The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043770	Haemophilus influenzae biotype aegyptius strain HE7/F1946 chromosome, complete genome	1985844	78485	86999	1985844		Bacillus_virus(33.33%)	9	NA	NA
WP_005663823.1|78485_79469_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	3.2e-17
WP_013526031.1|79471_80464_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
WP_013526030.1|80473_81361_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013526029.1|81375_82347_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013526028.1|82466_84650_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	8.7e-116
WP_005653684.1|84633_84867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686506.1|85261_85897_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	35.2	2.9e-11
WP_013526027.1|85897_86323_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.0	1.5e-19
WP_013526026.1|86315_86999_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.2	3.9e-54
>prophage 2
NZ_CP043770	Haemophilus influenzae biotype aegyptius strain HE7/F1946 chromosome, complete genome	1985844	185402	251027	1985844	integrase,holin,terminase,tRNA,plate,tail,bacteriocin	Haemophilus_phage(37.29%)	82	177317:177334	258048:258065
177317:177334	attL	GAAAATTGACCGCACTTT	NA	NA	NA	NA
WP_013525963.1|185402_187136_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	35.0	1.8e-87
WP_006996419.1|187215_187785_+	VOC family protein	NA	NA	NA	NA	NA
WP_006996418.1|187790_188087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525962.1|188112_188577_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_013525961.1|188761_189727_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	27.0	2.0e-11
WP_013525960.1|190377_192027_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_013525959.1|192123_193206_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.9	2.7e-33
WP_080452416.1|193215_194730_-	replicative DNA helicase	NA	O80281	Escherichia_phage	68.3	6.2e-169
WP_005653307.1|194763_196200_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_013525956.1|196748_197996_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	36.9	1.1e-73
WP_032826372.1|197992_198193_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_013525955.1|198431_199283_-	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	42.1	1.1e-53
WP_013525954.1|199613_199967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005684834.1|199953_200394_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	65.8	1.9e-49
WP_013525953.1|200537_200888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174939.1|200884_201121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005652248.1|201441_201621_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	62.1	1.8e-11
WP_013525952.1|201680_202115_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	35.1	1.3e-18
WP_013525951.1|202114_202759_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	71.4	1.5e-84
WP_013525950.1|202967_203651_-|bacteriocin	bacteriocin	bacteriocin	D0UIK6	Aggregatibacter_phage	81.9	2.5e-45
WP_086935072.1|204191_204365_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_013525949.1|204578_205091_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_013525948.1|205307_206114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174938.1|206639_206819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525947.1|206949_207894_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	68.8	2.2e-108
WP_013525946.1|207906_208200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525945.1|208196_208544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525944.1|208627_209266_-|bacteriocin	bacteriocin	bacteriocin	D0UIK6	Aggregatibacter_phage	73.7	1.1e-42
WP_041174937.1|209575_209668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525943.1|211039_211984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525942.1|212115_212808_-	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	31.2	9.2e-19
WP_041175006.1|212949_213162_+	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	51.5	8.1e-11
WP_005656655.1|213182_213479_+	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	70.4	2.0e-31
WP_013525941.1|213526_214195_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	53.0	2.4e-56
WP_138571565.1|214191_214950_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	68.3	1.3e-61
WP_013525940.1|214934_215576_+	replication P	NA	NA	NA	NA	NA
WP_041174936.1|215572_215797_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_013525939.1|215833_216250_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	84.7	4.7e-63
WP_013525938.1|216342_216885_+	hypothetical protein	NA	D0UIK8	Aggregatibacter_phage	67.2	2.6e-61
