The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043910	Acinetobacter baumannii strain AB043 chromosome, complete genome	3961713	139211	154009	3961713		Acinetobacter_phage(100.0%)	10	NA	NA
WP_000566784.1|139211_139787_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
WP_109104826.1|139883_142655_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	98.8	0.0e+00
WP_005134946.1|142662_145395_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.8	0.0e+00
WP_001982145.1|145750_146800_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608308.1|146809_147616_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_000066123.1|147625_148321_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	99.6	2.2e-121
WP_001164225.1|148331_149315_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	98.8	6.6e-188
WP_005134944.1|149321_151697_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	99.6	0.0e+00
WP_000893681.1|151698_153198_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.6	1.0e-277
WP_001187844.1|153460_154009_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 2
NZ_CP043910	Acinetobacter baumannii strain AB043 chromosome, complete genome	3961713	1253967	1276819	3961713	integrase,transposase	uncultured_Caudovirales_phage(40.0%)	27	1255427:1255441	1284970:1284984
WP_085944194.1|1253967_1255186_+|transposase	IS3-like element ISAba18 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.2	3.2e-75
1255427:1255441	attL	TTTTATGAATGAAAC	NA	NA	NA	NA
WP_017397630.1|1255481_1256597_-	TniQ family protein	NA	NA	NA	NA	NA
WP_074031684.1|1256623_1257424_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000954590.1|1257744_1258947_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	55.1	5.0e-121
WP_001179606.1|1259094_1259316_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001162384.1|1259320_1260148_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000743064.1|1260134_1261016_+	replication protein C	NA	NA	NA	NA	NA
WP_000024442.1|1262048_1262237_+	stabilization protein	NA	NA	NA	NA	NA
WP_000836966.1|1262377_1263157_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000718002.1|1263169_1263406_+	entry exclusion lipoprotein TrbK	NA	NA	NA	NA	NA
WP_001405816.1|1263416_1264844_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_000213809.1|1264848_1265097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211355.1|1265160_1265385_+	type I toxin-antitoxin system ptaRNA1 family toxin	NA	NA	NA	NA	NA
WP_000131871.1|1265421_1265625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272375.1|1265739_1266807_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000140066.1|1266803_1267310_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	3.0e-27
WP_001239389.1|1267306_1268074_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.3	1.4e-76
WP_000447876.1|1268070_1268403_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001366550.1|1268550_1269288_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|1269284_1269509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|1269719_1271213_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|1271243_1271495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|1271388_1271691_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|1271777_1272593_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940413.1|1272685_1273775_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000573066.1|1274197_1276108_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736393.1|1276108_1276819_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	5.3e-06
1284970:1284984	attR	GTTTCATTCATAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP043910	Acinetobacter baumannii strain AB043 chromosome, complete genome	3961713	3193175	3233991	3961713	portal,head,protease,tail,tRNA,integrase,capsid,terminase	Acinetobacter_phage(40.74%)	54	3203268:3203289	3238417:3238438
WP_000033177.1|3193175_3193679_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	2.9e-06
WP_001246675.1|3193748_3194192_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000218018.1|3194199_3194886_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140309.1|3194990_3196664_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000205997.1|3196820_3197123_+	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
WP_001269278.1|3197147_3197513_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_000392928.1|3197678_3198377_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001190745.1|3198373_3199285_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_109104877.1|3199334_3200882_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_085920605.1|3201045_3202023_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000933387.1|3202106_3203249_+	cell division protein ZapE	NA	NA	NA	NA	NA
3203268:3203289	attL	CGCTCTAAATTGAGCGCTTTTT	NA	NA	NA	NA
WP_000190203.1|3203425_3204385_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.4	7.6e-48
WP_000141160.1|3204350_3204602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005654.1|3204594_3204864_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	94.0	1.9e-44
