_3622272_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|3622312_3622822_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096640.1|3622864_3623716_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000724596.1|3623820_3624189_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105467.1|3624191_3625103_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000021034.1|3625237_3626335_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|3626324_3627200_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|3627199_3628033_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290262.1|3628032_3629049_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517443.1|3629206_3629998_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_077779535.1|3630138_3630369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001175632.1|3630277_3631174_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040463.1|3631177_3632602_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000084590.1|3632779_3633679_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838948.1|3633774_3634350_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001331810.1|3634410_3634860_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|3634846_3635272_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102910.1|3635485_3636355_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 272
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3655009	3655960	5099311		Cyanophage(100.0%)	1	NA	NA
WP_150330675.1|3655009_3655960_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 273
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3673201	3673915	5099311		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3673201_3673915_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 274
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3681394	3685395	5099311		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|3681394_3682684_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|3682769_3683396_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001350863.1|3683719_3684757_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.6	2.8e-72
WP_001028626.1|3684756_3685395_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 275
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3691830	3738062	5099311	tail,terminase,integrase,holin	Escherichia_phage(42.86%)	54	3713097:3713114	3743455:3743472
WP_001344399.1|3691830_3692004_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669398.1|3692317_3692833_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|3692848_3693388_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_150330676.1|3693606_3694089_-	DUF2514 family protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	91.9	1.5e-73
WP_000403803.1|3694085_3694715_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	6.8e-114
WP_000256103.1|3694704_3695013_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
WP_001276090.1|3694999_3695404_-	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_150330677.1|3695711_3698831_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	95.9	0.0e+00
WP_001188252.1|3699026_3699284_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_000932553.1|3699308_3699815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001164248.1|3699804_3700224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127505.1|3700669_3701365_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	100.0	5.4e-128
WP_000856391.1|3701505_3702138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|3702236_3702398_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_000723561.1|3702427_3703279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123343.1|3703280_3706670_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.9	1.4e-184
WP_001145645.1|3706669_3709417_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.5	6.9e-118
WP_000336178.1|3709416_3709995_-	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	79.8	7.1e-57
WP_150330678.1|3709994_3710459_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.7	1.4e-84
WP_001018550.1|3710458_3712930_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_000179261.1|3712929_3713535_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	100.0	2.1e-112
3713097:3713114	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_000424491.1|3713534_3713858_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	100.0	2.4e-54
WP_000012377.1|3713908_3714244_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_021515108.1|3714254_3714692_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	99.3	4.8e-74
WP_000268715.1|3714743_3715730_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_150330679.1|3715744_3716440_-	peptidase	NA	G9L6C4	Escherichia_phage	99.6	1.8e-94
WP_000133160.1|3716442_3716739_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_150330680.1|3716735_3718415_-|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	98.6	9.8e-301
WP_000335899.1|3718429_3718636_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_021515110.1|3719343_3719715_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	98.4	7.2e-63
WP_021515111.1|3719805_3721281_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	6.4e-296
WP_001090120.1|3721277_3721952_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_001124396.1|3721948_3722161_-	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_021525783.1|3722178_3722517_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	91.1	3.6e-53
WP_150330681.1|3722631_3723210_-	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	73.7	1.1e-73
WP_113402812.1|3723206_3723416_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	97.1	9.7e-33
WP_150330682.1|3723427_3723958_-	eae-like domain protein	NA	G9L6B1	Escherichia_phage	47.0	3.6e-23
WP_001231258.1|3724019_3724367_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	2.0e-59
WP_001406039.1|3724484_3725270_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_021515115.1|3725266_3726082_-	hypothetical protein	NA	Q286X4	Escherichia_phage	96.4	1.2e-118
WP_000402893.1|3726097_3726298_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_001282459.1|3726448_3726679_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|3726833_3727418_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001102251.1|3727726_3728026_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	4.9e-46
WP_000985082.1|3728022_3728922_+	endonuclease	NA	Q858E0	Salmonella_phage	90.6	1.6e-156
WP_000026205.1|3728931_3729954_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	92.9	7.1e-177
WP_000675390.1|3730003_3730252_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|3730409_3730661_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000163461.1|3730653_3731304_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	97.2	2.6e-124
WP_001055437.1|3731300_3731960_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	5.7e-103
WP_000954561.1|3731962_3733219_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	2.2e-236
WP_000138282.1|3733411_3734989_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|3735057_3736524_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937882.1|3736685_3738062_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	9.0e-42
3743455:3743472	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
>prophage 276
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3758541	3758973	5099311		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|3758541_3758973_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 277