WP_005650528.1|216881_217253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174935.1|217352_217535_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_041174934.1|217566_218016_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.3	1.8e-23
WP_041174933.1|218060_218243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525936.1|218880_219780_+	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	53.7	1.5e-77
WP_013525935.1|220766_221123_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_013525934.1|221091_221694_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	53.4	3.7e-56
WP_041174932.1|221686_222010_+	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	54.2	7.8e-21
WP_013525933.1|221921_222203_+	hypothetical protein	NA	Q776X1	Haemophilus_phage	72.2	1.4e-29
WP_006996386.1|222204_222552_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	4.4e-22
WP_005693952.1|222849_223365_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	40.9	5.6e-21
WP_006996384.1|223351_224695_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	53.7	3.1e-124
WP_013525932.1|224696_226028_+	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	84.2	1.5e-211
WP_006996380.1|227768_228125_+	DUF2513 domain-containing protein	NA	A0A1W6JNL0	Staphylococcus_phage	31.7	7.8e-06
WP_041174931.1|228186_229287_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	87.0	4.4e-140
WP_006996378.1|229299_229740_+	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	71.1	2.3e-47
WP_006996377.1|229749_230664_+	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	89.5	1.7e-150
WP_013525929.1|230673_231036_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	66.4	4.4e-33
WP_006996375.1|231036_231483_+	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	72.3	6.7e-55
WP_013525928.1|231479_231851_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	71.5	1.8e-45
WP_013525927.1|231915_232278_+	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	73.9	6.6e-45
WP_013525926.1|232282_233791_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	86.9	3.5e-249
WP_006996370.1|234035_234467_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	93.0	2.9e-71
WP_006996369.1|234466_234877_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	70.8	5.9e-50
WP_013525924.1|235027_237118_+	hypothetical protein	NA	Q7Y5T2	Haemophilus_phage	69.2	6.2e-212
WP_013525923.1|237123_237900_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	66.1	2.0e-83
WP_013525922.1|237905_238214_+	hypothetical protein	NA	D0UII0	Aggregatibacter_phage	80.4	1.9e-45
WP_041174930.1|238296_238476_+	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	94.9	1.9e-21
WP_013525921.1|238490_239363_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	86.6	2.7e-140
WP_013525920.1|239359_240004_+	hypothetical protein	NA	D0UIH7	Aggregatibacter_phage	79.9	1.2e-94
WP_013525919.1|240000_240354_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	87.8	4.8e-56
WP_013525918.1|240538_241057_+	hypothetical protein	NA	A0A0M4REH5	Salmonella_phage	52.0	9.8e-34
WP_013525917.1|241099_242242_+|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	87.1	1.6e-185
WP_005684190.1|242241_242817_+	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	79.1	3.5e-88
WP_013525916.1|242826_245070_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	65.8	7.9e-221
WP_013525647.1|245081_245684_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.0	2.6e-94
WP_013525915.1|245680_246172_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	60.4	3.8e-51
WP_006996123.1|247893_248364_-	hypothetical protein	NA	Q94N00	Haemophilus_virus	39.0	6.6e-21
WP_011961987.1|248363_248597_+	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	68.9	2.1e-20
WP_013525911.1|248608_249316_+	hypothetical protein	NA	A0A0M3LSH7	Mannheimia_phage	55.2	9.9e-61
WP_013525910.1|249439_249856_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	68.6	4.8e-47
WP_074039950.1|250015_250192_+	peptidase	NA	NA	NA	NA	NA
WP_013525909.1|250229_251027_-|holin	LPS cholinephosphotransferase	holin	A0A1V0SD50	Indivirus	37.4	1.1e-07
258048:258065	attR	AAAGTGCGGTCAATTTTC	NA	NA	NA	NA
>prophage 3
NZ_CP043770	Haemophilus influenzae biotype aegyptius strain HE7/F1946 chromosome, complete genome	1985844	655133	748119	1985844	integrase,transposase,terminase,tRNA,plate,tail	Burkholderia_virus(16.67%)	102	661121:661147	738121:738147
WP_005657715.1|655133_655634_-	hypothetical protein	NA	A0A0M3LP76	Mannheimia_phage	53.6	1.9e-10
WP_005660793.1|655844_656072_+	DNA-binding protein	NA	A0A0M3LPY8	Mannheimia_phage	69.0	2.1e-20
WP_013525667.1|656082_658092_+|transposase	transposase	transposase	M4M9R2	Vibrio_phage	35.7	1.8e-99
