The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043810	Haemophilus influenzae biotype aegyptius strain HE37/F3052 chromosome, complete genome	1877864	212181	276295	1877864	head,plate,holin,terminase,tail	Haemophilus_phage(44.0%)	76	NA	NA
WP_150007515.1|212181_212979_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	53.3	5.4e-07
WP_150007516.1|213016_214867_-	signal peptide peptidase SppA	NA	A0A2I6UG67	Salinibacter_virus	28.1	6.2e-14
WP_150007517.1|214963_215518_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_005667044.1|215565_216120_-	molecular chaperone	NA	NA	NA	NA	NA
WP_150007518.1|216119_216728_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_150007519.1|216848_218093_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_150007520.1|218377_218818_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_150007521.1|218887_219976_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.9	7.8e-81
WP_013527725.1|220193_221444_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_013527726.1|221443_222127_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.1	7.4e-37
WP_150007522.1|222208_222850_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_150007523.1|222859_223642_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_150007524.1|223629_224277_-	DUF452 family protein	NA	NA	NA	NA	NA
WP_150007525.1|224286_225429_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_150007526.1|225437_226730_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_006996103.1|226741_227923_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006996104.1|227922_228870_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	31.5	2.3e-28
WP_006996106.1|229800_230604_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006996107.1|230603_231482_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006996108.1|231481_231952_-	RDD family protein	NA	NA	NA	NA	NA
WP_150007527.1|233337_234105_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_006996113.1|234292_234952_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_006996114.1|235150_235687_-	transporting ATPase	NA	NA	NA	NA	NA
WP_032826285.1|235753_235882_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_150007528.1|236203_237163_+	phosphotransferase	NA	NA	NA	NA	NA
WP_150007514.1|238038_238740_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_150007515.1|238739_239537_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	53.3	5.4e-07
WP_074039950.1|239574_239751_-	peptidase	NA	NA	NA	NA	NA
WP_013527737.1|239911_240328_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	71.0	1.9e-51
WP_150007529.1|240470_241187_-	hypothetical protein	NA	A0A0M3LSH7	Mannheimia_phage	57.7	1.5e-69
WP_011961987.1|241198_241432_-	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	68.9	2.1e-20
WP_150007530.1|241431_241902_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_150007531.1|243623_244115_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	60.4	8.4e-51
WP_013527351.1|244111_244714_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.5	1.2e-94
WP_150007532.1|244725_246975_-|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	65.8	3.2e-222
WP_006996360.1|246984_247560_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	80.1	2.4e-89
WP_006996361.1|247559_248702_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	86.3	6.7e-184
WP_006996362.1|248797_249151_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	89.6	2.5e-57
WP_150007533.1|249147_249792_-|plate	baseplate protein	plate	Q7Y5S7	Haemophilus_phage	84.6	8.9e-85
WP_006996364.1|249788_250673_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	89.5	1.9e-141
WP_013527742.1|250927_251236_-	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	82.4	7.8e-47
WP_006996366.1|251241_252024_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	65.5	1.0e-82
WP_006996369.1|254272_254683_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	70.8	5.9e-50
WP_006996370.1|254682_255114_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	93.0	2.9e-71
WP_006996372.1|255358_256867_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	86.9	4.6e-249
WP_006996374.1|257300_257672_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	70.7	6.8e-45
WP_006996375.1|257668_258115_-	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	72.3	6.7e-55
WP_006996376.1|258115_258478_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	67.3	1.5e-33
WP_150007534.1|258487_259402_-	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	89.8	6.0e-151
WP_006996378.1|259411_259852_-	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	71.1	2.3e-47
WP_150007535.1|259864_260965_-	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	86.5	3.7e-139
WP_065250978.1|261028_261385_-	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	28.9	5.0e-05
WP_150007536.1|261663_263097_-|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	76.7	3.9e-88
WP_150007537.1|263125_264457_-	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	84.2	2.0e-211
WP_006996384.1|264458_265802_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	53.7	3.1e-124