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3768858	3775196	5099311		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133562.1|3768858_3770142_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|3770200_3770401_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|3770412_3770748_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_021515119.1|3770749_3772600_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	9.4e-103
WP_000384413.1|3772616_3773132_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3773227_3773551_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3773567_3773954_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3773981_3775196_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 278
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3792583	3803892	5099311		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|3792583_3793837_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883117.1|3794165_3795356_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3795400_3795739_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001305238.1|3795799_3797134_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.2	1.4e-10
WP_001215879.1|3797123_3797837_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001350885.1|3798001_3799429_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_150330684.1|3800004_3803892_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.1e-129
>prophage 279
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3808012	3808273	5099311		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|3808012_3808273_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 280
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3811732	3815469	5099311		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3811732_3812413_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|3812679_3813654_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|3813669_3815469_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 281
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3820371	3912365	5099311	tail,tRNA,portal,holin,protease,terminase,lysis,transposase	Enterobacteria_phage(44.26%)	100	NA	NA
WP_000083664.1|3820371_3821109_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3821240_3822575_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|3822607_3823489_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|3823591_3824179_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|3824234_3824618_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|3824921_3825611_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|3825658_3826696_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3826902_3827322_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|3827390_3828089_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|3828120_3830781_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3830894_3832250_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|3832295_3832619_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|3832615_3833914_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001331828.1|3834022_3834283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024186649.1|3835214_3835442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350770.1|3842396_3844970_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|3845099_3845831_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|3845827_3846808_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3846942_3847680_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000547191.1|3847800_3849129_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000178456.1|3849388_3849730_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3849833_3849881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|3849979_3851140_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|3851182_3852304_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|3852314_3853385_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|3853594_3853960_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|3854108_3854627_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|3854616_3855843_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|3855858_3856341_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3856417_3856765_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3856806_3857574_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3857604_3858153_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3858171_3858420_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3858556_3859918_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3860084_3860876_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3860896_3862183_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|3862237_3862831_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|3862953_3863832_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|3863917_3865579_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3865727_3866069_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|3866130_3866421_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|3866410_3866887_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3867018_3867501_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_072097749.1|3868306_3869521_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	1.0e-33
WP_001288444.1|3869555_3870989_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_071779325.1|3871612_3871735_+	ferredoxin	NA	NA	NA	NA	NA
WP_001011831.1|3872070_3872850_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000355360.1|3873051_3873345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104976644.1|3873357_3873636_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	4.5e-25
WP_150330685.1|3873632_3875696_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.1	2.0e-125
WP_001596836.1|3875760_3876360_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	1.1e-105
WP_150330686.1|3876427_3880126_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	75.0	0.0e+00
WP_001445893.1|3880186_3880834_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
WP_032151176.1|3880731_3881475_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.0e-148
WP_104976646.1|3881479_3882178_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	96.1	4.4e-130
WP_000447253.1|3882187_3882517_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_150330687.1|3882516_3885582_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.5	0.0e+00
WP_001161009.1|3885553_3885883_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3885891_3886278_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_053290591.1|3886338_3887082_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	1.7e-132
WP_001079400.1|3887092_3887494_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	1.1e-72
WP_000677106.1|3887490_3888069_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|3888080_3888356_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3888348_3888672_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_077827153.1|3888758_3890786_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.1	0.0e+00
WP_000985939.1|3890730_3892239_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	1.0e-288
WP_001072975.1|3892238_3892451_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507030.1|3892447_3894547_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	0.0e+00