WP_041174903.1|659034_659238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525664.1|659259_659778_+	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	58.1	5.4e-48
WP_041174902.1|659882_660080_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041174901.1|660244_660463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525663.1|660535_660910_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	51.2	5.3e-29
WP_041174900.1|660910_661141_+	DUF551 domain-containing protein	NA	A0A2H4FNA9	Salmonella_phage	34.7	9.4e-05
661121:661147	attL	CCACAACCACCGGAGGAATAAATTATG	NA	NA	NA	NA
WP_041174899.1|661144_661432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658929.1|661541_662030_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	31.7	4.8e-14
WP_005658927.1|662033_662408_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	46.2	1.9e-23
WP_005658925.1|662481_662901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525661.1|662987_663524_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.0	7.2e-72
WP_041174898.1|663763_663994_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	69.3	4.4e-18
WP_005658911.1|664370_664679_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	39.4	6.3e-12
WP_005658909.1|664675_664978_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	52.0	3.1e-24
WP_005658907.1|664987_665536_+	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	40.3	5.9e-29
WP_005658905.1|665519_666842_+|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	64.2	1.8e-148
WP_013525659.1|666843_668259_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	45.0	1.3e-112
WP_013525658.1|668259_669537_+	mu gp30-like protein	NA	J9STS2	Pseudomonas_phage	47.6	2.8e-53
WP_041174897.1|669723_669912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005661604.1|670114_670615_+	phage virion morphogenesis protein	NA	G8GWE3	Rhodobacter_phage	31.5	3.8e-14
WP_013525657.1|670857_671961_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	39.2	1.2e-65
WP_013525656.1|671979_672906_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	1.0e-73
WP_013525655.1|672971_673289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658887.1|673288_673723_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	36.4	4.4e-19
WP_005658884.1|673734_674232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005661612.1|674241_675627_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	44.3	5.2e-98
WP_013525654.1|675637_676156_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.6	1.1e-37
WP_005640664.1|676249_676534_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_086935107.1|676511_676664_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_041174896.1|676648_676963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525653.1|677008_679600_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.6	1.7e-41
WP_013525652.1|679599_680532_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016533315.1|680512_680743_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	47.8	7.2e-13
WP_013525651.1|680735_681800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005658861.1|681786_682395_+|plate	phage baseplate assembly protein V	plate	A0A291LA20	Bordetella_phage	42.1	2.2e-08
WP_013525650.1|682449_682815_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_013525649.1|682814_683921_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	36.2	2.3e-56
WP_005658855.1|683913_684483_+|tail	tail fiber protein	tail	A4JWL7	Burkholderia_virus	45.3	4.5e-40
WP_013525648.1|684514_686224_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	65.9	2.2e-154
WP_013525647.1|686235_686838_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.0	2.6e-94
WP_013525646.1|686834_687335_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	60.4	8.5e-51
WP_041174895.1|687510_687630_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013525645.1|687686_688532_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	71.7	4.0e-117
WP_041174894.1|688571_688835_-	hypothetical protein	NA	F6MIM3	Haemophilus_phage	76.7	7.2e-33
WP_013525643.1|689682_691038_-	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
WP_013525642.1|691034_691697_-	response regulator	NA	NA	NA	NA	NA
WP_006995783.1|691760_692126_-	YgiW/YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_111723596.1|692240_692423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005654343.1|692626_693127_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_013525641.1|693186_694914_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.6	9.6e-17
WP_013525640.1|694993_695251_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013525639.1|695409_696450_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_013525638.1|696520_697069_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	4.5e-29
