The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043942	Escherichia coli strain AR216.2b chromosome, complete genome	4849144	1118322	1131505	4849144		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1118322_1119084_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1119077_1119704_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1119843_1120983_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1121045_1122038_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1122131_1123496_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1123584_1124361_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1124365_1125004_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1125000_1126263_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1126259_1127168_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1127363_1128131_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1128181_1128838_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|1128943_1131505_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP043942	Escherichia coli strain AR216.2b chromosome, complete genome	4849144	1648884	1712331	4849144	head,protease,terminase,capsid,lysis,tail,portal	Enterobacteria_phage(39.22%)	78	NA	NA
WP_000849212.1|1648884_1649373_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000686721.1|1649778_1650273_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|1650262_1650526_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778055.1|1650522_1653009_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091291.1|1653015_1653711_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013506.1|1653697_1654561_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|1654557_1655007_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|1655016_1655619_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_001328413.1|1655637_1656255_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971741.1|1656251_1656914_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|1656955_1657693_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186534.1|1657689_1657899_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|1657895_1658375_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982446.1|1658371_1660315_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|1660311_1660869_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211558.1|1660865_1661918_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113637.1|1661953_1662601_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001551371.1|1662920_1665512_+	autotransporter YejO	NA	NA	NA	NA	NA
WP_001136067.1|1666097_1666865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145023.1|1666854_1667238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106493932.1|1667721_1668678_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000741304.1|1668815_1669994_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.7e-31
WP_001096409.1|1669996_1670206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021548839.1|1670267_1670483_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
WP_001242718.1|1670479_1670842_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_021548838.1|1670832_1671369_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	5.3e-99
WP_000081280.1|1671496_1672321_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000135680.1|1672385_1672748_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000141752.1|1673185_1673431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072018922.1|1673348_1673624_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	96.7	5.9e-46
WP_000450737.1|1674019_1674646_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000205494.1|1674743_1674944_+	cell division protein	NA	NA	NA	NA	NA
WP_000515869.1|1674981_1675539_+	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
WP_001250269.1|1675714_1675894_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104976.1|1675883_1676825_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
WP_074527436.1|1676821_1677316_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.2e-86
WP_125316734.1|1677315_1677897_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	100.0	5.7e-115
WP_000210155.1|1677965_1678292_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_040074681.1|1678288_1678678_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	98.4	4.6e-68
WP_087604717.1|1678697_1679495_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	1.9e-148
WP_074527437.1|1679502_1680492_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_044862710.1|1680505_1681258_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	9.9e-136
WP_000484663.1|1681472_1682012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|1682155_1682389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096956487.1|1682646_1683021_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	93.5	4.4e-60
WP_052978305.1|1683088_1683304_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_000075159.1|1683303_1683801_+	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
WP_001228685.1|1684017_1684203_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_024174403.1|1684286_1684610_+	protein KilA	NA	A0A220NRM9	Escherichia_phage	99.1	7.9e-58
WP_024205918.1|1684606_1684864_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	1.1e-38
WP_000079508.1|1685150_1685561_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|1685617_1685851_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_119785704.1|1685866_1686124_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	97.1	8.9e-12
WP_000453587.1|1686239_1686785_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027321.1|1686759_1688685_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|1688681_1688888_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_057077926.1|1688884_1690486_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_029395138.1|1690466_1691786_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_012304872.1|1691795_1692128_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_029395141.1|1692183_1693209_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_001468354.1|1693250_1693646_+	DNA packaging FI family protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
WP_029395143.1|1693657_1694011_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_001518407.1|1694022_1694601_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_021548556.1|1694597_1694993_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_021548555.1|1695000_1695741_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
WP_111530670.1|1695756_1696179_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459458.1|1696160_1696595_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_021548553.1|1696587_1699167_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
WP_000847379.1|1699163_1699493_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152640.1|1699492_1700191_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.5e-133
WP_000194783.1|1700196_1700940_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090895.1|1700876_1701509_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_111530669.1|1701569_1705067_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.2	0.0e+00
WP_001233090.1|1705137_1705737_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_150348808.1|1705801_1709560_+	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	88.6	0.0e+00
WP_070749868.1|1709614_1709743_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	92.9	7.3e-15
WP_001351450.1|1710845_1712048_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_071701748.1|1712238_1712331_+|capsid	capsid protein	capsid	NA	NA	NA	NA
>prophage 3
NZ_CP043942	Escherichia coli strain AR216.2b chromosome, complete genome	4849144	1781589	1791032	4849144		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1781589_1782516_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1782520_1783252_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1783232_1783340_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1783399_1784131_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1784352_1786038_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1786034_1786754_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|1786800_1787271_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_032204114.1|1787312_1787774_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001551351.1|1787898_1789899_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1789895_1791032_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 4
NZ_CP043942	Escherichia coli strain AR216.2b chromosome, complete genome	4849144	1879296	1890211	4849144		Enterobacteria_phage(22.22%)	10	NA	NA
WP_125922846.1|1879296_1880574_+	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	24.5	1.1e-12
WP_099147824.1|1880609_1881938_+	flippase	NA	NA	NA	NA	NA
WP_099147860.1|1882017_1882410_+	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	41.1	6.8e-11
WP_000043542.1|1882581_1883988_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_049139659.1|1884212_1885277_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_016161468.1|1885303_1886173_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_004206787.1|1886204_1887095_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_004206788.1|1887109_1887664_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
WP_000704907.1|1887844_1889011_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_087523507.1|1889203_1890211_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 5
NZ_CP043942	Escherichia coli strain AR216.2b chromosome, complete genome	4849144	2816545	2875176	4849144	head,integrase,terminase,holin,capsid,transposase,tRNA,tail,portal	Escherichia_phage(42.55%)	66	2824737:2824751	2875278:2875292