WP_005693952.1|265788_266304_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	40.9	5.6e-21
WP_006996385.1|266380_266632_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	50.6	6.4e-15
WP_006996386.1|266615_266963_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	4.4e-22
WP_013527746.1|266964_267246_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	74.4	2.5e-31
WP_006996388.1|267157_267481_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	56.5	4.5e-21
WP_006996389.1|267473_268076_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	53.9	5.6e-57
WP_005650535.1|268044_268401_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_006996390.1|268616_269486_-	phage repressor protein/antirepressor Ant	NA	D0UIK6	Aggregatibacter_phage	66.9	4.6e-108
WP_005687174.1|270083_270266_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	45.5	1.2e-05
WP_006996391.1|270310_270760_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_150007538.1|270791_270974_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_006996392.1|271074_271443_-	hypothetical protein	NA	Q7Y5V5	Haemophilus_phage	63.4	6.1e-38
WP_150007539.1|271444_271993_-	recombination protein NinG	NA	D0UIK8	Aggregatibacter_phage	62.0	5.1e-57
WP_150007540.1|272081_272501_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	75.9	2.5e-56
WP_005633909.1|272537_272762_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_065246949.1|272758_273400_-	replication P	NA	A0A1P8DTF3	Proteus_phage	32.9	5.1e-16
WP_118879936.1|273384_274143_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	68.8	4.8e-61
WP_038441201.1|274139_274814_-	antirepressor	NA	D0UIL6	Aggregatibacter_phage	68.4	1.1e-80
WP_048950185.1|274862_275303_-	hypothetical protein	NA	A0A0U4B0E3	Pseudomonas_phage	32.6	8.1e-13
WP_005655320.1|275357_275540_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	51.7	1.6e-10
WP_044332609.1|275641_276295_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.0	1.2e-31
>prophage 2
NZ_CP043810	Haemophilus influenzae biotype aegyptius strain HE37/F3052 chromosome, complete genome	1877864	1069065	1201374	1877864	integrase,tRNA,plate,head,protease,capsid,portal,terminase,lysis,tail	Mannheimia_phage(37.5%)	111	1125943:1126002	1160131:1160191
WP_006995287.1|1069065_1070022_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.8	1.9e-06
WP_006995288.1|1070021_1071377_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_150007689.1|1071389_1072766_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_006995290.1|1072839_1073226_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_006995291.1|1073315_1073573_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_006995292.1|1073681_1074251_+	RNA polymerase sigma factor RpoE	NA	A0A076YQ50	Rhizobium_phage	28.1	1.6e-05
WP_006995293.1|1074275_1074863_+	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_013527376.1|1074942_1075890_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_005655205.1|1075980_1076904_-	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_032826249.1|1079732_1080722_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_013527375.1|1080770_1081061_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_150007690.1|1081083_1082088_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005688125.1|1082216_1082834_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_006995300.1|1082856_1084227_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.0	1.5e-113
WP_005626605.1|1084498_1084990_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_013527374.1|1085044_1085416_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_012055142.1|1086989_1087301_-	DUF5389 family protein	NA	NA	NA	NA	NA
WP_013527372.1|1088001_1090479_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.8	1.8e-77
WP_013527371.1|1090507_1091608_-	cytochrome C nitrate reductase	NA	NA	NA	NA	NA
WP_041175151.1|1091765_1092707_-	alpha/beta hydrolase	NA	Q0NQ37	Cowpox_virus	23.7	2.2e-07
WP_006995304.1|1092761_1093877_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_006995305.1|1094035_1094752_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.5	1.3e-15
WP_006995306.1|1094903_1096241_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_081457550.1|1096303_1096756_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006995308.1|1097146_1099159_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	39.8	6.0e-119
WP_005654525.1|1099164_1099377_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_150007691.1|1101191_1101956_+	glycosyltransferase	NA	A0A1V0SAJ8	Catovirus	31.5	1.3e-05
WP_150007692.1|1101952_1102516_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005658635.1|1102630_1103383_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	47.3	7.3e-54
WP_006995320.1|1113421_1114354_-	carbamate kinase	NA	NA	NA	NA	NA
WP_006995321.1|1114363_1115368_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_150007693.1|1115770_1116589_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005692779.1|1116588_1116975_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	38.0	1.7e-06