WP_000992057.1|3204860_3205343_-	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	74.8	4.6e-70
WP_000130778.1|3205346_3205877_-	DUF551 domain-containing protein	NA	A0A1B1P9F6	Acinetobacter_phage	88.2	1.6e-31
WP_000717853.1|3205888_3206152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284990.1|3207009_3207282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001071965.1|3207274_3207712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049594836.1|3207966_3208599_-	Cro/Cl family transcriptional regulator	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	48.4	2.3e-24
WP_001005276.1|3209003_3209300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049594835.1|3209299_3210184_+	YdaU family protein	NA	A0A2I7RGZ2	Vibrio_phage	63.4	4.6e-31
WP_000009564.1|3210183_3211515_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	55.2	9.7e-126
WP_000846967.1|3211511_3211790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000801885.1|3211786_3212389_+	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	45.8	4.4e-09
WP_001003589.1|3212385_3212556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001060708.1|3212555_3213053_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
WP_000344040.1|3213143_3213860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000910071.1|3213885_3214248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380484.1|3214265_3214436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152595.1|3214760_3215189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856321.1|3215272_3215671_+	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	1.4e-11
WP_000433061.1|3215686_3216217_+	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	5.7e-37
WP_000093655.1|3216206_3216389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000503076.1|3216381_3216645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074031681.1|3216622_3216913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001219091.1|3217263_3217746_+|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	46.0	2.7e-25
WP_000467659.1|3217755_3217950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049594834.1|3218072_3219773_+|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	62.2	1.6e-197
WP_000108390.1|3219769_3220996_+|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	3.9e-182
WP_000375470.1|3220988_3221651_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.7	1.2e-73
WP_000137064.1|3221643_3222816_+|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	53.0	2.0e-103
WP_000666093.1|3222863_3223040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000631203.1|3223036_3223324_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	47.5	1.1e-18
WP_001139339.1|3223325_3223682_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.0	1.6e-19
WP_000426677.1|3223685_3224171_+	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	44.8	1.7e-27
WP_000598738.1|3224170_3224545_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	44.5	2.6e-20
WP_001062225.1|3224614_3225094_+	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	67.1	1.9e-55
WP_000113359.1|3225093_3225510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032061919.1|3225799_3226183_+	lipoprotein	NA	A0A1B1P9E7	Acinetobacter_phage	54.4	3.5e-36
WP_049594833.1|3226242_3229830_+	hypothetical protein	NA	J7I4Q7	Acinetobacter_phage	31.6	5.7e-72
WP_033502836.1|3229837_3230320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133292.1|3230312_3230819_+	hypothetical protein	NA	A0A1B1P9F1	Acinetobacter_phage	37.3	1.5e-23
WP_000054088.1|3231132_3233991_+	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	34.3	2.8e-130
3238417:3238438	attR	CGCTCTAAATTGAGCGCTTTTT	NA	NA	NA	NA
>prophage 4
NZ_CP043910	Acinetobacter baumannii strain AB043 chromosome, complete genome	3961713	3706703	3755288	3961713	integrase,capsid,terminase	Acinetobacter_phage(90.2%)	67	3704579:3704596	3755449:3755466
3704579:3704596	attL	ATAGAAAAAGTAGAATCC	NA	NA	NA	NA
WP_000829046.1|3706703_3707996_+	Y-family DNA polymerase	NA	A0A0P0I4F0	Acinetobacter_phage	90.2	8.9e-209
WP_000071917.1|3708024_3708447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086710.1|3708471_3708642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265239.1|3708610_3708979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066825.1|3708978_3709488_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	59.2	2.8e-49
WP_000005350.1|3709471_3709747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049594825.1|3709813_3713260_-	bacteriophage protein	NA	A0A0D4DBG7	Acinetobacter_phage	96.9	0.0e+00
WP_000835157.1|3713252_3713615_-	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	4.4e-65
WP_000368392.1|3713611_3714118_-	DUF1833 family protein	NA	A0A0D4DCA4	Acinetobacter_phage	99.4	2.7e-92
WP_000277431.1|3714117_3714516_-	hypothetical protein	NA	A0A0P0IY66	Acinetobacter_phage	95.5	1.3e-70
WP_000046542.1|3714565_3719461_-	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	98.3	0.0e+00
WP_031977960.1|3719553_3719943_-	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	100.0	7.3e-66
