The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043870	Proteus mirabilis strain S1959 chromosome, complete genome	3957207	350144	358678	3957207		Mycobacterium_phage(28.57%)	9	NA	NA
WP_004246075.1|350144_351344_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|351952_352921_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004252248.1|352946_355073_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|355101_355506_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|355517_355742_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|356023_356497_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|356694_356904_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246061.1|357206_357695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|358303_358678_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
>prophage 2
NZ_CP043870	Proteus mirabilis strain S1959 chromosome, complete genome	3957207	398319	444449	3957207	integrase,lysis,tail	Proteus_phage(25.0%)	63	398233:398253	451348:451368
398233:398253	attL	CTGCTTATTGGATTATAGTAG	NA	NA	NA	NA
WP_150024343.1|398319_399321_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	2.8e-69
WP_150024344.1|399277_399523_-	excisionase	NA	NA	NA	NA	NA
WP_036932464.1|401859_402186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246003.1|402219_402558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246002.1|402590_403394_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	95.9	1.7e-141
WP_150024345.1|403386_404205_-	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	96.7	1.0e-157
WP_012367605.1|404201_404456_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	94.0	4.6e-37
WP_012367606.1|404452_404716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150024346.1|404932_405124_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_150024347.1|405185_405449_-	hypothetical protein	NA	A0A0G2SS78	Proteus_phage	95.7	1.2e-16
WP_150024348.1|405452_405677_-	hypothetical protein	NA	A0A1L2C975	Pseudomonas_phage	46.5	1.1e-05
WP_150024349.1|405690_405879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150024350.1|406373_406652_-	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	83.5	1.7e-32
WP_150024351.1|407157_408048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150024352.1|408040_408613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150024353.1|408647_409331_-	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	97.4	1.3e-129
WP_004245989.1|409413_409623_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_150024354.1|409753_410116_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	50.5	7.6e-17
WP_104459722.1|410381_411149_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_017628813.1|411148_412534_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.4e-114
WP_026090523.1|412561_412891_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_036919942.1|412958_413408_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|413486_413777_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|413773_414130_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245982.1|414129_414762_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004247148.1|415073_415595_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_036907970.1|415853_416315_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	5.7e-25
WP_150024355.1|416523_416952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036976685.1|417479_418088_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.2e-64
WP_049195184.1|418090_419578_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.8	1.0e-264
WP_150024356.1|419577_420948_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	2.4e-119
WP_004245973.1|420944_422066_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.5	1.0e-104
WP_004245971.1|422177_422939_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	2.0e-67
WP_004245970.1|422952_423906_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_107033975.1|423908_424193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245968.1|424232_424712_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
WP_004245967.1|424714_425065_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	3.8e-21
WP_004245966.1|425066_425648_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.0e-47
WP_004245963.1|425644_426046_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004245961.1|426091_426748_+|tail	major tail protein	tail	G8C7Q3	Escherichia_phage	57.3	8.6e-59
WP_004245960.1|426799_427105_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_150024357.1|427131_427410_+	DUF1799 domain-containing protein	NA	F8UBV2	Escherichia_phage	47.0	4.3e-12
WP_004245958.1|427458_427662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245957.1|427715_428714_+	zinc chelation protein SecC	NA	A0A2H4JE36	uncultured_Caudovirales_phage	38.6	4.8e-29
WP_004245956.1|428829_429663_-	hypothetical protein	NA	I6S627	Salmonella_phage	55.6	1.7e-67
WP_004245955.1|429732_429894_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_004245954.1|430007_430265_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_004245953.1|430365_431211_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	36.0	1.2e-31
WP_012367638.1|431197_431617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245950.1|431609_432278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195350.1|432374_432608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150024358.1|432675_435615_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	35.2	6.6e-143
WP_004247512.1|435637_435850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195346.1|435889_436180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245944.1|436199_436400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150024359.1|436543_436885_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	49.1	4.5e-27
WP_150024360.1|436881_437625_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	60.2	9.0e-89
WP_049201317.1|437621_438332_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	61.2	1.2e-85
WP_150024361.1|438328_438916_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.9	8.5e-58
WP_150024362.1|438967_443161_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.5	1.0e-301
WP_004245936.1|443154_443523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|443524_444139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245934.1|444188_444449_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.4	2.5e-17
451348:451368	attR	CTGCTTATTGGATTATAGTAG	NA	NA	NA	NA
>prophage 3
NZ_CP043870	Proteus mirabilis strain S1959 chromosome, complete genome	3957207	617097	696131	3957207	plate,protease,tRNA	Bacillus_phage(17.65%)	59	NA	NA
WP_004244558.1|617097_617412_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|617442_619737_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|619856_620075_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_036932268.1|620394_621087_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|621088_622840_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_004244563.1|622842_624612_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	2.3e-21
