The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043772	Haemophilus influenzae biotype aegyptius strain HE24/F3037 chromosome, complete genome	1987687	76973	86046	1987687		Escherichia_phage(83.33%)	8	NA	NA
WP_005656004.1|76973_77474_-	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	32.0	3.2e-13
WP_005662894.1|77473_78085_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	32.5	3.0e-21
WP_013526115.1|78196_79036_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	31.4	9.4e-18
WP_005647791.1|79037_79655_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.3	7.5e-73
WP_013526114.1|79665_82086_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	9.1e-223
WP_005647785.1|82342_83452_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_006996602.1|83798_84077_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_006996601.1|84201_86046_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.6	1.6e-22
>prophage 2
NZ_CP043772	Haemophilus influenzae biotype aegyptius strain HE24/F3037 chromosome, complete genome	1987687	215032	223546	1987687		Planktothrix_phage(16.67%)	9	NA	NA
WP_005663823.1|215032_216016_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	1.8e-20
WP_013526031.1|216018_217011_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
WP_013526030.1|217020_217908_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013526029.1|217922_218894_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013526028.1|219013_221197_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	8.7e-116
WP_005653684.1|221180_221414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686506.1|221808_222444_-	7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	30.3	8.7e-16
WP_013526027.1|222444_222870_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.0	1.5e-19
WP_013526026.1|222862_223546_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.2	3.9e-54
>prophage 3
NZ_CP043772	Haemophilus influenzae biotype aegyptius strain HE24/F3037 chromosome, complete genome	1987687	333163	387261	1987687	bacteriocin,holin,tail,terminase,integrase,plate	Haemophilus_phage(41.51%)	73	332906:332922	382614:382630
332906:332922	attL	TCCAGCTAGTCGCACCA	NA	NA	NA	NA
WP_013525956.1|333163_334411_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	36.9	1.1e-73
WP_032826372.1|334407_334608_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_013525955.1|334846_335698_-	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	42.1	1.1e-53
WP_013525954.1|336028_336382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005684834.1|336368_336809_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	65.8	1.9e-49
WP_013525953.1|336952_337303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174939.1|337299_337536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005652248.1|337856_338036_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	62.1	1.8e-11
WP_013525952.1|338095_338530_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	35.1	1.3e-18
WP_013525951.1|338529_339174_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	71.4	1.5e-84
WP_013525950.1|339382_340066_-|bacteriocin	bacteriocin	bacteriocin	D0UIK6	Aggregatibacter_phage	81.9	2.5e-45
WP_086935072.1|340606_340780_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_013525949.1|340993_341506_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_013525948.1|341722_342529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174938.1|343054_343234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525947.1|343364_344309_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	68.8	2.2e-108
WP_013525946.1|344321_344615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525945.1|344611_344959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525944.1|345042_345681_-|bacteriocin	bacteriocin	bacteriocin	D0UIK6	Aggregatibacter_phage	73.7	1.1e-42
WP_041174937.1|345990_346083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525943.1|347453_348398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525942.1|348529_349222_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	35.5	1.7e-28
WP_041175006.1|349363_349576_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	48.5	4.8e-11
WP_005656655.1|349596_349893_+	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	2.0e-31
WP_013525941.1|349940_350609_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	53.0	2.4e-56
WP_138571565.1|350605_351364_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	68.3	1.3e-61
WP_013525940.1|351348_351990_+	replication P	NA	A0A1P8DTF3	Proteus_phage	33.3	3.6e-17