WP_000421825.1|3894555_3895095_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_032144328.1|3895250_3895451_-	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	90.9	3.9e-31
WP_001139681.1|3895767_3895920_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_001300226.1|3895907_3896375_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
WP_150330688.1|3896371_3896905_-	glycoside hydrolase family protein	NA	K7PLY1	Enterobacteria_phage	97.7	1.6e-100
WP_150330653.1|3896960_3897275_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	3.1e-51
WP_000839572.1|3897279_3897495_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000217632.1|3898316_3898742_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_071595351.1|3898665_3898893_-	hypothetical protein	NA	A0A291AX11	Escherichia_phage	97.3	3.8e-14
WP_001047112.1|3899022_3899775_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
WP_001360050.1|3899788_3900778_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061445.1|3900785_3901595_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_000767105.1|3901614_3902004_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210170.1|3902000_3902327_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000066917.1|3902323_3902977_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_077772149.1|3902976_3903459_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	95.1	1.2e-81
WP_123006721.1|3903455_3903824_-	hypothetical protein	NA	U5P0A0	Shigella_phage	96.7	2.8e-67
WP_001250270.1|3904404_3904617_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_021038219.1|3904792_3905350_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	96.8	3.3e-96
WP_001191669.1|3905342_3905603_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_071784359.1|3905604_3905727_-	amino acid permease	NA	NA	NA	NA	NA
WP_001020632.1|3905700_3906393_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_032153466.1|3906448_3906727_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	92.3	1.5e-12
WP_085447418.1|3907115_3907478_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	5.6e-60
WP_000081287.1|3907543_3908368_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008210.1|3908495_3909032_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242962.1|3909022_3909385_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.6e-65
WP_001331173.1|3909381_3909597_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|3909656_3909863_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531797.1|3909823_3910999_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	2.7e-148
WP_001293201.1|3911294_3911543_+	hypothetical protein	NA	I6PCV4	Cronobacter_phage	80.5	3.3e-27
WP_000457798.1|3911546_3912365_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	79.2	1.3e-117
>prophage 282
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3916902	3920954	5099311		Klosneuvirus(50.0%)	4	NA	NA
WP_001332373.1|3916902_3918183_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.2e-32
WP_001298180.1|3918420_3919821_+	GABA permease	NA	NA	NA	NA	NA
WP_000156818.1|3919841_3920504_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|3920504_3920954_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 283
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3926760	3932057	5099311		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|3926760_3927006_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080951.1|3927002_3927413_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.1e-18
WP_150330689.1|3927385_3929530_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.7	3.8e-196
WP_000777929.1|3929539_3930499_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000985490.1|3930854_3932057_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 284
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3946939	3952325	5099311	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3946939_3947125_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047209.1|3947359_3949990_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000140506.1|3950117_3950618_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3950686_3951748_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132237.1|3951827_3952325_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	3.4e-31
>prophage 285
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3957793	3958759	5099311		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|3957793_3958759_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 286
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3966330	3967344	5099311		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001363010.1|3966330_3967344_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	5.1e-26
>prophage 287
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3986228	3993368	5099311		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|3986228_3988790_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|3988895_3989552_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|3989602_3990370_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|3990565_3991474_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|3991470_3992733_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_150330693.1|3992729_3993368_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 288
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	3997741	4001457	5099311		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|3997741_3998734_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3998796_3999936_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254701.1|4000075_4000702_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|4000695_4001457_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 289
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4004568	4006601	5099311		Tupanvirus(50.0%)	2	NA	NA
WP_001173653.1|4004568_4005174_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090357.1|4005173_4006601_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.3e-30
>prophage 290
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4021250	4022036	5099311		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021344.1|4021250_4022036_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
>prophage 291
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4025609	4026281	5099311		Vibrio_phage(100.0%)	1	NA	NA
WP_001199974.1|4025609_4026281_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
>prophage 292
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4030090	4033114	5099311		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|4030090_4031389_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|4031476_4033114_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 293
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4037147	4041262	5099311		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046816.1|4037147_4038449_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	1.1e-38
WP_000186431.1|4038505_4041262_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
>prophage 294
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4048794	4049643	5099311		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|4048794_4049643_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 295
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4054501	4055257	5099311		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|4054501_4055257_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 296