WP_004244564.1|624750_625710_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|626252_626747_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_150024365.1|626874_630741_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|630853_631459_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|631469_632819_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|632952_634242_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|634421_634754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244573.1|635154_636204_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|636276_637182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|637539_638280_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|638387_640670_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|640724_641579_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_017827047.1|642249_644007_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_004244579.1|644234_645272_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_004244580.1|645346_646600_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244581.1|646736_648167_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.4	1.3e-06
WP_004244582.1|648303_649392_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004244584.1|649588_650875_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|651163_651841_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|652022_653696_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|653760_654048_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_150024452.1|654133_654316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244588.1|654500_656870_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.7	2.1e-22
WP_004244589.1|656906_658652_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_004244590.1|658648_659650_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|660145_660361_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|660775_660955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|660959_661721_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004244595.1|661844_662675_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|663054_663828_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|663837_665160_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004244598.1|665140_665872_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_150024366.1|665868_670326_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004244601.1|670608_671262_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.0	1.0e-99
WP_004247637.1|671667_672381_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004244603.1|672723_674439_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|674770_675319_+	YcbK family protein	NA	NA	NA	NA	NA
WP_036932274.1|675368_676019_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|676111_676585_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|676675_678412_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_004244609.1|678404_679760_-	membrane protein	NA	NA	NA	NA	NA
WP_004244610.1|679797_683346_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004244611.1|683348_684812_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|684817_685468_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|685469_686258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150024367.1|686261_688973_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	4.9e-84
WP_004244617.1|688981_689737_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004244618.1|689729_691097_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|691089_691641_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_036932298.1|691642_692911_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|692915_693953_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_017628432.1|693916_695692_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|695699_696131_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP043870	Proteus mirabilis strain S1959 chromosome, complete genome	3957207	855518	881423	3957207	integrase,terminase,head,protease,tRNA,capsid,portal	Morganella_phage(24.0%)	35	853900:853913	861158:861171
853900:853913	attL	CATTAGCTAAACCT	NA	NA	NA	NA
WP_004247117.1|855518_856622_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|856727_857180_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|857172_857802_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|857940_859194_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_004251675.1|859314_860442_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.6	3.7e-126
WP_004251672.1|860422_860665_-	excisionase	NA	NA	NA	NA	NA
WP_004247124.1|860726_861257_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
861158:861171	attR	CATTAGCTAAACCT	NA	NA	NA	NA
WP_004247125.1|861313_862141_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247126.1|862206_862581_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247127.1|862604_862787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247128.1|863229_863712_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247129.1|863815_864055_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247130.1|864139_864598_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_004247132.1|864886_865066_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_004247133.1|865078_866170_+	hypothetical protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_004247134.1|866341_867049_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004247135.1|867048_868074_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247136.1|868101_868500_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247137.1|868842_869055_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004251632.1|869525_869861_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_017827436.1|869964_870891_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_036905792.1|871307_871736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|871888_872140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|872583_872853_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_036900946.1|872852_873323_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_001967215.1|874337_874676_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905782.1|874678_874891_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_036905779.1|875014_875482_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_036969710.1|875435_877169_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
WP_012367784.1|877168_878437_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
WP_004251596.1|878454_879123_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
WP_004251594.1|879126_880293_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
WP_004251590.1|880331_880631_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