WP_001297484.1|2816545_2817652_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2817687_2818329_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2818332_2819703_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2819871_2820543_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2820542_2822003_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2822078_2823200_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|2823248_2824475_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2824724_2825861_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2824737:2824751	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2825844_2826708_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|2827262_2827931_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309429.1|2827875_2828013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042047081.1|2828168_2828699_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_032143699.1|2829432_2829804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|2830112_2831621_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|2835574_2836174_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2836241_2839721_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|2839781_2840390_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|2840326_2841070_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2841075_2841774_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2841773_2842130_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2842107_2845335_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2845381_2845642_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|2845683_2846070_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|2846069_2846774_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2846834_2847179_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2847175_2847625_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2847621_2847960_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2847968_2848286_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2848362_2849580_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|2850185_2851412_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|2851559_2853317_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2853316_2853799_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2853946_2854297_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_071586179.1|2854589_2854730_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
WP_000738421.1|2854822_2855116_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2855206_2855389_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2855605_2856139_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2856202_2856553_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2856557_2856773_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|2857080_2857269_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2857529_2857865_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2857935_2858148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2858636_2858723_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|2859117_2859939_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2859935_2860316_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2860316_2861375_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2861376_2861655_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2861822_2862035_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000786213.1|2862237_2862417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002431311.1|2862988_2864530_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|2864544_2865291_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001224662.1|2865658_2865841_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2865934_2866291_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|2866348_2866771_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2866811_2867882_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2867953_2868379_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2868362_2868605_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2868996_2869335_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|2869766_2869967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2870059_2870278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2870242_2870446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2870846_2871035_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2871031_2871223_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2871316_2873758_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2873819_2874089_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2874057_2875176_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2875278:2875292	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
NZ_CP043942	Escherichia coli strain AR216.2b chromosome, complete genome	4849144	3761444	3814199	4849144	transposase,plate,integrase	Morganella_phage(16.67%)	55	3766149:3766164	3823631:3823646
WP_000230707.1|3761444_3761900_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	2.9e-45
WP_000678612.1|3761979_3762180_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
WP_050571080.1|3762405_3762642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016231257.1|3762663_3763101_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_016231258.1|3763163_3765269_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	1.4e-86
WP_016231259.1|3765268_3766735_-	hypothetical protein	NA	B6SCW4	Bacteriophage	53.3	1.4e-106
3766149:3766164	attL	TGATCTTTGATATCGA	NA	NA	NA	NA
WP_014639558.1|3767179_3767431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087523544.1|3767497_3770254_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	2.6e-298
WP_001058739.1|3770266_3770869_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_000181940.1|3770861_3771083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|3771079_3771343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3771339_3771534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077900594.1|3771526_3772594_-	ash family protein	NA	NA	NA	NA	NA
WP_033554327.1|3772587_3772770_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_087523546.1|3772762_3773572_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	53.6	3.0e-29
WP_000412539.1|3773584_3774016_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_074525659.1|3774015_3774219_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_074525658.1|3774266_3774500_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_021531046.1|3774611_3775826_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000893278.1|3776181_3777435_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3777446_3778550_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|3778837_3779893_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|3779931_3780333_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|3780390_3781635_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3781726_3782185_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|3782445_3783903_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|3783959_3784496_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|3784428_3784695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|3785000_3785453_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|3785462_3785861_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|3785863_3786157_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3786208_3787264_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001333407.1|3787334_3788105_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3788064_3789804_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3790027_3790525_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|3790700_3791450_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3791659_3791920_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3791922_3792201_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3792356_3793097_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3793067_3793835_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3794040_3794619_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3794858_3797303_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|3797345_3797819_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_087523548.1|3797972_3798743_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3798783_3799920_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_024198219.1|3800510_3800744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|3800721_3804954_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3805029_3807171_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3807380_3807899_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3808593_3809094_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3809128_3809353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3809403_3810879_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3810885_3811299_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3811302_3813153_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3813116_3814199_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
3823631:3823646	attR	TGATCTTTGATATCGA	NA	NA	NA	NA
>prophage 7
NZ_CP043942	Escherichia coli strain AR216.2b chromosome, complete genome	4849144	4547552	4626905	4849144	integrase,protease,transposase,tRNA,tail	Escherichia_phage(40.0%)	77	4557252:4557287	4635790:4635825
WP_000187022.1|4547552_4548653_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4548692_4549052_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4549051_4549702_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4550032_4551433_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4551415_4552333_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|4552599_4553973_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|4554033_4554810_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4554817_4555822_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|4555975_4557127_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