WP_013525637.1|697374_698442_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_013525636.1|698516_701108_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_005649958.1|701201_702008_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_005670302.1|702143_702488_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	48.6	1.7e-26
WP_010869281.1|702489_702843_+	YacL family protein	NA	NA	NA	NA	NA
WP_013525634.1|702849_705198_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_005688052.1|705363_706236_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.0	1.1e-50
WP_005688053.1|706391_707726_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	79.4	8.4e-53
WP_005688055.1|707796_708990_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_005688057.1|709033_709771_-	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_013525633.1|709757_710687_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_013525632.1|710683_711325_-	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_041174892.1|711557_712430_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_013525631.1|712407_714387_-	exoribonuclease II	NA	NA	NA	NA	NA
WP_005649928.1|714468_715257_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013525630.1|715435_717019_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.1	2.6e-29
WP_005632089.1|717094_717328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525629.1|717430_717760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005665596.1|717756_718491_-	azaleucine resistance protein AzlC	NA	NA	NA	NA	NA
WP_005654899.1|718500_719430_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013525628.1|725635_727771_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_013525627.1|728164_729274_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_005690258.1|729258_730044_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	NA	NA	NA	NA
WP_013525626.1|730221_731229_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_005653606.1|731278_731785_-	DUF2301 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_013525625.1|731897_733259_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_013525624.1|733643_734834_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_005658075.1|735108_735666_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005641600.1|736318_737344_-|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.4	7.4e-57
WP_005651299.1|737241_737556_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013525623.1|737685_738123_-	hypothetical protein	NA	A0A2K9V3W6	Faecalibacterium_phage	37.6	2.0e-24
WP_005668271.1|738126_738396_-	hypothetical protein	NA	NA	NA	NA	NA
738121:738147	attR	CATAATTTATTCCTCCGGTGGTTGTGG	NA	NA	NA	NA
WP_041174991.1|738660_739149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651292.1|739265_739682_-	hypothetical protein	NA	E5E463	Acinetobacter_phage	65.2	1.3e-07
WP_012054998.1|739729_741004_-	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	46.9	7.7e-96
WP_013525621.1|741011_741371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525620.1|741367_741604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525619.1|741600_742170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525618.1|742448_743525_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	61.9	7.3e-07
WP_013525617.1|743586_744021_-	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	7.5e-19
WP_013525616.1|744020_744671_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	71.6	1.2e-84
WP_013525615.1|744645_745596_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	68.3	1.0e-108
WP_041174891.1|745608_745902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525614.1|745898_746246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525613.1|746259_746997_-	site-specific DNA-methyltransferase	NA	A0A0E3U2R2	Fusobacterium_phage	77.5	5.2e-113
WP_013525612.1|747087_748119_-	endonuclease	NA	D0UIK6	Aggregatibacter_phage	82.8	5.2e-42
>prophage 4
NZ_CP043770	Haemophilus influenzae biotype aegyptius strain HE7/F1946 chromosome, complete genome	1985844	751452	789482	1985844	plate,tail,tRNA,terminase	Pseudomonas_phage(15.15%)	50	NA	NA
WP_013525608.1|751452_752040_-	recombinase NinG	NA	A0A2I7RAC0	Vibrio_phage	48.5	1.7e-37
WP_005651114.1|752132_752549_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	84.7	1.1e-62
WP_005633909.1|752585_752810_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_013525607.1|752806_753448_-	replication P	NA	NA	NA	NA	NA
WP_013525606.1|753432_754215_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	45.1	4.3e-41