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4066833	4069339	5099311	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001331603.1|4066833_4068039_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.5	3.2e-75
WP_000184272.1|4068038_4068482_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|4068532_4069339_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
>prophage 297
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4078393	4081039	5099311		Cronobacter_phage(100.0%)	1	NA	NA
WP_000147358.1|4078393_4081039_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	1.9e-96
>prophage 298
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4086853	4087114	5099311		Burkholderia_virus(100.0%)	1	NA	NA
WP_001117814.1|4086853_4087114_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	37.2	5.7e-06
>prophage 299
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4101929	4118544	5099311		Paramecium_bursaria_Chlorella_virus(14.29%)	10	NA	NA
WP_001331592.1|4101929_4102877_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
WP_001066237.1|4102948_4103545_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_000382413.1|4103547_4104723_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810553.1|4104722_4106303_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	4.5e-05
WP_001314100.1|4106334_4107159_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|4107416_4108670_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|4108901_4110233_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775938.1|4110294_4112121_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.0e-24
WP_001331589.1|4112120_4115663_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138098.1|4115655_4118544_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	9.0e-68
>prophage 300
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4124021	4130794	5099311		Geobacillus_virus(33.33%)	7	NA	NA
WP_000816232.1|4124021_4124816_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|4124822_4125698_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|4125848_4128095_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|4128107_4128638_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_031935696.1|4128949_4129144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082183.1|4129322_4130012_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|4130080_4130794_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 301
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4140425	4142920	5099311		Aichi_virus(50.0%)	2	NA	NA
WP_000256426.1|4140425_4141844_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|4142158_4142920_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 302
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4147206	4147962	5099311		Clostridium_phage(100.0%)	1	NA	NA
WP_021515135.1|4147206_4147962_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 303
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4172241	4187633	5099311	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|4172241_4173642_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001296347.1|4173659_4174976_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012167.1|4175011_4176379_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_000838415.1|4176414_4176903_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001363023.1|4176902_4178822_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001363024.1|4179257_4180706_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.0	4.3e-26
WP_001050745.1|4180707_4180833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|4180829_4180901_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192798.1|4180955_4181504_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|4181546_4183064_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|4183073_4184172_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813190.1|4184262_4185996_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_000715230.1|4186001_4186712_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806987.1|4186736_4187633_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 304
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4191438	4195911	5099311		Pandoravirus(50.0%)	2	NA	NA
WP_001350137.1|4191438_4192872_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	1.5e-31
WP_150330701.1|4193037_4195911_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.9	5.3e-262
>prophage 305
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4204047	4205280	5099311		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4204047_4205280_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 306
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4218775	4219453	5099311		Bacillus_virus(100.0%)	1	NA	NA
WP_000956879.1|4218775_4219453_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	6.4e-09
>prophage 307
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4224505	4225414	5099311		Yersinia_phage(100.0%)	1	NA	NA
WP_000646942.1|4224505_4225414_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 308
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4233568	4234723	5099311		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|4233568_4234723_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 309
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4257418	4258681	5099311	integrase	Pseudomonas_phage(100.0%)	1	4248435:4248448	4259882:4259895
4248435:4248448	attL	TTTGCTGGCCCCAG	NA	NA	NA	NA
WP_001218820.1|4257418_4258681_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
WP_001218820.1|4257418_4258681_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
4259882:4259895	attR	TTTGCTGGCCCCAG	NA	NA	NA	NA
>prophage 310
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4275207	4277383	5099311		Yersinia_phage(33.33%)	4	NA	NA
WP_001175142.1|4275207_4276026_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.8e-45
WP_000860054.1|4276116_4276602_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.2	3.8e-11
WP_001186756.1|4276616_4277093_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692312.1|4277161_4277383_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 311
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4282869	4283853	5099311		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001331698.1|4282869_4283853_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 312
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4297434	4298094	5099311		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000590258.1|4297434_4298094_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
>prophage 313
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4330773	4331946	5099311		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524959.1|4330773_4331946_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 314
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4354169	4355054	5099311		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|4354169_4355054_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 315
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4360897	4368216	5099311		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013152.1|4360897_4361725_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691616.1|4361924_4362851_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848521.1|4362901_4363159_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095186.1|4363200_4365420_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438655.1|4365671_4366421_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001331680.1|4366743_4368216_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	1.7e-46