WP_041174936.1|351986_352211_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_013525939.1|352247_352664_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	84.7	4.7e-63
WP_013525938.1|352756_353299_+	hypothetical protein	NA	D0UIK8	Aggregatibacter_phage	67.2	2.6e-61
WP_005650528.1|353295_353667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174935.1|353766_353949_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_041174934.1|353980_354430_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_041174933.1|354474_354657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525936.1|355294_356194_+	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	53.7	1.5e-77
WP_013525935.1|357180_357537_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_013525934.1|357505_358108_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	53.4	3.7e-56
WP_041174932.1|358100_358424_+	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	54.2	7.8e-21
WP_013525933.1|358335_358617_+	hypothetical protein	NA	Q776X1	Haemophilus_phage	72.2	1.4e-29
WP_006996386.1|358618_358966_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	4.4e-22
WP_005693952.1|359263_359779_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	40.9	5.6e-21
WP_006996384.1|359765_361109_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	53.7	3.1e-124
WP_013525932.1|361110_362442_+	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	84.2	1.5e-211
WP_006996380.1|364182_364539_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_149998743.1|364600_365521_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	82.1	1.1e-99
WP_006996378.1|365533_365974_+	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	71.1	2.3e-47
WP_006996377.1|365983_366898_+	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	89.5	1.7e-150
WP_013525929.1|366907_367270_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	66.4	4.4e-33
WP_006996375.1|367270_367717_+	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	72.3	6.7e-55
WP_013525928.1|367713_368085_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	71.5	1.8e-45
WP_013525927.1|368149_368512_+	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	73.9	6.6e-45
WP_013525926.1|368516_370025_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	86.9	3.5e-249
WP_006996370.1|370269_370701_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	93.0	2.9e-71
WP_006996369.1|370700_371111_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	70.8	5.9e-50
WP_013525924.1|371261_373352_+	hypothetical protein	NA	Q7Y5T2	Haemophilus_phage	69.2	6.2e-212
WP_013525923.1|373357_374134_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	66.1	2.0e-83
WP_013525922.1|374139_374448_+	hypothetical protein	NA	D0UII0	Aggregatibacter_phage	80.4	1.9e-45
WP_041174930.1|374530_374710_+	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	94.9	1.9e-21
WP_013525921.1|374724_375597_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	86.6	2.7e-140
WP_013525920.1|375593_376238_+	hypothetical protein	NA	D0UIH7	Aggregatibacter_phage	79.9	1.2e-94
WP_013525919.1|376234_376588_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	87.8	4.8e-56
WP_013525918.1|376772_377291_+	hypothetical protein	NA	A0A0M4REH5	Salmonella_phage	52.0	9.8e-34
WP_013525917.1|377333_378476_+|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	87.1	1.6e-185
WP_005684190.1|378475_379051_+	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	79.1	3.5e-88
WP_013525916.1|379060_381304_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	65.8	7.9e-221
WP_013525647.1|381315_381918_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.0	2.6e-94
WP_013525915.1|381914_382406_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	60.4	3.8e-51
WP_006996123.1|384127_384598_-	hypothetical protein	NA	NA	NA	NA	NA
382614:382630	attR	TCCAGCTAGTCGCACCA	NA	NA	NA	NA
WP_011961987.1|384597_384831_+	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	68.9	2.1e-20
WP_013525911.1|384842_385550_+	hypothetical protein	NA	A0A0M3LSH7	Mannheimia_phage	55.2	9.9e-61
WP_013525910.1|385673_386090_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	68.6	4.8e-47
WP_074039950.1|386249_386426_+	peptidase	NA	NA	NA	NA	NA
WP_013525909.1|386463_387261_-|holin	LPS cholinephosphotransferase	holin	A0A1V0SD50	Indivirus	37.4	1.1e-07
>prophage 4
NZ_CP043772	Haemophilus influenzae biotype aegyptius strain HE24/F3037 chromosome, complete genome	1987687	504047	516157	1987687	tRNA	Acinetobacter_phage(42.86%)	10	NA	NA
WP_014550746.1|504047_505052_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	40.1	1.2e-51