WP_006995323.1|1116971_1117430_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005654959.1|1117509_1118574_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.2	2.6e-113
WP_006995324.1|1118946_1119600_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
1125943:1126002	attL	CTCCAAAACCGGGTGTTGGGAGTTCGAGCCTCTCCGCCCCTGCCATAAAAAACCTTTCAT	NA	NA	NA	NA
WP_013527358.1|1126004_1127060_-|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	36.2	2.2e-56
WP_005668391.1|1126969_1127302_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005668393.1|1127298_1127820_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	42.4	7.3e-29
WP_005668395.1|1127833_1128043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005668397.1|1128053_1128245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150007694.1|1128263_1130450_-	replication endonuclease	NA	Q94N00	Haemophilus_virus	42.5	7.1e-166
WP_005655052.1|1130459_1130768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005668404.1|1130893_1131136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995328.1|1131139_1131520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005655063.1|1131899_1132142_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	68.1	1.2e-21
WP_032826251.1|1132204_1132546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527354.1|1132910_1133159_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	44.4	1.5e-08
WP_006995332.1|1133278_1133968_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	34.9	1.0e-30
WP_006995333.1|1133977_1135147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668419.1|1135157_1135397_+	nuclease	NA	Q19UP2	Mannheimia_phage	40.5	6.6e-09
WP_150007695.1|1135422_1136616_-	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	50.8	7.4e-101
WP_006995336.1|1136615_1137053_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	56.7	1.0e-39
WP_006995339.1|1137381_1137528_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	65.0	2.2e-07
WP_150007696.1|1137527_1137827_-|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	42.9	2.7e-12
WP_150007697.1|1137895_1138402_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	58.9	4.6e-52
WP_006995341.1|1138405_1139590_-|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	48.7	6.0e-103
WP_006995342.1|1140034_1140880_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	72.8	2.3e-120
WP_005641687.1|1140936_1141056_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_150007698.1|1141231_1141732_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	60.4	3.2e-50
WP_013527351.1|1141728_1142331_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.5	1.2e-94
WP_150007699.1|1142342_1144595_-|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	59.7	1.1e-190
WP_150007848.1|1144603_1145140_-|tail	phage tail protein I	tail	M1T2R2	Escherichia_phage	53.1	5.4e-51
WP_150007700.1|1145129_1146044_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	59.9	2.3e-94
WP_005663412.1|1146040_1146379_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	56.6	4.5e-19
WP_005668437.1|1146380_1146980_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	66.0	7.1e-44
WP_150007701.1|1147080_1147533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150007702.1|1147754_1150454_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	32.2	1.3e-89
WP_105882170.1|1150524_1150785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150007703.1|1150762_1151221_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	51.1	3.5e-27
WP_150007704.1|1151220_1151691_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	45.3	5.6e-28
WP_005633796.1|1151687_1151903_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	47.9	1.4e-10
WP_105896747.1|1151899_1152163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005689812.1|1152077_1152428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150007705.1|1152412_1152931_-	glycoside hydrolase family protein	NA	A0A0M3LPQ1	Mannheimia_phage	47.1	1.1e-37
WP_150007706.1|1152923_1153145_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_021035391.1|1153146_1153356_-	hypothetical protein	NA	A0A0M3LPY0	Mannheimia_phage	43.8	1.0e-10
WP_105875356.1|1153355_1153862_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	50.7	6.2e-33
WP_150007707.1|1154107_1154758_-|terminase	terminase	terminase	Q19US0	Mannheimia_phage	45.5	2.0e-44
WP_150007708.1|1154769_1155819_-|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	51.6	9.7e-89
WP_150007709.1|1155840_1156665_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	60.2	1.0e-64
WP_150007710.1|1156829_1158611_+|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	65.4	2.2e-218
WP_065250678.1|1158620_1159631_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	61.2	2.3e-119
WP_006995369.1|1160905_1162192_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
1160131:1160191	attR	CTCCAAAACCGGGTGTTGGGAGTTCGAGCCTCTCCGCCCCTGCCATAAAAAACCTTTCATT	NA	NA	NA	NA
WP_150007711.1|1162202_1163414_-	HemX protein	NA	NA	NA	NA	NA