WP_000523932.1|3719976_3720300_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_074031683.1|3720308_3720485_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	57.7	8.2e-09
WP_000966688.1|3720584_3720989_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
WP_000838146.1|3721081_3721264_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_001185604.1|3721589_3722105_-	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	98.5	5.3e-72
WP_000094261.1|3722174_3723092_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.4	2.7e-167
WP_000002414.1|3723144_3724323_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	65.1	1.9e-101
WP_000064603.1|3724322_3724676_-	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	95.7	5.1e-58
WP_000749906.1|3724772_3725294_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|3725402_3725621_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_001251846.1|3725622_3726021_-	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	90.9	5.2e-67
WP_000539743.1|3726022_3726391_-	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	98.1	1.1e-55
WP_170825905.1|3726362_3726800_-	hypothetical protein	NA	J7I0W8	Acinetobacter_phage	91.0	4.7e-69
WP_000524217.1|3726778_3727147_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	100.0	2.6e-65
WP_000008486.1|3727148_3727538_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	99.2	8.6e-67
WP_000692542.1|3727542_3728208_-	hypothetical protein	NA	J7I4P7	Acinetobacter_phage	95.0	1.8e-109
WP_049594824.1|3728273_3729230_-	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
WP_000770049.1|3729257_3730025_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_001139861.1|3730138_3730330_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000004365.1|3730553_3730790_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	94.9	4.8e-36
WP_000965191.1|3730888_3731317_-	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	99.3	1.2e-72
WP_000179750.1|3731325_3732429_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	99.2	6.6e-205
WP_001286363.1|3732430_3733882_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	98.8	1.6e-283
WP_000102084.1|3733878_3735306_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	92.8	5.3e-263
WP_000729376.1|3735295_3735766_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.1	4.4e-73
WP_000435236.1|3735824_3736466_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	92.0	4.7e-118
WP_000341081.1|3736434_3736863_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	61.1	1.3e-39
WP_000469283.1|3737587_3737806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162489797.1|3738331_3738451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170825904.1|3738816_3738990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991752.1|3739204_3740005_-	hypothetical protein	NA	B6SD57	Bacteriophage	41.2	9.2e-55
WP_000992310.1|3740265_3740703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000097328.1|3740705_3741110_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	50.9	5.2e-22
WP_053100974.1|3741109_3741298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647824.1|3741980_3742322_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	57.1	4.6e-32
WP_000544508.1|3742318_3743068_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	95.6	7.8e-133
WP_001110402.1|3743060_3744011_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	61.4	1.3e-95
WP_001091618.1|3744007_3745561_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	41.8	2.4e-136
WP_000102847.1|3745557_3745842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095599.1|3745838_3746114_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	98.9	2.6e-41
WP_000051076.1|3746157_3746421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217697.1|3746417_3746594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105766.1|3746721_3747411_+	helix-turn-helix domain-containing protein	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	73.1	2.0e-58
WP_000029179.1|3747483_3748374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054453.1|3748374_3749241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101042.1|3749443_3749884_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	96.6	5.4e-73
WP_000181044.1|3749886_3750210_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	80.4	3.8e-44
WP_001207475.1|3750220_3751342_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.7	1.5e-212
WP_001061220.1|3751338_3752547_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	50.2	4.4e-93
WP_000654848.1|3752548_3752800_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.7	1.1e-38
WP_000147327.1|3752800_3753208_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000048748.1|3753204_3753489_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	97.9	1.2e-44
WP_000005652.1|3753492_3753750_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	96.5	3.2e-46
WP_000910238.1|3753750_3754020_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000773628.1|3754025_3755288_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	99.0	3.6e-247
3755449:3755466	attR	ATAGAAAAAGTAGAATCC	NA	NA	NA	NA