>prophage 316
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4375674	4380714	5099311		Bacillus_virus(50.0%)	4	NA	NA
WP_001281888.1|4375674_4377933_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
WP_001350728.1|4378070_4379678_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183493.1|4379786_4380269_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|4380321_4380714_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 317
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4388556	4401002	5099311		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000986428.1|4388556_4389540_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_000940869.1|4389536_4390346_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	2.7e-14
WP_001240663.1|4390719_4392861_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195274.1|4392924_4394817_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_000105733.1|4394845_4395427_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444744.1|4395426_4396254_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|4396278_4396701_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|4396701_4397331_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|4397535_4399017_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|4399164_4399836_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442855.1|4399841_4401002_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	9.1e-88
>prophage 318
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4412235	4412889	5099311		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|4412235_4412889_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 319
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4416802	4418236	5099311		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|4416802_4418236_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 320
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4423373	4424612	5099311	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708479.1|4423373_4424612_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 321
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4431020	4436379	5099311	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_001264377.1|4431020_4432034_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
WP_001144069.1|4432271_4432487_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918851.1|4432597_4434343_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	8.4e-77
WP_000437380.1|4434537_4436379_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
>prophage 322
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4440474	4448644	5099311	tRNA	Salmonella_phage(33.33%)	5	NA	NA
WP_000094730.1|4440474_4441995_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000631993.1|4442301_4443792_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450588.1|4443833_4444166_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212450.1|4444384_4445368_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082822.1|4445551_4448644_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	8.5e-157
>prophage 323
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4460305	4461271	5099311		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|4460305_4461271_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 324
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4481149	4483444	5099311		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861709.1|4481149_4483444_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 325
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4489592	4490738	5099311		Streptococcus_phage(100.0%)	1	NA	NA
WP_001298324.1|4489592_4490738_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	2.8e-49
>prophage 326
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4507421	4515216	5099311		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|4507421_4508285_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249171.1|4508348_4510385_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246833.1|4510342_4510738_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|4510757_4511348_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|4511357_4511933_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147637.1|4512045_4513086_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|4513158_4513794_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001350722.1|4513921_4514440_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	1.7e-09
WP_000449450.1|4514419_4514863_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189322.1|4514913_4515216_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 327
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4520918	4522808	5099311		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|4520918_4522808_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 328
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4528289	4534928	5099311		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|4528289_4530962_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|4530986_4532474_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|4532501_4532954_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207671.1|4533584_4534928_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 329
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4539005	4541878	5099311	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764750.1|4539005_4539854_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	2.6e-23
WP_001107467.1|4539943_4541878_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 330
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4548507	4549990	5099311		Indivirus(50.0%)	2	NA	NA
WP_001047338.1|4548507_4549479_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445401.1|4549711_4549990_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	2.2e-16
>prophage 331
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4554058	4568853	5099311		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|4554058_4554868_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922880.1|4555077_4556055_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|4556068_4557055_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|4557075_4557642_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|4557638_4558214_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4558182_4558740_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4558746_4559472_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|4559519_4560953_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4560975_4561263_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|4561380_4561872_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4561917_4562772_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4562768_4563041_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620407.1|4563254_4563887_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047069.1|4563883_4564612_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719794.1|4564608_4565262_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809780.1|4565491_4567828_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001296449.1|4567923_4568853_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 332