WP_013525605.1|754216_754450_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	60.3	2.3e-14
WP_005651123.1|754495_754948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995067.1|754991_755198_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	48.3	8.7e-10
WP_013525604.1|755331_756300_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	30.4	2.4e-17
WP_013525603.1|756722_757049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525602.1|757035_757440_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	68.7	3.9e-46
WP_013527467.1|757436_757826_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_013525600.1|757800_758031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012054986.1|758042_759398_+	ParB N-terminal domain-containing protein	NA	A0A0E3U266	Fusobacterium_phage	44.8	1.8e-98
WP_005692583.1|759394_759616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651145.1|759673_760042_+	LuxR family transcriptional regulator	NA	A0A0R6PHW5	Moraxella_phage	39.3	3.4e-12
WP_013525599.1|760022_761372_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.2	5.5e-145
WP_013525598.1|761373_762690_+	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	32.0	1.8e-47
WP_041174890.1|762670_763888_+	hypothetical protein	NA	A0A2D2W1Z9	Sinorhizobium_phage	38.0	2.6e-24
WP_005692574.1|764013_765087_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.2	1.2e-54
WP_013525596.1|765099_765519_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_013525595.1|765526_766528_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	36.2	2.9e-50
WP_005692571.1|766530_766719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525594.1|766722_767073_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_013525593.1|767065_767524_+	hypothetical protein	NA	A0A2I7R754	Vibrio_phage	34.5	4.1e-15
WP_013525592.1|767523_767883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525591.1|767884_768394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525590.1|768380_769454_+	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	41.0	4.8e-59
WP_005643344.1|769499_769925_+	DUF3277 family protein	NA	A0A0A1IUI2	Pseudomonas_phage	36.9	2.6e-16
WP_013525589.1|769924_770407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525588.1|770591_773009_+	tape measure protein	NA	H9EB42	Vibrio_phage	28.0	1.6e-33
WP_013525587.1|773083_773806_-	hypothetical protein	NA	A6XMM0	Bacillus_virus	46.4	5.8e-24
WP_013525586.1|773967_774549_+	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	28.4	1.5e-06
WP_013525585.1|774545_774860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525584.1|774856_775819_+	hypothetical protein	NA	E5AGC0	Erwinia_phage	29.9	5.9e-32
WP_013525583.1|775815_776487_+|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	32.6	2.6e-18
WP_005643324.1|776483_776849_+	hypothetical protein	NA	A0A1J0MEY0	Pectobacterium_phage	35.4	1.4e-10
WP_013525582.1|776841_778278_+	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	28.2	1.4e-45
WP_012054979.1|778286_778901_+	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	37.4	1.0e-21
WP_013525581.1|778910_781280_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	60.1	9.9e-214
WP_013525580.1|781291_781894_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	94.5	5.0e-98
WP_013525579.1|781890_782349_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.8	4.9e-45
WP_005691741.1|782996_783722_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_013525578.1|783774_784227_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_013525577.1|784294_785509_+	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	36.0	5.1e-33
WP_005691745.1|785532_785949_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.6	2.0e-53
WP_005688927.1|786006_786330_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.8	1.3e-23
WP_005662651.1|786342_786867_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_013525576.1|786917_787604_+	DUF2625 domain-containing protein	NA	NA	NA	NA	NA
WP_013525575.1|787622_789482_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.5	1.4e-109
>prophage 5
NZ_CP043770	Haemophilus influenzae biotype aegyptius strain HE7/F1946 chromosome, complete genome	1985844	840152	849045	1985844	tRNA	Tupanvirus(16.67%)	10	NA	NA
WP_013525543.1|840152_841919_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	23.4	5.6e-12
WP_014550473.1|841952_842417_+	dihydroneopterin triphosphate diphosphatase	NA	A0A248SJK4	Salicola_phage	30.4	6.6e-05
WP_005649034.1|842576_843317_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005659992.1|843363_843936_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	27.2	7.1e-09