WP_004251588.1|880630_880960_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_004251585.1|880949_881423_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
>prophage 5
NZ_CP043870	Proteus mirabilis strain S1959 chromosome, complete genome	3957207	1139934	1149937	3957207		Escherichia_phage(66.67%)	8	NA	NA
WP_004242885.1|1139934_1141992_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
WP_004242886.1|1142003_1143704_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1144039_1144726_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1144725_1145187_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1145250_1145862_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242891.1|1146001_1146862_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242892.1|1146863_1147481_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_004242893.1|1147492_1149937_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 6
NZ_CP043870	Proteus mirabilis strain S1959 chromosome, complete genome	3957207	1482002	1525502	3957207	tail,integrase,terminase,holin	Escherichia_phage(25.71%)	49	1510243:1510258	1531272:1531287
WP_004243319.1|1482002_1483055_-	nucleotidyltransferase	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
WP_036905599.1|1483038_1483818_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.7	4.8e-32
WP_004243321.1|1484195_1484690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243323.1|1484705_1485164_-	structural protein	NA	A0A0D4DAE2	Escherichia_phage	50.4	6.9e-31
WP_004243326.1|1485166_1485439_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_004243327.1|1485435_1485807_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	40.0	5.1e-16
WP_004243328.1|1486006_1486369_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	60.7	8.4e-32
WP_004243329.1|1486368_1487289_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	84.3	9.6e-149
WP_004243330.1|1487285_1488731_+	glucosyl transferase	NA	A0A192Y7W8	Salmonella_phage	29.7	8.3e-14
WP_004243331.1|1488760_1491142_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	40.6	2.2e-64
WP_004243332.1|1491315_1491567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243333.1|1491591_1491891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243335.1|1491901_1495285_-	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.3	2.8e-185
WP_004243336.1|1495284_1498368_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	51.1	6.5e-165
WP_004243338.1|1498370_1498919_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	3.4e-45
WP_107337200.1|1498918_1499389_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	60.5	1.5e-49
WP_004243340.1|1499390_1501853_-	hypothetical protein	NA	Q858G3	Salmonella_phage	70.0	0.0e+00
WP_004243342.1|1501852_1502458_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	5.1e-66
WP_004243343.1|1502457_1502769_-	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	1.8e-14
WP_004243344.1|1502832_1503174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243346.1|1503182_1503614_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	55.5	1.7e-31
WP_150024386.1|1503672_1504653_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.1	9.4e-110
WP_004243353.1|1504668_1505346_-	hypothetical protein	NA	T1SAP9	Salmonella_phage	64.3	5.2e-43
WP_004243354.1|1505363_1505678_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_004243355.1|1505674_1507339_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	65.6	1.1e-198
WP_004243356.1|1507348_1507561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150024387.1|1507745_1509230_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.6	1.4e-229
WP_080047821.1|1509229_1509793_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.5e-43
WP_004243359.1|1509897_1510257_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	56.2	3.3e-28
1510243:1510258	attL	AGGTGATTTAGCCATT	NA	NA	NA	NA
WP_036932155.1|1510249_1510594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243363.1|1510593_1510803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243365.1|1510789_1511083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243366.1|1511208_1511604_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	5.2e-35
WP_004243367.1|1511600_1512014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243368.1|1512260_1512986_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
WP_004243371.1|1513838_1514024_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
WP_064505757.1|1514163_1514442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|1514519_1515128_+	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_004243376.1|1515524_1517249_+	DNA breaking-rejoining protein	NA	A0A0U2I1R6	Escherichia_phage	47.8	1.2e-112
WP_004243377.1|1517294_1518335_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	51.0	1.9e-100
WP_004243378.1|1518379_1518637_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004243380.1|1518703_1519417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107337201.1|1519451_1519925_+	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	77.4	6.0e-70
WP_004243384.1|1519921_1520563_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	61.1	1.3e-72
WP_004243387.1|1520565_1520763_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	63.5	2.9e-18
WP_004243388.1|1520762_1520951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150024388.1|1520958_1522155_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.9	2.4e-139
WP_004250844.1|1522373_1523951_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004243391.1|1524035_1525502_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
1531272:1531287	attR	AATGGCTAAATCACCT	NA	NA	NA	NA
>prophage 7
NZ_CP043870	Proteus mirabilis strain S1959 chromosome, complete genome	3957207	1715359	1728801	3957207		Escherichia_phage(30.0%)	14	NA	NA
WP_012368081.1|1715359_1717798_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|1717809_1718427_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|1718430_1719207_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|1719322_1719865_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_004243613.1|1720432_1720612_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243614.1|1720725_1722018_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.6e-14
WP_004243615.1|1722023_1722680_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_004243616.1|1722676_1723864_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|1723856_1724201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|1724197_1724890_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|1724892_1725705_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|1725673_1725994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243624.1|1726006_1726495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243625.1|1726497_1728801_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	5.4e-15
>prophage 8