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4577556	4581567	5099311	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108476.1|4577556_4579047_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|4579155_4580049_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074795.1|4580170_4580962_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|4581069_4581567_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 333
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4585534	4588059	5099311	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001298588.1|4585534_4586902_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
WP_021515164.1|4586991_4588059_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 334
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4604553	4605597	5099311		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4604553_4605597_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 335
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4614884	4619396	5099311		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000132905.1|4614884_4616384_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.7	5.2e-11
WP_001331656.1|4616444_4617335_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275539.1|4617370_4618225_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|4618565_4619396_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 336
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4624735	4625620	5099311		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258951.1|4624735_4625620_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 337
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4632124	4636278	5099311		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738577.1|4632124_4633150_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_001350717.1|4633217_4634399_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001351032.1|4634408_4635512_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078319.1|4635519_4636278_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-19
>prophage 338
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4646615	4648087	5099311	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4646615_4647125_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|4647139_4648087_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 339
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4669311	4671264	5099311		Vibrio_phage(100.0%)	1	NA	NA
WP_001514015.1|4669311_4671264_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 340
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4680112	4688679	5099311		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773166.1|4680112_4682815_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	1.5e-40
WP_000031783.1|4683106_4684291_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|4684361_4686476_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|4686572_4687043_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4687139_4687514_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903381.1|4687639_4687927_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820734.1|4687933_4688293_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	3.1e-10
WP_001209702.1|4688292_4688679_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	4.3e-18
>prophage 341
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4694249	4703790	5099311		Tupanvirus(25.0%)	9	NA	NA
WP_000634747.1|4694249_4696163_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.1	4.7e-73
WP_000057415.1|4696162_4697185_+	hydrolase	NA	NA	NA	NA	NA
WP_000907086.1|4697178_4697397_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	4.0e-05
WP_001274684.1|4697450_4698320_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4698374_4698779_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4699080_4699713_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001304921.1|4699763_4701854_+	membrane protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000963803.1|4701920_4703141_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|4703226_4703790_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 342
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4722700	4723537	5099311		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|4722700_4723537_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 343
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4740440	4744207	5099311		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|4740440_4742063_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253708.1|4742138_4743491_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|4743487_4744207_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 344
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4750783	4751677	5099311		Sodalis_phage(100.0%)	1	NA	NA
WP_000039083.1|4750783_4751677_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 345
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4757837	4760231	5099311		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081889.1|4757837_4760231_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 346
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4764621	4765848	5099311		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105471.1|4764621_4765848_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 347
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4781251	4783699	5099311		Dickeya_phage(100.0%)	1	NA	NA
WP_000993444.1|4781251_4783699_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 348
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4803569	4805380	5099311		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073603.1|4803569_4804313_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
WP_000907827.1|4804309_4805380_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 349
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4808921	4810404	5099311		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|4808921_4809635_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|4809636_4810404_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 350
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4819295	4824022	5099311		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_001332164.1|4819295_4820216_+	phosphoglycerate dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	30.7	3.3e-24
WP_000661262.1|4820215_4821100_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000130217.1|4821203_4822058_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4822302_4823361_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4823353_4824022_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 351
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4827028	4831327	5099311		Dickeya_phage(50.0%)	4	NA	NA
WP_000964729.1|4827028_4827655_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.1	2.7e-30
WP_000106588.1|4827728_4829927_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.6	1.0e-119
WP_000130621.1|4830195_4830441_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|4830661_4831327_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 352
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4839220	4840027	5099311		Bacillus_virus(100.0%)	1	NA	NA
WP_000173679.1|4839220_4840027_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 353