WP_005650594.1|505569_506058_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_013525800.1|506073_506571_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_149998747.1|506746_507640_+	glycosyltransferase	NA	A7IW34	Paramecium_bursaria_Chlorella_virus	29.7	1.3e-17
WP_013525802.1|507745_509302_+	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	33.2	1.8e-22
WP_013525803.1|509314_509896_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	39.4	5.0e-34
WP_013525804.1|510384_511386_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.0	5.7e-46
WP_013525805.1|511422_512856_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	38.0	3.6e-33
WP_013525806.1|512986_513253_+	hydrogenase maturation factor HybG	NA	NA	NA	NA	NA
WP_013525807.1|513292_516157_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.7	9.3e-150
>prophage 5
NZ_CP043772	Haemophilus influenzae biotype aegyptius strain HE24/F3037 chromosome, complete genome	1987687	791204	916313	1987687	head,holin,tail,portal,terminase,integrase,transposase,capsid,plate,tRNA	Haemophilus_virus(26.44%)	141	797192:797218	906399:906425
WP_005657715.1|791204_791705_-	hypothetical protein	NA	A0A0M3LPN5	Mannheimia_phage	44.0	6.4e-14
WP_005660793.1|791915_792143_+	DNA-binding protein	NA	A0A0M3LPY8	Mannheimia_phage	69.0	2.1e-20
WP_013525667.1|792153_794163_+|transposase	transposase	transposase	A0A0C4UR24	Shigella_phage	37.7	6.6e-102
WP_041174903.1|795105_795309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525664.1|795330_795849_+	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	58.1	5.4e-48
WP_041174902.1|795953_796151_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041174901.1|796315_796534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525663.1|796606_796981_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	51.2	5.3e-29
WP_041174900.1|796981_797212_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	38.0	5.5e-05
797192:797218	attL	CCACAACCACCGGAGGAATAAATTATG	NA	NA	NA	NA
WP_041174899.1|797215_797503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658929.1|797612_798101_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	31.7	4.8e-14
WP_005658927.1|798104_798479_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	46.2	1.9e-23
WP_005658925.1|798552_798972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525661.1|799058_799595_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.0	7.2e-72
WP_041174898.1|799834_800065_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	69.3	4.4e-18
WP_149998754.1|800061_800319_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_005658911.1|800442_800751_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	39.4	6.3e-12
WP_005658909.1|800747_801050_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	52.0	3.1e-24
WP_005658907.1|801059_801608_+	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	40.3	5.9e-29
WP_005658905.1|801591_802914_+|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	64.2	1.8e-148
WP_013525659.1|802915_804331_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	45.0	1.3e-112
WP_013525658.1|804331_805609_+	mu gp30-like protein	NA	J9STS2	Pseudomonas_phage	47.6	2.8e-53
WP_041174897.1|805795_805984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005661604.1|806186_806687_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	34.6	4.3e-18
WP_013525657.1|806929_808033_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	39.2	1.2e-65
WP_013525656.1|808051_808978_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	1.0e-73
WP_013525655.1|809043_809361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658887.1|809360_809795_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	36.4	4.4e-19
WP_005658884.1|809806_810304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005661612.1|810313_811699_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	44.3	5.2e-98
WP_013525654.1|811709_812228_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.6	1.1e-37
WP_005640664.1|812321_812606_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_086935107.1|812583_812736_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_041174896.1|812720_813035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525653.1|813080_815672_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.6	1.7e-41
WP_013525652.1|815671_816604_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	30.3	4.2e-19
WP_016533315.1|816584_816815_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	47.8	7.2e-13
WP_013525651.1|816807_817872_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	38.6	6.7e-61
WP_005658861.1|817858_818467_+|plate	phage baseplate assembly protein V	plate	R9U0U6	Rhizobium_phage	30.9	5.2e-10