WP_013525542.1|843998_844613_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_013525541.1|844620_845628_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	2.8e-08
WP_005659998.1|845679_845967_-	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_013525540.1|846139_847033_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.1	1.9e-32
WP_013525539.1|847063_848230_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_013525538.1|848229_849045_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	29.2	2.4e-18
>prophage 6
NZ_CP043770	Haemophilus influenzae biotype aegyptius strain HE7/F1946 chromosome, complete genome	1985844	955910	1024850	1985844	integrase,head,capsid,holin,portal,tRNA,tail	Haemophilus_virus(56.1%)	67	982814:982831	1004818:1004835
WP_013525482.1|955910_957200_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.4	8.6e-95
WP_013525481.1|957554_957896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011271885.1|957985_958465_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_013525480.1|958466_959237_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_032828395.1|959365_960628_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_011271882.1|960908_962288_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_013525479.1|962512_965539_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.7	4.7e-19
WP_011271880.1|965638_966889_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006995664.1|967060_968524_-	ATPase	NA	A0A1B3AYT3	Gordonia_phage	30.9	9.2e-45
WP_013525478.1|968652_971025_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.4	5.2e-21
WP_013525477.1|971200_971956_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_086935051.1|972256_974152_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	9.9e-116
WP_011961808.1|974230_974575_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_011961809.1|974602_975736_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011961810.1|975737_976418_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_080334646.1|976452_977508_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	2.8e-27
WP_013525475.1|977509_979030_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011961812.1|979147_980146_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013525474.1|980297_981854_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_083071253.1|982368_982983_+	hemagglutinin	NA	NA	NA	NA	NA
982814:982831	attL	AAAGTGCGGTCAATTCTG	NA	NA	NA	NA
WP_013525473.1|983091_983847_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013525472.1|983920_984622_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_013525471.1|984935_987383_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_005654296.1|987395_988340_+	homoserine kinase	NA	NA	NA	NA	NA
WP_013525470.1|988382_989660_+	threonine synthase	NA	NA	NA	NA	NA
WP_013525469.1|990208_991222_-|integrase	site-specific integrase	integrase	P79671	Haemophilus_phage	96.1	2.2e-186
WP_041174886.1|991224_991518_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_041174885.1|991517_991745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041174884.1|991781_991985_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_041174883.1|991984_992227_-	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	59.5	6.0e-18
WP_013525467.1|992571_992946_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_041174882.1|993068_993260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174881.1|993256_993496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525466.1|993628_994132_+	hypothetical protein	NA	P79675	Haemophilus_phage	91.6	5.7e-79
WP_013525465.1|994150_994486_+	hypothetical protein	NA	P79676	Haemophilus_phage	94.6	1.6e-56
WP_013525464.1|994546_996886_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	94.1	0.0e+00
WP_013525463.1|996897_997203_+	hypothetical protein	NA	Q94MZ9	Haemophilus_virus	78.8	5.8e-34
WP_013525462.1|997212_997731_+	phage N-6-adenine-methyltransferase	NA	Q94MZ8	Haemophilus_virus	97.0	1.0e-94
WP_041174880.1|997810_997990_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	72.9	2.2e-17
WP_013525461.1|998053_998461_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	66.7	4.7e-47
WP_013525460.1|998491_998752_-	ogr/Delta-like zinc finger family protein	NA	Q1I103	Pasteurella_virus	52.4	4.3e-22
WP_013525459.1|998833_999868_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	98.6	6.9e-196
WP_013525457.1|1001865_1002753_+|capsid	phage capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	68.0	4.0e-91
WP_013525456.1|1002756_1003767_+|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	94.9	1.4e-180
WP_013525454.1|1004618_1005071_+|head	head completion/stabilization protein	head	Q94MZ2	Haemophilus_virus	96.7	3.4e-75