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4847466	4850202	5099311		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149183.1|4847466_4850202_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 354
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4859888	4861931	5099311		Indivirus(100.0%)	1	NA	NA
WP_001312164.1|4859888_4861931_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
>prophage 355
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4865070	4865496	5099311		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_021515176.1|4865070_4865496_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.1e-50
>prophage 356
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4876167	4877637	5099311		Pithovirus(50.0%)	2	NA	NA
WP_001332154.1|4876167_4876938_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	1.7e-18
WP_000123131.1|4876989_4877637_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 357
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4924883	4926868	5099311		Bacillus_virus(50.0%)	2	NA	NA
WP_000103579.1|4924883_4925888_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196477.1|4925884_4926868_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 358
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4936753	4939087	5099311		Escherichia_phage(100.0%)	1	NA	NA
WP_150330713.1|4936753_4939087_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.8e-72
>prophage 359
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4942741	4942954	5099311		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4942741_4942954_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 360
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4947175	4948171	5099311		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182635.1|4947175_4948171_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 361
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4953489	4955031	5099311		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146512.1|4953489_4955031_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 362
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	4974605	4979217	5099311		Clostridioides_phage(50.0%)	3	NA	NA
WP_000985743.1|4974605_4975901_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	3.7e-21
WP_000741500.1|4976030_4977182_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000582432.1|4977372_4979217_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 363
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5001343	5010849	5099311		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|5001343_5001595_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|5001735_5002167_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|5002411_5003956_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214150.1|5003965_5005249_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483824.1|5005252_5006212_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982107.1|5006198_5007233_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000646018.1|5007471_5008497_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213847.1|5008506_5009703_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
WP_000587750.1|5009916_5010849_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 364
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5014257	5016351	5099311		Catovirus(50.0%)	2	NA	NA
WP_000064025.1|5014257_5015241_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
WP_000364803.1|5015322_5016351_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
>prophage 365
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5023789	5028352	5099311		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|5023789_5024269_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|5024307_5025117_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|5025214_5025382_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|5025402_5025639_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|5025855_5026524_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_150330714.1|5026695_5027916_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	4.2e-43
WP_001351218.1|5027896_5028352_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.6e-48
>prophage 366
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5031726	5038477	5099311		Morganella_phage(25.0%)	6	NA	NA
WP_001297973.1|5031726_5032551_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
WP_000924289.1|5032842_5033460_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001363072.1|5033456_5035139_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.4	6.7e-23
WP_001295237.1|5035396_5036020_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|5036074_5036350_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|5036368_5038477_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 367
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5042778	5044170	5099311		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|5042778_5044170_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 368
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5057431	5058469	5099311		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|5057431_5058469_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 369
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5063910	5065245	5099311		Moraxella_phage(100.0%)	1	NA	NA
WP_001363077.1|5063910_5065245_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 370
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5072549	5084426	5099311		Micromonas_sp._RCC1109_virus(20.0%)	11	NA	NA
WP_000168473.1|5072549_5074238_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.2e-56
WP_001312198.1|5074343_5074442_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001332269.1|5074842_5076027_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148034.1|5076034_5076532_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113443.1|5076528_5076891_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|5076880_5077228_-	YidH family protein	NA	NA	NA	NA	NA
WP_001087168.1|5078776_5080492_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.0	6.1e-40
WP_001332266.1|5080658_5081525_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279773.1|5081614_5083276_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|5083472_5083901_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|5084012_5084426_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 371
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5088855	5090004	5099311		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|5088855_5090004_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 372
NZ_CP043950	Escherichia coli strain ST95-32 chromosome, complete genome	5099311	5094709	5097124	5099311		Bacillus_virus(100.0%)	1	NA	NA
WP_001298010.1|5094709_5097124_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
>prophage 1
NZ_CP043951	Escherichia coli strain ST95-32 plasmid pST95-32-1, complete sequence	228062	158582	216055	228062	transposase	Salmonella_phage(46.15%)	55	NA	NA
WP_087522250.1|158582_159951_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_000783758.1|160050_160209_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001015182.1|160627_160831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743060.1|160876_161227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031421.1|161286_161886_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
WP_000778030.1|161985_162930_-	DUF5417 domain-containing protein	NA	NA	NA	NA	NA