WP_013525650.1|818521_818887_+|plate	phage baseplate protein	plate	Q6QIA0	Burkholderia_phage	43.4	3.6e-14
WP_013525649.1|818886_819993_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.8	5.9e-60
WP_005658855.1|819985_820555_+|tail	tail fiber protein	tail	A4JWL7	Burkholderia_virus	45.3	4.5e-40
WP_013525648.1|820586_822296_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	65.9	2.2e-154
WP_013525647.1|822307_822910_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.0	2.6e-94
WP_013525646.1|822906_823407_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	60.4	8.5e-51
WP_041174895.1|823582_823702_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013525645.1|823758_824604_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	71.7	4.0e-117
WP_041174894.1|824643_824907_-	hypothetical protein	NA	F6MIM3	Haemophilus_phage	76.7	7.2e-33
WP_149998755.1|825754_827110_-	two-component system sensor histidine kinase QseC	NA	W8CYF6	Bacillus_phage	25.8	3.9e-13
WP_006995784.1|827106_827769_-	response regulator	NA	NA	NA	NA	NA
WP_149998756.1|827805_828183_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	34.2	8.0e-09
WP_111723596.1|828297_828480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005654343.1|828683_829184_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_013525641.1|829243_830971_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	NA	NA	NA	NA
WP_013525640.1|831050_831308_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013525639.1|831466_832507_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_013525638.1|832577_833126_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	4.5e-29
WP_013525637.1|833431_834499_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_013525636.1|834573_837165_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_005649958.1|837258_838065_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_005670302.1|838200_838545_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	48.6	1.7e-26
WP_010869281.1|838546_838900_+	YacL family protein	NA	NA	NA	NA	NA
WP_013525634.1|838906_841255_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_005688052.1|841420_842293_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.0	1.1e-50
WP_005688053.1|842448_843783_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	79.4	8.4e-53
WP_005688055.1|843853_845047_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_005688057.1|845090_845828_-	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_013525633.1|845814_846744_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_013525632.1|846740_847382_-	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_041174892.1|847614_848487_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_013525631.1|848464_850444_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	26.0	3.1e-27
WP_005649928.1|850525_851314_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013525630.1|851492_853076_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	25.8	7.4e-32
WP_005632089.1|853151_853385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525629.1|853487_853817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005665596.1|853813_854548_-	azaleucine resistance protein AzlC	NA	NA	NA	NA	NA
WP_005654899.1|854557_855487_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013525628.1|861692_863828_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.5	1.3e-18
WP_013525627.1|864221_865331_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_005690258.1|865315_866101_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	A0A291ATS8	Pandoravirus	28.9	1.5e-17
WP_013525626.1|866278_867286_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_005653606.1|867335_867842_-	DUF2301 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_013525625.1|867954_869316_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_013525624.1|869700_870891_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_005658075.1|871165_871723_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_013525435.1|872720_874322_-	hypothetical protein	NA	Q94MX6	Haemophilus_virus	98.7	4.0e-283
WP_013525436.1|874322_874883_-	hypothetical protein	NA	Q94MX7	Haemophilus_virus	97.3	3.6e-82
WP_041174878.1|874869_875637_-	hypothetical protein	NA	Q94MX8	Haemophilus_virus	98.8	7.3e-134
WP_013525438.1|875655_875925_-	hypothetical protein	NA	Q776W9	Haemophilus_phage	74.4	5.3e-31
WP_013525439.1|875903_876518_-	hypothetical protein	NA	F6MIL9	Haemophilus_phage	57.1	8.7e-13
WP_013525440.1|876596_876875_+	peptidase	NA	A0A2L1IV28	Escherichia_phage	45.7	1.8e-18