1004818:1004835	attR	AAAGTGCGGTCAATTCTG	NA	NA	NA	NA
WP_138571532.1|1005076_1005541_+|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	62.7	1.1e-52
WP_013525452.1|1005537_1006263_+	phage virion morphogenesis protein	NA	Q1I0Z5	Pasteurella_virus	32.1	1.8e-17
WP_013525451.1|1006524_1007655_+	DUF2586 domain-containing protein	NA	Q94MY9	Haemophilus_virus	97.3	2.1e-214
WP_013525450.1|1007658_1008111_+	DUF2597 family protein	NA	Q94MY8	Haemophilus_virus	95.8	1.2e-72
WP_041174879.1|1008197_1008434_+|holin	holin	holin	Q94MY7	Haemophilus_virus	97.4	5.3e-35
WP_013525449.1|1008426_1008987_+	lysozyme	NA	Q94MY6	Haemophilus_virus	92.7	2.5e-91
WP_013525448.1|1008971_1009319_+	hypothetical protein	NA	Q94MY5	Haemophilus_virus	89.6	3.0e-47
WP_013525447.1|1009499_1009808_+	hypothetical protein	NA	Q775G2	Haemophilus_virus	98.0	3.5e-47
WP_013525446.1|1009994_1012271_+|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	76.1	3.5e-309
WP_013525445.1|1012274_1012610_+	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	94.6	2.8e-50
WP_013525444.1|1012602_1013772_+	hypothetical protein	NA	Q94MY2	Haemophilus_virus	92.7	1.1e-205
WP_013525443.1|1013781_1014306_+	hypothetical protein	NA	Q94MY1	Haemophilus_virus	97.7	3.5e-95
WP_013525442.1|1014332_1017014_+|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	63.9	0.0e+00
WP_050780969.1|1017059_1017371_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	37.3	1.2e-05
WP_013525440.1|1017387_1017666_-	peptidase	NA	A0A0M3LQB1	Mannheimia_phage	46.7	2.6e-17
WP_013525439.1|1017744_1018359_+	hypothetical protein	NA	Q7Y5S1	Haemophilus_phage	45.6	2.1e-19
WP_013525438.1|1018337_1018607_+	hypothetical protein	NA	Q776W9	Haemophilus_phage	74.4	5.3e-31
WP_041174878.1|1018625_1019393_+	hypothetical protein	NA	Q94MX8	Haemophilus_virus	98.8	7.3e-134
WP_013525436.1|1019379_1019940_+	hypothetical protein	NA	Q94MX7	Haemophilus_virus	97.3	3.6e-82
WP_013525435.1|1019940_1021542_+	hypothetical protein	NA	Q94MX6	Haemophilus_virus	98.7	4.0e-283
WP_081457578.1|1022696_1023842_+	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_013525433.1|1023854_1024850_+	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	39.6	6.4e-66
>prophage 7
NZ_CP043770	Haemophilus influenzae biotype aegyptius strain HE7/F1946 chromosome, complete genome	1985844	1828998	1844718	1985844	tail,terminase,head	Haemophilus_phage(58.82%)	25	NA	NA
WP_005647090.1|1828998_1829190_+	HTH domain-containing protein	NA	F6MII8	Haemophilus_phage	57.6	9.5e-11
WP_013526168.1|1829190_1829808_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	58.8	6.8e-66
WP_006996621.1|1829994_1830192_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006996623.1|1830363_1830537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006996624.1|1830541_1830790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013526167.1|1831030_1831429_+	regulatory protein GemA	NA	F6MIJ6	Haemophilus_phage	43.7	5.3e-19
WP_006996626.1|1831455_1831659_+	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_013526166.1|1832195_1832837_+	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	41.8	3.7e-22
WP_005641522.1|1832847_1833066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174961.1|1833191_1833368_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	87.9	5.9e-23
WP_013526165.1|1833422_1833839_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	75.2	3.8e-52
WP_013526164.1|1833950_1834379_+	hypothetical protein	NA	F6MIJ8	Haemophilus_phage	42.3	2.5e-27
WP_013526163.1|1834459_1834963_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	63.1	4.9e-54
WP_041174960.1|1835116_1835407_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	61.4	3.3e-15
WP_013526161.1|1835406_1835664_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_005684166.1|1835787_1836045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005661915.1|1836044_1836311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013526160.1|1836312_1836813_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	51.8	4.1e-45
WP_013526159.1|1836962_1838612_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	79.7	1.1e-248
WP_013526158.1|1840296_1841613_+|head	head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	67.7	2.0e-168
WP_013526157.1|1841755_1842109_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	67.9	3.1e-23
WP_086935082.1|1841996_1842986_+	I protein	NA	A0A0M3LPA7	Mannheimia_phage	45.6	5.8e-67
WP_013526155.1|1842985_1843906_+|tail	tail sheath protein	tail	A0A0M3LQ11	Mannheimia_phage	62.9	1.0e-110
WP_013526154.1|1843941_1844277_+	hypothetical protein	NA	B7SDP3	Haemophilus_phage	55.4	4.4e-19
WP_013526153.1|1844286_1844718_+	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	61.6	1.2e-37