4557252:4557287	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|4557724_4560376_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|4560557_4562291_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|4562505_4563357_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|4563343_4563685_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|4563686_4564565_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|4564530_4566828_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4566878_4567199_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4567213_4568293_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|4568601_4571103_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|4571114_4571777_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4571787_4572891_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|4573165_4573783_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|4573809_4574715_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|4574807_4576988_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|4577316_4578207_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4578555_4580988_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|4580990_4582151_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4582427_4582745_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|4582928_4583537_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|4583597_4583810_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|4584012_4586211_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4586366_4587392_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4587483_4588443_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4588535_4589066_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4589075_4590407_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4590473_4591400_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4591492_4591978_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4592062_4592308_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4592732_4593578_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4593600_4595109_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4595243_4596254_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4596350_4597097_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|4597101_4597530_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|4597556_4597856_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4598067_4598508_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|4598608_4599208_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|4599315_4600083_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|4600137_4600893_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|4600999_4601989_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4602308_4603271_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4603451_4604354_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001145759.1|4604561_4605074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|4605347_4606717_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|4606789_4607008_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|4607089_4608253_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|4608252_4608732_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|4608746_4611194_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|4611186_4611306_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4611338_4611614_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4611670_4612189_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|4612201_4613392_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|4613451_4614054_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|4614061_4615597_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|4615645_4615993_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4615989_4616394_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001016257.1|4616714_4617461_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|4617475_4619017_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_000027659.1|4620491_4620767_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4620763_4620988_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4620987_4621290_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4621289_4621514_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4621577_4622078_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4622247_4622520_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4622656_4622950_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4623019_4624000_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4624186_4624687_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4624836_4625535_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4625531_4626905_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4635790:4635825	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 1
NZ_CP043944	Escherichia coli strain AR216.2b plasmid pMPNDM-5, complete sequence	99465	1262	47322	99465	transposase,protease,integrase	Escherichia_phage(46.15%)	47	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001309252.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|2678_3848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|4694_4967_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001496335.1|6209_8180_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|8186_8978_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001317493.1|9716_10499_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255956.1|10495_11518_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|12597_12972_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_001067855.1|12996_13701_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|13822_14728_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|14724_15963_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|15962_16547_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|16492_16849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|17776_18481_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|18587_19448_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|19460_20003_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|21196_21901_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023408309.1|22459_23272_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_004201167.1|23275_23641_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|23645_24284_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|24294_25326_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_000050481.1|25638_27180_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|27584_28424_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|28417_28765_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|28928_29720_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|29725_30016_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|30127_30625_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_060591625.1|30769_31657_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
WP_001067855.1|31690_32395_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|34016_34259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000470728.1|34290_34968_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|35046_36246_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|36277_37162_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|37299_37692_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509965.1|38468_39074_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001553819.1|39168_42066_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|42202_42604_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|42536_42794_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|42886_43540_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012311408.1|43729_44116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152935.1|44478_45336_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|45328_45403_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_072163418.1|45486_45597_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000083821.1|45637_45895_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_071529016.1|45861_46113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|46299_47322_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP043944	Escherichia coli strain AR216.2b plasmid pMPNDM-5, complete sequence	99465	60477	68857	99465	transposase	Stx2-converting_phage(50.0%)	14	NA	NA
WP_023149734.1|60477_62049_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|62068_62416_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|62415_63093_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_077779935.1|63069_63237_+	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	7.8e-09
WP_001496308.1|63230_63353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012601.1|63537_63750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139363.1|63883_64444_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_086625070.1|64498_65275_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.3e-09
WP_000271685.1|65380_65803_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001666994.1|65849_66152_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001006251.1|66688_67459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546462.1|67503_67938_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|67951_68173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032181561.1|68173_68857_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
>prophage 1
NZ_CP043943	Escherichia coli strain AR216.2b plasmid pMPTEM-30, complete sequence	115609	13920	33306	115609	integrase,transposase	Escherichia_phage(33.33%)	19	8977:8991	35656:35670
8977:8991	attL	ATTTATAATGCTGAA	NA	NA	NA	NA
WP_001067858.1|13920_14625_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001043260.1|14840_15656_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|15742_16045_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|15938_16190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|16220_17714_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|17825_18131_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039026029.1|18158_19373_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	3.2e-19
WP_001447541.1|19589_20474_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_021561477.1|23336_24197_-	inhibitor-resistant class A broad-spectrum beta-lactamase TEM-30	NA	Q1MVP3	Enterobacteria_phage	99.7	3.9e-160
WP_001067858.1|24318_25023_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000679427.1|25878_26226_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206317.1|26389_27181_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000777555.1|27273_27747_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_000845048.1|27903_28917_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067858.1|29613_30318_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001596999.1|30351_30609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290416.1|30653_31580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465036.1|32111_32525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164198.1|32526_33306_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
35656:35670	attR	ATTTATAATGCTGAA	NA	NA	NA	NA