WP_050780969.1|876891_877203_+	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	44.6	1.2e-07
WP_149998757.1|879956_880481_-|tail	phage tail protein	tail	Q94MY1	Haemophilus_virus	98.3	2.7e-95
WP_149998758.1|880490_881660_-	hypothetical protein	NA	Q94MY2	Haemophilus_virus	97.9	3.4e-215
WP_149998759.1|881652_881988_-	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	97.3	4.4e-51
WP_013525447.1|884452_884761_-	hypothetical protein	NA	Q775G2	Haemophilus_virus	98.0	3.5e-47
WP_013525448.1|884941_885289_-	hypothetical protein	NA	Q94MY5	Haemophilus_virus	89.6	3.0e-47
WP_013525449.1|885273_885834_-	lysozyme	NA	Q94MY6	Haemophilus_virus	92.7	2.5e-91
WP_041174879.1|885826_886063_-|holin	holin	holin	Q94MY7	Haemophilus_virus	97.4	5.3e-35
WP_013525450.1|886149_886602_-	DUF2597 family protein	NA	Q94MY8	Haemophilus_virus	95.8	1.2e-72
WP_013525451.1|886605_887736_-	DUF2586 domain-containing protein	NA	Q94MY9	Haemophilus_virus	97.3	2.1e-214
WP_013525452.1|887997_888723_-	phage virion morphogenesis protein	NA	Q1I0Z5	Pasteurella_virus	32.1	1.8e-17
WP_138571532.1|888719_889184_-|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	62.7	1.1e-52
WP_013525454.1|889189_889642_-|head	head completion/stabilization protein	head	Q94MZ2	Haemophilus_virus	96.7	3.4e-75
WP_013525456.1|890493_891504_-|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	94.9	1.4e-180
WP_013525457.1|891507_892395_-|capsid	phage capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	68.0	4.0e-91
WP_013525459.1|894392_895427_+|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	98.6	6.9e-196
WP_013525460.1|895508_895769_+	ogr/Delta-like zinc finger family protein	NA	Q1I103	Pasteurella_virus	52.4	4.3e-22
WP_013525461.1|895799_896207_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	66.7	4.7e-47
WP_041174880.1|896270_896450_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	72.9	2.2e-17
WP_013525462.1|896529_897048_-	phage N-6-adenine-methyltransferase	NA	Q94MZ8	Haemophilus_virus	97.0	1.0e-94
WP_013525463.1|897057_897363_-	hypothetical protein	NA	Q94MZ9	Haemophilus_virus	78.8	5.8e-34
WP_013525464.1|897374_899714_-	replication endonuclease	NA	Q94N00	Haemophilus_virus	94.1	0.0e+00
WP_013525465.1|899774_900110_-	hypothetical protein	NA	P79676	Haemophilus_phage	94.6	1.6e-56
WP_013525466.1|900128_900632_-	hypothetical protein	NA	P79675	Haemophilus_phage	91.6	5.7e-79
WP_041174881.1|900764_901004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174882.1|901000_901192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525467.1|901314_901689_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_041174883.1|902033_902276_+	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	59.5	6.0e-18
WP_041174884.1|902275_902479_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_041174885.1|902515_902743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174886.1|902742_903036_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013525469.1|903038_904052_+|integrase	site-specific integrase	integrase	P79671	Haemophilus_phage	96.1	2.2e-186
WP_005641600.1|904596_905622_-|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.4	7.4e-57
WP_005651299.1|905519_905834_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013525623.1|905963_906401_-	hypothetical protein	NA	A0A2K9V3W6	Faecalibacterium_phage	37.6	2.0e-24
WP_005668271.1|906404_906674_-	hypothetical protein	NA	NA	NA	NA	NA
906399:906425	attR	CATAATTTATTCCTCCGGTGGTTGTGG	NA	NA	NA	NA
WP_041174991.1|906938_907427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651292.1|907543_907960_-	hypothetical protein	NA	E5EYK4	Acinetobacter_phage	35.9	1.1e-08
WP_012054998.1|908007_909282_-	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	46.9	7.7e-96
WP_013525621.1|909289_909649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525620.1|909645_909882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525619.1|909878_910448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149998760.1|910726_911749_-	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	56.4	1.6e-32
WP_149998761.1|911810_912245_-	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	5.7e-19
WP_005668703.1|912244_912895_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	70.2	1.0e-83
WP_011272494.1|912869_913790_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	71.5	4.8e-116
WP_012054992.1|913802_914096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149998762.1|914092_914440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651093.1|914453_915191_-	site-specific DNA-methyltransferase	NA	A0A0E3U2R2	Fusobacterium_phage	77.5	5.2e-113