WP_001272970.1|164031_165216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000710431.1|165281_165563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893963.1|165819_166026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744346.1|166146_166443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286107.1|166487_166925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000800252.1|166992_167529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537761.1|167693_168062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000442694.1|168494_168797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032029.1|169153_169438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210769.1|169503_169857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338612.1|170143_170875_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000952983.1|170876_172058_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
WP_000718549.1|172068_172731_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_046788496.1|172717_173827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046788497.1|173826_175911_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001011151.1|175910_179057_-	helicase	NA	NA	NA	NA	NA
WP_000128631.1|179066_179804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|179800_180286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004209.1|181044_181845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140953.1|181846_182359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196728.1|182952_183999_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001257292.1|183988_185404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046788498.1|185412_189366_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001284752.1|189546_190836_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
WP_024136329.1|190943_191510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494967.1|191592_192132_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000720274.1|192279_193029_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000843244.1|193053_193446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025803.1|193479_193902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000620990.1|193961_194573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031377.1|194679_195489_+	DsbA family protein	NA	NA	NA	NA	NA
WP_042634445.1|195534_196794_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
WP_000111290.1|196777_197212_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_001130842.1|197405_198023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770127.1|198172_198529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|198986_199691_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000434930.1|200245_200872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|201376_202252_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_012579081.1|202331_203255_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_000147567.1|205272_205833_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|205835_208787_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|208795_209197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|209281_209986_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|210910_211795_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214121.1|212011_213226_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001255015.1|213253_213559_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032153701.1|213825_215025_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_021536379.1|215103_215781_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|215812_216055_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP043952	Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence	189994	544	58316	189994	protease,transposase,integrase	Enterobacteria_phage(14.29%)	44	18612:18626	61300:61314
WP_150330720.1|544_4678_+|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	1.4e-295
WP_000612591.1|6854_7202_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|7198_7579_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001017347.1|7654_8635_-	FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_000379710.1|8631_8901_-	membrane protein	NA	NA	NA	NA	NA
WP_001323890.1|9840_10077_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001259758.1|10054_10366_+	colicin V	NA	NA	NA	NA	NA
WP_001183604.1|10535_12650_-	microcin H47 export transporter peptidase/ATP-binding subunit MchF	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001332356.1|12624_13866_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001324224.1|14580_14778_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000969988.1|14774_14957_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000377483.1|15055_15364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001334482.1|15714_15906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001190233.1|15923_16958_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
WP_024130004.1|16878_17064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012006525.1|17287_17515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001222186.1|17800_19978_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
18612:18626	attL	GCCAGGGGAATATCT	NA	NA	NA	NA
WP_000271277.1|20022_20979_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933675.1|21063_22293_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_011402704.1|22396_26182_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_001318220.1|26195_27311_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001324233.1|27509_27773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324238.1|29758_29941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738422.1|30455_30749_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_150330721.1|31410_32683_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.9e-171
WP_000450494.1|33138_34332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696619.1|34966_36364_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001610304.1|36595_36865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610303.1|36864_37332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610302.1|37374_37746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610298.1|40087_42352_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_001610297.1|42353_43130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696614.1|45525_46896_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_001610286.1|46899_48840_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001696612.1|48836_50024_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	6.0e-10
WP_001595315.1|51738_52155_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.6	3.3e-16
WP_001324038.1|52303_52567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011402718.1|52934_53324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000280980.1|53427_54381_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_023145084.1|54469_54754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696610.1|54812_55922_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000175738.1|55984_56893_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_001332052.1|57266_57455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066953.1|57575_58316_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
61300:61314	attR	AGATATTCCCCTGGC	NA	NA	NA	NA