WP_006995371.1|1163718_1166250_+	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_006995372.1|1166323_1167331_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005694542.1|1167347_1168151_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006995373.1|1168160_1168976_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_005654480.1|1170636_1171485_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	6.1e-33
WP_005668621.1|1172012_1173299_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_006995376.1|1173337_1173988_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005648572.1|1174007_1174442_-	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_006995378.1|1175937_1177707_-	L-fucose isomerase	NA	NA	NA	NA	NA
WP_005661551.1|1177936_1178686_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_150007712.1|1178883_1181655_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.4	1.5e-19
WP_006995380.1|1181657_1182317_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_006995381.1|1182343_1182922_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005672324.1|1182951_1183719_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005654466.1|1184020_1184842_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_006995384.1|1184880_1185570_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013527340.1|1185559_1186597_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.5	1.2e-33
WP_006996628.1|1186772_1187327_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_006995387.1|1193615_1193894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006995388.1|1194007_1194568_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_005648547.1|1194571_1195012_+	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_005652269.1|1195073_1195700_-	response regulator	NA	NA	NA	NA	NA
WP_150007713.1|1197190_1197307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150007714.1|1197404_1197710_+	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_150007715.1|1197711_1199571_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.3	1.7e-88
WP_006995391.1|1199655_1201374_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043810	Haemophilus influenzae biotype aegyptius strain HE37/F3052 chromosome, complete genome	1877864	1534950	1544299	1877864	tRNA	Faustovirus(16.67%)	9	NA	NA
WP_081457578.1|1534950_1536096_+	methionine biosynthesis PLP-dependent protein	NA	A0A141ZJM2	Faustovirus	26.5	3.6e-12
WP_006995684.1|1536108_1537104_+	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	39.6	1.1e-65
WP_005689970.1|1537223_1537547_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.4	9.8e-16
WP_032826269.1|1537605_1537872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995686.1|1537882_1538140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995687.1|1538201_1538990_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005652519.1|1539044_1539554_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	32.9	7.2e-13
WP_006995688.1|1539656_1541036_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.7	3.9e-53
WP_006995691.1|1542175_1544299_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.1	2.0e-258
>prophage 4
NZ_CP043810	Haemophilus influenzae biotype aegyptius strain HE37/F3052 chromosome, complete genome	1877864	1634048	1638992	1877864		Haemophilus_phage(50.0%)	11	NA	NA
WP_006995453.1|1634048_1634447_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	45.1	2.8e-20
WP_006996626.1|1634473_1634677_+	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_013527863.1|1635149_1635791_+	hypothetical protein	NA	A0A0A7RVQ9	Clostridium_phage	38.7	1.4e-10
WP_005641522.1|1635801_1636020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006995448.1|1636125_1636554_+	hypothetical protein	NA	F6MIJ8	Haemophilus_phage	42.3	3.3e-27
WP_013527862.1|1636635_1637139_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	64.4	5.8e-55
WP_041174960.1|1637292_1637583_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	61.4	3.3e-15
WP_013527861.1|1637582_1637840_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_005684166.1|1637963_1638221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006995441.1|1638220_1638487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527860.1|1638488_1638992_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	51.8	4.1e-45
>prophage 5
NZ_CP043810	Haemophilus influenzae biotype aegyptius strain HE37/F3052 chromosome, complete genome	1877864	1642451	1646874	1877864	head	Mannheimia_phage(50.0%)	6	NA	NA
WP_150007790.1|1642451_1643768_+|head	phage head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	68.0	1.6e-168
WP_150007791.1|1643910_1644066_+	G protein	NA	B7SDN8	Haemophilus_phage	61.2	2.3e-07
WP_041174959.1|1644137_1645142_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	46.2	1.4e-68
WP_150007792.1|1645141_1646062_+|head	head protein	head	A0A0M3LQ11	Mannheimia_phage	62.9	7.9e-111
WP_013526154.1|1646097_1646433_+	hypothetical protein	NA	B7SDP3	Haemophilus_phage	55.4	4.4e-19
WP_150007793.1|1646442_1646874_+	DUF1320 family protein	NA	B7SDP4	Haemophilus_phage	61.6	1.2e-37