NZ_CP043870	Proteus mirabilis strain S1959 chromosome, complete genome	3957207	2475146	2484020	3957207		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|2475146_2476715_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_004245602.1|2477115_2477796_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|2477892_2478468_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|2478544_2479123_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|2479190_2480216_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|2480250_2480706_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_150024407.1|2480730_2481897_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004245609.1|2481897_2482482_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_150024408.1|2482874_2484020_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	26.9	3.5e-31
>prophage 9
NZ_CP043870	Proteus mirabilis strain S1959 chromosome, complete genome	3957207	3259311	3318160	3957207	integrase,terminase,head,protease,tail,lysis,plate,tRNA,holin,capsid,portal	Salmonella_phage(39.47%)	67	3274265:3274312	3303324:3303371
WP_004246449.1|3259311_3259815_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_004246448.1|3259818_3260769_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004246447.1|3260791_3261796_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	31.3	1.2e-38
WP_004246446.1|3261821_3262988_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.4	5.9e-119
WP_080544260.1|3263009_3264074_-	EpsG family protein	NA	NA	NA	NA	NA
WP_004246444.1|3264070_3264817_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	31.8	9.6e-06
WP_004246443.1|3264820_3265639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246442.1|3265604_3266708_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004246441.1|3266709_3267930_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_036932483.1|3267932_3268832_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_004246438.1|3269316_3270075_-	DUF707 domain-containing protein	NA	NA	NA	NA	NA
WP_004246433.1|3271317_3272706_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
WP_004246432.1|3272718_3273417_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
WP_004249721.1|3273600_3274167_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
3274265:3274312	attL	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTT	NA	NA	NA	NA
WP_036908546.1|3274443_3275415_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	64.4	1.6e-117
WP_036908544.1|3275481_3275787_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	49.5	8.4e-17
WP_036908542.1|3275891_3276182_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	63.5	1.1e-31
WP_049220106.1|3276183_3276372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220105.1|3276526_3276922_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_006536692.1|3276939_3277197_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_109397523.1|3277189_3277411_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_150024421.1|3277412_3278240_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.4	2.0e-60
WP_036907632.1|3278239_3278563_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_150024422.1|3278562_3280941_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.6	2.6e-166
WP_087726421.1|3281047_3281257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150024423.1|3281873_3282902_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.7	3.2e-137
WP_150024424.1|3282901_3284656_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	72.7	5.7e-259
WP_150024425.1|3284830_3285640_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	49.1	1.1e-66
WP_150024426.1|3285655_3286801_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	66.9	1.7e-126
WP_150024427.1|3286800_3287469_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_150024428.1|3287546_3288002_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	44.7	5.4e-28
WP_113976851.1|3288001_3288208_+|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	52.9	1.3e-16
WP_080972378.1|3288227_3288542_+|holin	holin	holin	NA	NA	NA	NA
WP_150024429.1|3288528_3288966_+	M15 family metallopeptidase	NA	A0A193GZ39	Escherichia_phage	57.2	7.7e-40
WP_150024430.1|3288962_3289466_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	29.0	1.4e-05
WP_150024431.1|3289440_3289878_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	48.6	9.2e-33
WP_150024432.1|3289867_3290503_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	36.3	1.5e-28
WP_150024433.1|3290578_3291205_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.1	5.9e-57
WP_150024434.1|3291201_3291540_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	49.5	2.2e-26
WP_150024435.1|3291541_3292450_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	2.1e-108
WP_150024436.1|3292442_3293054_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	67.9	6.1e-75
WP_150024437.1|3293043_3294696_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	45.5	4.8e-58
WP_150024438.1|3294791_3295964_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	70.6	1.6e-164
WP_150024439.1|3295967_3296483_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.3	7.7e-55
WP_150024440.1|3296502_3296850_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.7	1.3e-18
WP_072070684.1|3296810_3296984_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	52.6	5.6e-10
WP_150024441.1|3296976_3299838_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.7	4.1e-121
WP_036907694.1|3299837_3300302_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_150024442.1|3300301_3301399_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	54.0	2.5e-111
WP_150024443.1|3301451_3301670_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	68.8	1.9e-18
WP_088206906.1|3301723_3302377_-	DCL family protein	NA	NA	NA	NA	NA
WP_150024444.1|3302423_3303128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036969549.1|3303458_3304214_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
3303324:3303371	attR	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTT	NA	NA	NA	NA
WP_004246429.1|3304747_3305725_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004246428.1|3306018_3307023_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004249716.1|3307118_3307889_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012368676.1|3307995_3308631_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_004246425.1|3308742_3309171_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_004246424.1|3309231_3309978_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_004246423.1|3310316_3311501_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	2.0e-13
WP_004246422.1|3311610_3313143_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246421.1|3313185_3314001_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_012368679.1|3314297_3314540_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_004246419.1|3314633_3315152_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_004246418.1|3315260_3316178_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004246417.1|3316276_3317617_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
WP_004246416.1|3317629_3318160_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