WP_013525612.1|915281_916313_-	endonuclease	NA	D0UIK6	Aggregatibacter_phage	82.8	5.2e-42
>prophage 6
NZ_CP043772	Haemophilus influenzae biotype aegyptius strain HE24/F3037 chromosome, complete genome	1987687	919645	957400	1987687	head,tail,terminase,plate,tRNA	Pseudomonas_phage(15.62%)	50	NA	NA
WP_013525608.1|919645_920233_-	recombinase NinG	NA	A0A2I7RAC0	Vibrio_phage	48.5	1.7e-37
WP_005651114.1|920325_920742_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	84.7	1.1e-62
WP_005633909.1|920778_921003_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_149998764.1|920999_921641_-	replication P	NA	A0A1P8DTF3	Proteus_phage	32.9	5.1e-16
WP_149998765.1|921625_922453_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	48.7	4.3e-39
WP_005651121.1|922454_922688_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	58.9	1.9e-13
WP_005651123.1|922733_923186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995067.1|923229_923436_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006995066.1|923569_924538_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	30.5	7.0e-17
WP_005651127.1|924731_925058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005692586.1|925044_925449_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	66.4	2.2e-44
WP_005651133.1|925445_925835_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_005651135.1|925809_926040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012054986.1|926051_927407_+	ParB N-terminal domain-containing protein	NA	A0A0E3U266	Fusobacterium_phage	44.8	1.8e-98
WP_005651141.1|927403_927625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651145.1|927682_928051_+	LuxR family transcriptional regulator	NA	A0A0R6PHW5	Moraxella_phage	39.3	3.4e-12
WP_149998792.1|928031_929381_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.7	1.6e-144
WP_005651149.1|929382_930699_+	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	32.2	1.4e-47
WP_149998793.1|930679_931897_+|head	phage head morphogenesis protein	head	I3PGT9	Xanthomonas_phage	36.0	1.8e-33
WP_149998766.1|932022_933096_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.2	7.2e-55
WP_005643361.1|933108_933528_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_041174811.1|933535_934537_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	36.2	8.5e-50
WP_005692571.1|934539_934728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005692569.1|934731_935082_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_012054983.1|935074_935533_+	hypothetical protein	NA	A0A2I7R754	Vibrio_phage	35.2	3.7e-16
WP_005692565.1|935532_935892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005692563.1|935893_936403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005692561.1|936389_937463_+	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	36.0	5.0e-64
WP_005643344.1|937508_937934_+	DUF3277 family protein	NA	A0A2K9V3K6	Faecalibacterium_phage	45.9	4.0e-25
WP_013525589.1|937933_938416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149998767.1|938600_940931_+	tape measure protein	NA	K7RVL7	Vibrio_phage	29.0	2.6e-33
WP_006995044.1|941005_941578_-	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	52.3	3.3e-14
WP_006995043.1|941885_942467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005643334.1|942463_942778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006995042.1|942774_943737_+	hypothetical protein	NA	A0A0N9RT60	Pseudomonas_phage	34.4	9.7e-35
WP_149998768.1|943733_944405_+|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	33.0	2.9e-17
WP_149998769.1|944401_944767_+	hypothetical protein	NA	K4RI30	Pseudomonas_phage	31.1	7.0e-10
WP_126513638.1|944759_946196_+	hypothetical protein	NA	E5AGC3	Erwinia_phage	29.0	1.2e-44
WP_149998770.1|946204_946819_+	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	36.9	5.1e-21
WP_149998771.1|946828_949198_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	60.0	1.9e-212
WP_013525580.1|949209_949812_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	94.5	5.0e-98
WP_013525579.1|949808_950267_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.8	4.9e-45
WP_005691741.1|950914_951640_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_013525578.1|951692_952145_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_013525577.1|952212_953427_+	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	36.0	5.1e-33
WP_005691745.1|953450_953867_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.6	2.0e-53
WP_005688927.1|953924_954248_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.8	1.3e-23
WP_005662651.1|954260_954785_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_013525576.1|954835_955522_+	DUF2625 domain-containing protein	NA	NA	NA	NA	NA
WP_013525575.1|955540_957400_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.5	1.4e-109
>prophage 7
NZ_CP043772	Haemophilus influenzae biotype aegyptius strain HE24/F3037 chromosome, complete genome	1987687	1029600	1033362	1987687		uncultured_virus(100.0%)	7	NA	NA
WP_013525530.1|1029600_1029807_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.5e-09
WP_005666693.1|1029880_1030087_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.1e-09
WP_005666693.1|1030172_1030379_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.1e-09
WP_005666693.1|1030452_1030659_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.1e-09
WP_005666693.1|1030732_1030939_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.1e-09
WP_005666693.1|1031012_1031219_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.7	1.1e-09
WP_013525529.1|1031193_1033362_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	51.4	2.0e-192
>prophage 8
NZ_CP043772	Haemophilus influenzae biotype aegyptius strain HE24/F3037 chromosome, complete genome	1987687	1159266	1168612	1987687	tRNA	Faustovirus(16.67%)	10	NA	NA
WP_081457578.1|1159266_1160412_+	methionine biosynthesis PLP-dependent protein	NA	A0A141ZJM2	Faustovirus	26.5	3.6e-12
WP_013525433.1|1160424_1161420_+	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	39.6	6.4e-66
WP_013525432.1|1161539_1161863_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.4	2.2e-15
WP_013525431.1|1161912_1162185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174877.1|1162195_1162453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525430.1|1162514_1163303_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_013525429.1|1163357_1163867_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	32.9	5.5e-13
WP_011271818.1|1163969_1165349_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.7	8.7e-53
WP_011271817.1|1165509_1166370_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_013525428.1|1166488_1168612_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.2	6.9e-259
>prophage 9
NZ_CP043772	Haemophilus influenzae biotype aegyptius strain HE24/F3037 chromosome, complete genome	1987687	1967254	1982973	1987687	head,tail,terminase	Haemophilus_phage(52.94%)	25	NA	NA
WP_005647090.1|1967254_1967446_+	HTH domain-containing protein	NA	F6MII8	Haemophilus_phage	57.6	9.5e-11
WP_013526168.1|1967446_1968064_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	58.8	6.8e-66
WP_006996621.1|1968250_1968448_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006996623.1|1968619_1968793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006996624.1|1968797_1969046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013526167.1|1969286_1969685_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	45.1	2.8e-20
WP_006996626.1|1969711_1969915_+	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_013526166.1|1970451_1971093_+	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	41.8	3.7e-22
WP_005641522.1|1971103_1971322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174961.1|1971446_1971623_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	87.9	5.9e-23
WP_013526165.1|1971677_1972094_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	75.2	3.8e-52
WP_013526164.1|1972205_1972634_+	hypothetical protein	NA	F6MIJ8	Haemophilus_phage	42.3	2.5e-27
WP_013526163.1|1972714_1973218_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	63.1	4.9e-54
WP_041174960.1|1973371_1973662_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	61.4	3.3e-15
WP_013526161.1|1973661_1973919_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_005684166.1|1974042_1974300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005661915.1|1974299_1974566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013526160.1|1974567_1975068_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	51.8	4.1e-45
WP_013526159.1|1975217_1976867_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	79.7	1.1e-248
WP_013526158.1|1978551_1979868_+|head	head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	67.7	2.0e-168
WP_013526157.1|1980010_1980364_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	67.9	3.1e-23
WP_086935082.1|1980251_1981241_+	I protein	NA	A0A0M3LPA7	Mannheimia_phage	45.6	5.8e-67
WP_013526155.1|1981240_1982161_+|tail	tail sheath protein	tail	A0A0M3LQ11	Mannheimia_phage	62.9	1.0e-110
WP_013526154.1|1982196_1982532_+	hypothetical protein	NA	B7SDP3	Haemophilus_phage	55.4	4.4e-19
WP_013526153.1|1982541_1982973_+	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	61.6	1.2e-37
